Starting /dee2/code/volunteer_pipeline.sh SRR7169017 current disk space = 3058456506368 free memory = 1214328848 SRR7169017 SRAfilesize ed30f9325c2bec6885f2219f6cdc7f3b SRR7169017.sra SRR7169017.sra file validated SRR7169017 is paired end SRR7169017 is conventional basespace SRR7169017 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169017_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26225 34.0 33.0 34.0 33.0 34.0 2 33.498 34.0 34.0 34.0 33.0 34.0 3 33.53075 34.0 34.0 34.0 33.0 34.0 4 33.54 34.0 34.0 34.0 33.0 34.0 5 33.5575 34.0 34.0 34.0 33.0 34.0 6 37.27225 38.0 38.0 38.0 36.0 38.0 7 37.433 38.0 38.0 38.0 37.0 38.0 8 37.42525 38.0 38.0 38.0 37.0 38.0 9 37.47475 38.0 38.0 38.0 37.0 38.0 10-14 37.52655 38.0 38.0 38.0 38.0 38.0 15-19 37.546299999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.49665 38.0 38.0 38.0 38.0 38.0 25-29 37.4659 38.0 38.0 38.0 37.8 38.0 30-34 37.437799999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.2871 38.0 38.0 38.0 36.8 38.0 40-44 37.25405 38.0 38.0 38.0 37.0 38.0 45-49 37.249700000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.159499999999994 38.0 38.0 38.0 36.8 38.0 55-59 37.1139 38.0 38.0 38.0 36.0 38.0 60-64 37.078649999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.93455 38.0 38.0 38.0 36.0 38.0 70-74 36.8943 38.0 38.0 38.0 35.8 38.0 75-79 36.7241 38.0 38.0 38.0 35.2 38.0 80-84 36.57235 38.0 38.0 38.0 34.8 38.0 85-89 36.419200000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.286500000000004 38.0 38.0 38.0 33.8 38.0 95-99 36.161 38.0 37.8 38.0 33.4 38.0 100-104 35.81145 38.0 37.0 38.0 31.4 38.0 105-109 35.5098 38.0 37.0 38.0 30.0 38.0 110-114 35.0308 38.0 36.2 38.0 28.2 38.0 115-119 34.687349999999995 38.0 36.0 38.0 26.8 38.0 120-124 34.10425 38.0 34.4 38.0 23.8 38.0 125-129 33.69315 38.0 34.0 38.0 21.2 38.0 130-134 33.01245 38.0 33.0 38.0 17.0 38.0 135-139 31.99905 38.0 31.2 38.0 13.4 38.0 140-144 31.028999999999996 36.4 28.6 38.0 12.4 38.0 145-149 29.126150000000003 36.0 26.6 38.0 2.0 38.0 150-151 21.137125 19.0 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 2.0 13 0.0 14 6.0 15 0.0 16 4.0 17 2.0 18 11.0 19 15.0 20 14.0 21 9.0 22 8.0 23 9.0 24 20.0 25 26.0 26 25.0 27 30.0 28 42.0 29 39.0 30 52.0 31 77.0 32 95.0 33 145.0 34 236.0 35 457.0 36 1083.0 37 1590.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.671701913393758 10.42296072507553 17.245720040281974 40.659617321248746 2 21.275 15.25 33.35 30.125 3 19.35 22.825 25.025 32.800000000000004 4 22.175 31.45 21.349999999999998 25.025 5 22.50562640660165 35.28382095523881 22.18054513628407 20.030007501875467 6 19.05 36.825 25.2 18.925 7 14.924999999999999 28.65 39.725 16.7 8 20.200000000000003 25.35 30.5 23.95 9 18.525 25.124999999999996 32.95 23.400000000000002 10-14 19.6 31.28 26.58 22.54 15-19 19.495 29.99 27.485 23.03 20-24 19.5 29.21 27.52 23.77 25-29 19.74 30.035 26.965 23.26 30-34 19.950000000000003 30.049999999999997 26.490000000000002 23.51 35-39 20.25 29.29 27.11 23.35 40-44 19.805 29.435 27.35 23.41 45-49 20.29 29.020000000000003 27.015 23.674999999999997 50-54 20.119999999999997 29.18 27.345000000000002 23.355 55-59 19.845 29.505 27.48 23.169999999999998 60-64 20.1 29.34 27.1 23.46 65-69 20.515 29.99 26.77 22.725 70-74 20.555 28.985 26.924999999999997 23.535 75-79 20.355 28.810000000000002 27.295 23.54 80-84 20.150000000000002 29.15 26.8 23.9 85-89 20.09 28.675 27.83 23.405 90-94 20.03 28.965000000000003 26.83 24.175 95-99 20.205000000000002 28.410000000000004 27.565 23.82 100-104 20.810000000000002 28.51 27.005000000000003 23.674999999999997 105-109 20.375 28.939999999999998 27.229999999999997 23.455000000000002 110-114 19.99 28.74 27.095000000000002 24.175 115-119 20.345 28.865000000000002 27.315 23.474999999999998 120-124 21.029999999999998 28.065 26.674999999999997 24.23 125-129 20.94 27.975 27.36 23.724999999999998 130-134 20.865000000000002 28.32 27.034999999999997 23.78 135-139 20.369999999999997 28.854999999999997 27.24 23.535 140-144 20.765 27.82 27.765 23.65 145-149 20.735 28.084999999999997 26.97 24.21 150-151 21.175 28.1 27.075 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 1.5 25 4.0 26 8.0 27 11.5 28 17.5 29 19.5 30 21.0 31 29.5 32 40.0 33 54.5 34 64.0 35 78.5 36 95.0 37 109.0 38 128.5 39 154.0 40 192.0 41 215.5 42 235.0 43 255.0 44 271.5 45 276.0 46 266.0 47 244.0 48 219.0 49 194.0 50 169.0 51 143.5 52 110.0 53 89.0 54 78.5 55 59.0 56 35.0 57 26.5 58 19.0 59 14.5 60 13.0 61 10.5 62 7.5 63 2.0 64 0.5 65 1.5 66 1.5 67 2.0 68 3.0 69 1.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44556451612904 98.65 2 0.5040322580645161 1.0 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025201612903225805 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCTCCATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.7374999999999998 0.0 0.0 0.0 0.0 130-131 1.9249999999999998 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.3875 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138-139 3.0875000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGCCAC 10 0.006830828 145.0 1 >>END_MODULE SRR7169017 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169017_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83425 33.0 33.0 34.0 32.0 34.0 2 32.9555 34.0 33.0 34.0 32.0 34.0 3 32.86825 34.0 33.0 34.0 31.0 34.0 4 32.8555 34.0 33.0 34.0 32.0 34.0 5 32.81225 34.0 33.0 34.0 31.0 34.0 6 36.95275 38.0 38.0 38.0 36.0 38.0 7 37.0035 38.0 38.0 38.0 37.0 38.0 8 37.08025 38.0 38.0 38.0 37.0 38.0 9 37.1085 38.0 38.0 38.0 37.0 38.0 10-14 36.9996 38.0 38.0 38.0 37.0 38.0 15-19 36.936 38.0 38.0 38.0 36.6 38.0 20-24 36.833349999999996 38.0 38.0 38.0 36.2 38.0 25-29 36.84025 38.0 38.0 38.0 36.0 38.0 30-34 36.7799 38.0 38.0 38.0 36.0 38.0 35-39 36.73345 38.0 38.0 38.0 36.0 38.0 40-44 36.6781 38.0 38.0 38.0 35.8 38.0 45-49 36.556200000000004 38.0 38.0 38.0 35.0 38.0 50-54 36.394000000000005 38.0 38.0 38.0 34.4 38.0 55-59 36.3836 38.0 38.0 38.0 34.2 38.0 60-64 36.20265 38.0 38.0 38.0 33.8 38.0 65-69 35.99615 38.0 37.8 38.0 33.4 38.0 70-74 35.84595 38.0 37.8 38.0 33.0 38.0 75-79 35.639300000000006 38.0 37.0 38.0 31.2 38.0 80-84 35.487649999999995 38.0 37.0 38.0 30.6 38.0 85-89 35.302550000000004 38.0 36.6 38.0 29.4 38.0 90-94 34.95765 38.0 36.0 38.0 28.4 38.0 95-99 34.62495 38.0 35.8 38.0 26.4 38.0 100-104 33.92995 38.0 34.4 38.0 20.8 38.0 105-109 33.47580000000001 38.0 33.2 38.0 18.8 38.0 110-114 32.8814 38.0 32.8 38.0 14.8 38.0 115-119 31.92235 37.8 30.6 38.0 13.8 38.0 120-124 30.951749999999997 37.0 28.2 38.0 12.6 38.0 125-129 29.738 36.0 25.6 38.0 11.2 38.0 130-134 28.616949999999996 34.0 22.2 38.0 5.6 38.0 135-139 27.9329 33.4 20.8 38.0 2.0 38.0 140-144 26.12405 33.0 13.4 38.0 2.0 38.0 145-149 23.6207 31.4 6.0 38.0 2.0 38.0 150-151 17.197875 15.5 2.0 33.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 4.0 4 4.0 5 5.0 6 4.0 7 3.0 8 3.0 9 4.0 10 1.0 11 5.0 12 3.0 13 3.0 14 7.0 15 13.0 16 12.0 17 13.0 18 21.0 19 16.0 20 18.0 21 25.0 22 18.0 23 28.0 24 29.0 25 38.0 26 40.0 27 42.0 28 62.0 29 84.0 30 104.0 31 138.0 32 153.0 33 283.0 34 457.0 35 688.0 36 1041.0 37 615.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.7 12.475 27.750000000000004 31.075000000000003 2 30.873154866149612 15.561671253440078 32.524393294971226 21.04078058543908 3 23.1981981981982 22.17217217217217 34.28428428428428 20.345345345345343 4 24.7997997997998 28.77877877877878 24.624624624624623 21.796796796796798 5 24.2992992992993 33.58358358358358 23.1981981981982 18.91891891891892 6 21.80545136284071 36.284071017754435 22.95573893473368 18.95473868467117 7 20.505126281570394 20.330082520630157 38.30957739434859 20.855213803450862 8 22.58064516129032 24.706176544136035 26.756689172293076 25.95648912228057 9 23.605901475368842 25.056264066016503 27.68192048012003 23.655913978494624 10-14 22.97 27.68 26.995 22.355 15-19 23.04 27.334999999999997 27.855 21.77 20-24 23.118467770165523 27.704155623343503 28.059208881332196 21.118167725158774 25-29 23.035 28.044999999999998 27.779999999999998 21.14 30-34 22.922292229222922 27.94279427942794 28.07780778077808 21.057105710571054 35-39 23.016150807540377 27.631381569078457 27.91139556977849 21.44107205360268 40-44 23.386169308465423 27.51637581879094 28.061403070153506 21.03605180259013 45-49 22.862286228622864 26.972697269726975 28.092809280928094 22.072207220722074 50-54 23.36 27.405 27.955000000000002 21.279999999999998 55-59 23.236161808090404 27.716385819290963 28.106405320266013 20.94104705235262 60-64 23.026151307565378 28.186409320466023 27.626381319065953 21.161058052902646 65-69 23.345 27.755000000000003 27.71 21.19 70-74 23.086154307715386 27.546377318865943 27.936396819840994 21.43107155357768 75-79 23.551177558877946 27.651382569128458 27.541377068853446 21.256062803140157 80-84 23.57 27.185 28.13 21.115000000000002 85-89 22.402240224022403 27.29272927292729 27.972797279727974 22.33223322332233 90-94 23.105 27.715 28.04 21.14 95-99 23.62 27.565 27.700000000000003 21.115000000000002 100-104 22.985 27.779999999999998 28.27 20.965 105-109 23.369999999999997 27.575 27.810000000000002 21.245 110-114 23.605 27.725 27.565 21.105 115-119 23.97239723972397 27.34773477347735 27.772777277727773 20.907090709070907 120-124 23.704740948189638 27.985597119423883 27.580516103220642 20.729145829165834 125-129 23.352005601680503 27.628288486545966 28.023407022106632 20.9962988896669 130-134 24.033605040756115 26.884032604890734 28.18422763414512 20.89813472020803 135-139 24.056202810140505 27.26136306815341 28.041402070103505 20.641032051602583 140-144 24.15120756037802 27.521376068803438 27.50637531876594 20.821041052052603 145-149 23.494999999999997 27.875 27.834999999999997 20.794999999999998 150-151 25.15 27.250000000000004 26.987499999999997 20.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 1.0 23 2.0 24 1.5 25 3.5 26 4.5 27 4.5 28 4.5 29 7.0 30 15.0 31 18.5 32 25.0 33 33.0 34 40.5 35 57.0 36 67.0 37 86.0 38 123.0 39 158.0 40 189.0 41 217.5 42 240.5 43 253.0 44 275.0 45 293.5 46 297.0 47 278.5 48 238.5 49 192.0 50 162.0 51 150.5 52 123.5 53 95.5 54 77.5 55 58.0 56 39.0 57 30.5 58 26.5 59 21.0 60 16.0 61 12.0 62 10.0 63 7.5 64 4.0 65 4.0 66 4.5 67 3.5 68 2.0 69 1.0 70 2.0 71 3.0 72 1.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 1.0 87 0.5 88 1.0 89 1.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.1 4 0.1 5 0.1 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.01 35-39 0.005 40-44 0.005 45-49 0.01 50-54 0.0 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.005 75-79 0.005 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.02 125-129 0.03 130-134 0.015 135-139 0.005 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59758551307847 99.0 2 0.35211267605633806 0.7000000000000001 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025150905432595575 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.23750000000000002 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.6124999999999998 0.0 0.0 0.0 0.0 130-131 1.7999999999999998 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.2750000000000004 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.0076550315 18.125 135-139 >>END_MODULE Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797639 spots for SRR7169017.sra Written 797639 spots for SRR7169017.sra Read 797654 spots for SRR7169017.sra Written 797654 spots for SRR7169017.sra SRR ids: ['SRR7169017.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kkdb5nyp SRR7169017.sra spots: 15952795 blocks: [[1, 797639], [797640, 1595278], [1595279, 2392917], [2392918, 3190556], [3190557, 3988195], [3988196, 4785834], [4785835, 5583473], [5583474, 6381112], [6381113, 7178751], [7178752, 7976390], [7976391, 8774029], [8774030, 9571668], [9571669, 10369307], [10369308, 11166946], [11166947, 11964585], [11964586, 12762224], [12762225, 13559863], [13559864, 14357502], [14357503, 15155141], [15155142, 15952795]] SRR7169017 file size 5384178 SRR7169017 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169017 SRR7169017_1.fastq SRR7169017_2.fastq Input file: SRR7169017_1.fastq Paired file: SRR7169017_2.fastq trimmed: SRR7169017-trimmed-pair1.fastq, SRR7169017-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:26:11 2025 >> started Mon Feb 10 16:26:31 2025 >> done (20.046s) 15952795 read pairs processed; of these: 35672 ( 0.22%) short read pairs filtered out after trimming by size control 99287 ( 0.62%) empty read pairs filtered out after trimming by size control 15817836 (99.15%) read pairs available; of these: 6878989 (43.49%) trimmed read pairs available after processing 8938847 (56.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 16 0.00% 20 15 0.00% 21 8 0.00% 22 14 0.00% 23 9 0.00% 24 14 0.00% 25 12 0.00% 26 18 0.00% 27 15 0.00% 28 12 0.00% 29 14 0.00% 30 20 0.00% 31 15 0.00% 32 13 0.00% 33 15 0.00% 34 19 0.00% 35 22 0.00% 36 23 0.00% 37 15 0.00% 38 20 0.00% 39 22 0.00% 40 22 0.00% 41 50 0.00% 42 29 0.00% 43 36 0.00% 44 56 0.00% 45 57 0.00% 46 74 0.00% 47 62 0.00% 48 81 0.00% 49 86 0.00% 50 107 0.00% 51 121 0.00% 52 104 0.00% 53 126 0.00% 54 121 0.00% 55 155 0.00% 56 158 0.00% 57 171 0.00% 58 310 0.00% 59 496 0.00% 60 464 0.00% 61 536 0.00% 62 283 0.00% 63 259 0.00% 64 343 0.00% 65 465 0.00% 66 471 0.00% 67 677 0.00% 68 1058 0.01% 69 1838 0.01% 70 1273 0.01% 71 738 0.00% 72 710 0.00% 73 839 0.01% 74 853 0.01% 75 899 0.01% 76 1062 0.01% 77 1085 0.01% 78 1225 0.01% 79 1440 0.01% 80 1481 0.01% 81 1701 0.01% 82 1926 0.01% 83 2207 0.01% 84 3773 0.02% 85 4739 0.03% 86 4642 0.03% 87 4936 0.03% 88 4979 0.03% 89 5024 0.03% 90 5240 0.03% 91 5589 0.04% 92 5881 0.04% 93 6244 0.04% 94 6741 0.04% 95 6764 0.04% 96 7116 0.04% 97 7261 0.05% 98 7608 0.05% 99 7949 0.05% 100 8590 0.05% 101 9068 0.06% 102 9630 0.06% 103 10121 0.06% 104 10935 0.07% 105 11335 0.07% 106 11943 0.08% 107 12426 0.08% 108 12812 0.08% 109 13556 0.09% 110 14282 0.09% 111 15295 0.10% 112 15961 0.10% 113 16860 0.11% 114 18076 0.11% 115 19249 0.12% 116 20053 0.13% 117 21005 0.13% 118 21836 0.14% 119 22389 0.14% 120 23652 0.15% 121 25274 0.16% 122 26510 0.17% 123 28550 0.18% 124 29925 0.19% 125 31893 0.20% 126 33873 0.21% 127 35356 0.22% 128 36589 0.23% 129 38602 0.24% 130 40478 0.26% 131 42871 0.27% 132 45281 0.29% 133 48522 0.31% 134 52002 0.33% 135 55472 0.35% 136 60115 0.38% 137 65044 0.41% 138 69877 0.44% 139 74460 0.47% 140 80923 0.51% 141 89331 0.56% 142 98906 0.63% 143 112569 0.71% 144 130385 0.82% 145 156350 0.99% 146 192846 1.22% 147 258484 1.63% 148 384382 2.43% 149 720257 4.55% 150 3373706 21.33% 151 8938847 56.51% 15817836 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=5.68 fanout-score-rank=13 prefix-density=0.45 prefix-fanout=3.6 sequence=CTGGTGCTGGAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=34 fanout-score=34.44 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=5.3 sequence=TGCCTTCTCCGGTGTACCAGTGCAAGAAAGCCTTCCTCCTGAACATAGCTGTGAATTGCTCACT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=31 prefix-density=0.29 prefix-fanout=3.1 sequence=TAACCATCTTTGCACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=58.92 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=12.3 sequence=TTCTTCTCTTCTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTAGATGAAGTGAGAGCCAGTGACTACAGCACATGCACTACAGGCAATGCAATCACTTCAGATAGCAGTGGTGCTACCACAATAGCCCTCAAGACTGCCGGAACTCATTATTTCATTTGTGGTGTTCCTGGCCACTGTGGGAGTGGCATGAAGGTTGCAGTCACTGTTGCAGCAGCAGGATCGAGCACAAGTCCCTCCTCCTCAGGAACTCCATCTTCTGATGGCACTACCACTTCTCCGGCCGGTAGTAACGTCACCAATTACAAGCCTTCATCCAACAACG SRR7169017 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:27:13 Started mapping on | Feb 10 16:27:14 Finished on | Feb 10 16:28:33 Mapping speed, Million of reads per hour | 720.81 Number of input reads | 15817836 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15188132 Uniquely mapped reads % | 96.02% Average mapped length | 295.15 Number of splices: Total | 13073579 Number of splices: Annotated (sjdb) | 12837804 Number of splices: GT/AG | 12886609 Number of splices: GC/AG | 143006 Number of splices: AT/AC | 11787 Number of splices: Non-canonical | 32177 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290731 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 34767 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365007 365007 365007 N_multimapping 290731 290731 290731 N_noFeature 409648 14935525 523720 N_ambiguous 205421 1233 65953 UnstrandedReadsAssigned:14573063 PositiveStrandReadsAssigned:251374 NegativeStrandReadsAssigned:14598459 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169017 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169017-trimmed-pair1.fastq SRR7169017-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,817,836 reads, 14,500,091 reads pseudoaligned [quant] estimated average fragment length: 249.462 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR7169017.ke.tsv 34699 SRR7169017.se.tsv 87100 total ==> SRR7169017.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.54 237 8.15913 Potri.005G024800.1.v4.1 1035 786.538 32 2.47848 Potri.004G059700.1.v4.1 961 712.562 0 0 Potri.007G009000.2.v4.1 1416 1167.54 0 0 Potri.003G141000.2.v4.1 2943 2694.54 208 4.70256 Potri.016G087400.1.v4.1 270 72.116 1593 1345.67 Potri.015G069301.1.v4.1 564 319.846 0 0 Potri.010G195200.1.v4.1 1773 1524.54 25 0.998981 Potri.012G127500.1.v4.1 977 728.562 4226 353.361 ==> SRR7169017.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1795 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 200 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169017 completed mapping pipeline successfully