Starting /dee2/code/volunteer_pipeline.sh SRR7169016 current disk space = 3058775392256 free memory = 1338153552 SRR7169016 SRAfilesize 459f7b32b17d9da56581926189a2266b SRR7169016.sra SRR7169016.sra file validated SRR7169016 is paired end SRR7169016 is conventional basespace SRR7169016 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169016_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.778 34.0 33.0 34.0 33.0 34.0 2 33.31775 34.0 34.0 34.0 33.0 34.0 3 33.41975 34.0 34.0 34.0 33.0 34.0 4 33.477 34.0 34.0 34.0 33.0 34.0 5 33.449 34.0 34.0 34.0 33.0 34.0 6 37.15425 38.0 38.0 38.0 36.0 38.0 7 37.35925 38.0 38.0 38.0 37.0 38.0 8 37.54425 38.0 38.0 38.0 37.0 38.0 9 37.541 38.0 38.0 38.0 38.0 38.0 10-14 37.55815 38.0 38.0 38.0 38.0 38.0 15-19 37.5075 38.0 38.0 38.0 37.8 38.0 20-24 37.519000000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.4631 38.0 38.0 38.0 37.8 38.0 30-34 37.469950000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.386500000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.23165 38.0 38.0 38.0 36.6 38.0 45-49 37.2219 38.0 38.0 38.0 36.4 38.0 50-54 37.1553 38.0 38.0 38.0 36.0 38.0 55-59 37.13125 38.0 38.0 38.0 36.0 38.0 60-64 37.06295 38.0 38.0 38.0 36.0 38.0 65-69 36.978249999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.009550000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.88655 38.0 38.0 38.0 35.8 38.0 80-84 36.8086 38.0 38.0 38.0 35.0 38.0 85-89 36.763400000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.6691 38.0 38.0 38.0 34.6 38.0 95-99 36.501 38.0 38.0 38.0 34.2 38.0 100-104 36.355149999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.15045 38.0 37.6 38.0 33.4 38.0 110-114 35.95285 38.0 37.0 38.0 32.8 38.0 115-119 35.80485 38.0 37.0 38.0 32.2 38.0 120-124 35.715599999999995 38.0 36.8 38.0 31.6 38.0 125-129 35.467200000000005 38.0 36.0 38.0 31.0 38.0 130-134 35.166850000000004 38.0 36.0 38.0 29.0 38.0 135-139 34.91605 38.0 35.6 38.0 28.0 38.0 140-144 34.61715 38.0 35.0 38.0 27.6 38.0 145-149 34.077 38.0 35.0 38.0 25.4 38.0 150-151 30.935375 36.5 31.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 0.0 15 5.0 16 2.0 17 5.0 18 4.0 19 4.0 20 5.0 21 5.0 22 9.0 23 12.0 24 12.0 25 6.0 26 16.0 27 17.0 28 19.0 29 37.0 30 36.0 31 46.0 32 55.0 33 83.0 34 156.0 35 238.0 36 706.0 37 2520.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.73285568065507 14.329580348004095 10.9007164790174 32.03684749232344 2 23.5 16.400000000000002 34.2 25.900000000000002 3 18.575 23.200000000000003 26.8 31.424999999999997 4 21.55 30.0 22.85 25.6 5 22.05 33.525 24.2 20.225 6 19.950000000000003 33.074999999999996 25.3 21.675 7 14.649999999999999 27.3 39.875 18.175 8 18.0 26.775 30.049999999999997 25.174999999999997 9 16.650000000000002 26.55 31.175000000000004 25.624999999999996 10-14 19.865 29.415000000000003 27.389999999999997 23.330000000000002 15-19 19.580000000000002 28.705000000000002 27.215 24.5 20-24 19.98 28.970000000000002 27.250000000000004 23.799999999999997 25-29 19.814999999999998 29.065 27.58 23.54 30-34 19.634999999999998 29.5 27.055 23.810000000000002 35-39 19.775000000000002 28.82 27.295 24.11 40-44 20.48 28.749999999999996 26.99 23.78 45-49 20.4 29.275000000000002 26.724999999999998 23.599999999999998 50-54 20.25 28.935 27.125 23.69 55-59 20.43 28.655 27.025 23.89 60-64 20.005 28.825 27.105 24.065 65-69 20.11 28.58 26.939999999999998 24.37 70-74 20.7 28.32 27.189999999999998 23.79 75-79 20.599999999999998 27.450000000000003 27.725 24.224999999999998 80-84 20.435 28.725 26.66 24.18 85-89 20.685000000000002 28.285 27.075 23.955000000000002 90-94 20.57 28.945 26.205000000000002 24.279999999999998 95-99 20.64 27.955000000000002 27.525 23.880000000000003 100-104 20.419999999999998 28.505000000000003 26.63 24.445 105-109 20.435 27.884999999999998 27.505000000000003 24.175 110-114 20.105 28.7 27.089999999999996 24.104999999999997 115-119 20.875 28.465 26.950000000000003 23.71 120-124 20.535 28.505000000000003 26.72 24.240000000000002 125-129 20.93 27.485 27.42 24.165 130-134 20.485 28.21 27.060000000000002 24.245 135-139 20.73 27.73 27.384999999999998 24.154999999999998 140-144 21.37 27.589999999999996 26.93 24.11 145-149 20.880000000000003 28.26 27.029999999999998 23.830000000000002 150-151 21.0 28.15 26.637499999999996 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 3.0 22 3.0 23 2.5 24 3.5 25 2.5 26 3.5 27 6.0 28 11.5 29 21.0 30 23.0 31 32.5 32 43.0 33 47.0 34 64.0 35 69.0 36 80.0 37 106.0 38 125.0 39 148.5 40 174.0 41 201.5 42 228.5 43 237.5 44 237.5 45 252.5 46 262.5 47 243.5 48 221.5 49 195.0 50 174.5 51 155.5 52 127.5 53 107.0 54 81.0 55 63.0 56 53.5 57 44.0 58 37.0 59 27.0 60 17.5 61 14.0 62 12.5 63 12.0 64 8.0 65 3.5 66 2.5 67 2.5 68 3.5 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.8999999999999999 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.5125000000000002 0.0 0.0 0.0 0.0 134-135 1.7125 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169016 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169016_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.029 33.0 33.0 34.0 32.0 34.0 2 33.05225 34.0 33.0 34.0 32.0 34.0 3 33.09425 34.0 33.0 34.0 33.0 34.0 4 33.07925 34.0 33.0 34.0 33.0 34.0 5 33.078 34.0 33.0 34.0 33.0 34.0 6 37.24725 38.0 38.0 38.0 37.0 38.0 7 37.246 38.0 38.0 38.0 37.0 38.0 8 37.22475 38.0 38.0 38.0 37.0 38.0 9 37.21525 38.0 38.0 38.0 37.0 38.0 10-14 37.1651 38.0 38.0 38.0 37.0 38.0 15-19 37.0761 38.0 38.0 38.0 37.0 38.0 20-24 37.093 38.0 38.0 38.0 37.0 38.0 25-29 37.05975 38.0 38.0 38.0 37.0 38.0 30-34 37.06815 38.0 38.0 38.0 37.0 38.0 35-39 37.049350000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.04655 38.0 38.0 38.0 37.0 38.0 45-49 36.9561 38.0 38.0 38.0 36.6 38.0 50-54 36.889300000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.88735 38.0 38.0 38.0 36.0 38.0 60-64 36.84825 38.0 38.0 38.0 36.0 38.0 65-69 36.71685 38.0 38.0 38.0 35.8 38.0 70-74 36.68534999999999 38.0 38.0 38.0 35.6 38.0 75-79 36.6429 38.0 38.0 38.0 35.2 38.0 80-84 36.481350000000006 38.0 38.0 38.0 34.6 38.0 85-89 36.4421 38.0 38.0 38.0 34.4 38.0 90-94 36.3476 38.0 38.0 38.0 34.0 38.0 95-99 36.2077 38.0 38.0 38.0 34.0 38.0 100-104 36.0654 38.0 38.0 38.0 33.8 38.0 105-109 35.943349999999995 38.0 38.0 38.0 33.2 38.0 110-114 35.81345 38.0 37.6 38.0 32.6 38.0 115-119 35.63765 38.0 37.0 38.0 31.8 38.0 120-124 35.277950000000004 38.0 36.6 38.0 29.8 38.0 125-129 35.036950000000004 38.0 36.2 38.0 28.6 38.0 130-134 34.805899999999994 38.0 35.8 38.0 28.0 38.0 135-139 34.4831 38.0 35.6 38.0 26.4 38.0 140-144 33.96545 38.0 35.0 38.0 23.2 38.0 145-149 33.431799999999996 38.0 34.4 38.0 17.8 38.0 150-151 29.173625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 0.0 5 0.0 6 0.0 7 2.0 8 4.0 9 2.0 10 2.0 11 3.0 12 3.0 13 1.0 14 1.0 15 4.0 16 3.0 17 3.0 18 5.0 19 7.0 20 10.0 21 9.0 22 11.0 23 9.0 24 15.0 25 11.0 26 26.0 27 18.0 28 28.0 29 35.0 30 40.0 31 46.0 32 61.0 33 80.0 34 135.0 35 248.0 36 559.0 37 2601.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 22.15 13.575000000000001 24.625 2 26.674999999999997 27.950000000000003 27.925 17.45 3 20.225 30.9 30.075000000000003 18.8 4 23.45 34.55 23.175 18.825 5 25.074999999999996 34.975 21.65 18.3 6 21.65 35.55 24.325 18.475 7 20.625 21.575 37.724999999999994 20.075000000000003 8 23.225 26.200000000000003 26.1 24.474999999999998 9 22.3 25.05 28.7 23.95 10-14 23.830000000000002 28.125 25.724999999999998 22.32 15-19 23.285 28.26 27.255000000000003 21.2 20-24 24.115000000000002 27.755000000000003 27.01 21.12 25-29 24.07 28.105000000000004 26.93 20.895 30-34 24.21 28.634999999999998 26.255 20.9 35-39 23.885 28.225 27.025 20.865000000000002 40-44 23.52 28.225 27.075 21.18 45-49 24.07 27.565 27.860000000000003 20.505000000000003 50-54 24.01 27.57 27.24 21.18 55-59 24.215 27.455000000000002 27.405 20.925 60-64 23.515 27.85 27.725 20.91 65-69 24.37 27.315 27.375 20.94 70-74 24.54 27.125 27.565 20.77 75-79 23.26 27.245 28.08 21.415 80-84 23.765 26.985 28.01 21.240000000000002 85-89 24.425 27.265 27.3 21.01 90-94 23.630000000000003 27.450000000000003 27.735 21.185000000000002 95-99 23.549999999999997 27.88 27.395000000000003 21.175 100-104 24.610000000000003 26.595000000000002 27.99 20.805 105-109 24.355 27.235 27.694999999999997 20.715 110-114 24.23 27.744999999999997 27.595 20.43 115-119 24.169999999999998 27.650000000000002 27.495000000000005 20.685000000000002 120-124 24.26 27.355 27.675 20.71 125-129 24.33 28.08 26.995 20.595 130-134 24.57 27.72 27.38 20.330000000000002 135-139 24.3 27.089999999999996 27.485 21.125 140-144 23.68 27.625 27.74 20.955 145-149 25.145 27.505000000000003 27.05 20.3 150-151 25.087500000000002 27.037499999999998 27.437499999999996 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 1.5 25 1.0 26 1.0 27 0.5 28 2.5 29 4.0 30 8.0 31 13.5 32 19.5 33 25.0 34 38.0 35 46.5 36 63.0 37 80.5 38 89.5 39 137.0 40 192.5 41 211.5 42 233.0 43 271.5 44 295.0 45 295.0 46 286.0 47 276.0 48 255.0 49 219.5 50 187.0 51 158.0 52 129.0 53 111.5 54 96.0 55 69.5 56 46.5 57 32.0 58 26.0 59 25.0 60 14.5 61 7.0 62 7.0 63 6.5 64 3.0 65 2.5 66 1.5 67 1.5 68 3.5 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.1375 0.0 0.0 0.0 0.0 128-129 1.2625000000000002 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911641 spots for SRR7169016.sra Written 911641 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra Read 911623 spots for SRR7169016.sra Written 911623 spots for SRR7169016.sra SRR ids: ['SRR7169016.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xwl9vqpq SRR7169016.sra spots: 18232478 blocks: [[1, 911623], [911624, 1823246], [1823247, 2734869], [2734870, 3646492], [3646493, 4558115], [4558116, 5469738], [5469739, 6381361], [6381362, 7292984], [7292985, 8204607], [8204608, 9116230], [9116231, 10027853], [10027854, 10939476], [10939477, 11851099], [11851100, 12762722], [12762723, 13674345], [13674346, 14585968], [14585969, 15497591], [15497592, 16409214], [16409215, 17320837], [17320838, 18232478]] SRR7169016 file size 6156688 SRR7169016 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169016 SRR7169016_1.fastq SRR7169016_2.fastq Input file: SRR7169016_1.fastq Paired file: SRR7169016_2.fastq trimmed: SRR7169016-trimmed-pair1.fastq, SRR7169016-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:52:09 2025 >> started Mon Feb 10 15:52:29 2025 >> done (19.893s) 18232478 read pairs processed; of these: 37848 ( 0.21%) short read pairs filtered out after trimming by size control 32033 ( 0.18%) empty read pairs filtered out after trimming by size control 18162597 (99.62%) read pairs available; of these: 7261677 (39.98%) trimmed read pairs available after processing 10900920 (60.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 7 0.00% 21 4 0.00% 22 8 0.00% 23 12 0.00% 24 8 0.00% 25 9 0.00% 26 7 0.00% 27 11 0.00% 28 5 0.00% 29 7 0.00% 30 11 0.00% 31 4 0.00% 32 8 0.00% 33 15 0.00% 34 11 0.00% 35 9 0.00% 36 7 0.00% 37 12 0.00% 38 9 0.00% 39 16 0.00% 40 11 0.00% 41 8 0.00% 42 16 0.00% 43 12 0.00% 44 14 0.00% 45 13 0.00% 46 20 0.00% 47 21 0.00% 48 16 0.00% 49 27 0.00% 50 26 0.00% 51 24 0.00% 52 28 0.00% 53 27 0.00% 54 37 0.00% 55 54 0.00% 56 51 0.00% 57 45 0.00% 58 75 0.00% 59 60 0.00% 60 58 0.00% 61 81 0.00% 62 91 0.00% 63 90 0.00% 64 111 0.00% 65 121 0.00% 66 125 0.00% 67 175 0.00% 68 194 0.00% 69 217 0.00% 70 297 0.00% 71 285 0.00% 72 317 0.00% 73 343 0.00% 74 387 0.00% 75 421 0.00% 76 501 0.00% 77 507 0.00% 78 602 0.00% 79 697 0.00% 80 793 0.00% 81 893 0.00% 82 1061 0.01% 83 1322 0.01% 84 2754 0.02% 85 3797 0.02% 86 3894 0.02% 87 3954 0.02% 88 4081 0.02% 89 4129 0.02% 90 4146 0.02% 91 4454 0.02% 92 4501 0.02% 93 4934 0.03% 94 5118 0.03% 95 5349 0.03% 96 5673 0.03% 97 5981 0.03% 98 6211 0.03% 99 6713 0.04% 100 7109 0.04% 101 7494 0.04% 102 7957 0.04% 103 8639 0.05% 104 9188 0.05% 105 9921 0.05% 106 10291 0.06% 107 11008 0.06% 108 11418 0.06% 109 12022 0.07% 110 12752 0.07% 111 13520 0.07% 112 14403 0.08% 113 15658 0.09% 114 16475 0.09% 115 18256 0.10% 116 18731 0.10% 117 19461 0.11% 118 20696 0.11% 119 21346 0.12% 120 22248 0.12% 121 23597 0.13% 122 24871 0.14% 123 26704 0.15% 124 28797 0.16% 125 30270 0.17% 126 31727 0.17% 127 33738 0.19% 128 35156 0.19% 129 36951 0.20% 130 39184 0.22% 131 41515 0.23% 132 44570 0.25% 133 47470 0.26% 134 51064 0.28% 135 55180 0.30% 136 59351 0.33% 137 63032 0.35% 138 68137 0.38% 139 73152 0.40% 140 78780 0.43% 141 87874 0.48% 142 97388 0.54% 143 110493 0.61% 144 127551 0.70% 145 150293 0.83% 146 186323 1.03% 147 249682 1.37% 148 374534 2.06% 149 732446 4.03% 150 3877097 21.35% 151 10900920 60.02% 18162597 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=127.73 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=17.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=22.53 fanout-score-rank=11 prefix-density=0.44 prefix-fanout=8.1 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=338.66 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=19.9 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATA SRR7169016 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:53:17 Started mapping on | Feb 10 15:53:17 Finished on | Feb 10 15:55:25 Mapping speed, Million of reads per hour | 510.82 Number of input reads | 18162597 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16777872 Uniquely mapped reads % | 92.38% Average mapped length | 296.30 Number of splices: Total | 15400798 Number of splices: Annotated (sjdb) | 15133427 Number of splices: GT/AG | 15165695 Number of splices: GC/AG | 187595 Number of splices: AT/AC | 12856 Number of splices: Non-canonical | 34652 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340553 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 32793 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.52% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1073166 1073166 1073166 N_multimapping 340553 340553 340553 N_noFeature 374874 16594218 453430 N_ambiguous 176747 893 71187 UnstrandedReadsAssigned:16226251 PositiveStrandReadsAssigned:182761 NegativeStrandReadsAssigned:16253255 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169016 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169016-trimmed-pair1.fastq SRR7169016-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,162,597 reads, 16,169,307 reads pseudoaligned [quant] estimated average fragment length: 250.057 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7169016.ke.tsv 34699 SRR7169016.se.tsv 87100 total ==> SRR7169016.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.94 294 8.89693 Potri.005G024800.1.v4.1 1035 785.943 39 2.65632 Potri.004G059700.1.v4.1 961 711.956 1 0.0751889 Potri.007G009000.2.v4.1 1416 1166.94 0 0 Potri.003G141000.2.v4.1 2943 2693.94 299.036 5.94213 Potri.016G087400.1.v4.1 270 70.0576 2074 1584.75 Potri.015G069301.1.v4.1 564 318.844 0 0 Potri.010G195200.1.v4.1 1773 1523.94 99 3.47755 Potri.012G127500.1.v4.1 977 727.95 7111 522.921 ==> SRR7169016.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2038 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 367 Potri.001G212900.v4.1 100 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7169016 completed mapping pipeline successfully