Starting /dee2/code/volunteer_pipeline.sh SRR7169018 current disk space = 3058683584512 free memory = 1212482900 SRR7169018 SRAfilesize d9e8cd167e642b9998e4889eff6e38d9 SRR7169018.sra SRR7169018.sra file validated SRR7169018 is paired end SRR7169018 is conventional basespace SRR7169018 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169018_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.593 34.0 33.0 34.0 25.0 34.0 2 32.72875 34.0 33.0 34.0 28.0 34.0 3 32.89425 34.0 33.0 34.0 32.0 34.0 4 33.14525 34.0 33.0 34.0 32.0 34.0 5 33.1245 34.0 33.0 34.0 32.0 34.0 6 36.7505 38.0 37.0 38.0 35.0 38.0 7 37.15775 38.0 38.0 38.0 36.0 38.0 8 37.26825 38.0 38.0 38.0 37.0 38.0 9 37.32775 38.0 38.0 38.0 37.0 38.0 10-14 37.313 38.0 38.0 38.0 37.0 38.0 15-19 37.300599999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.26515 38.0 38.0 38.0 37.0 38.0 25-29 37.1915 38.0 38.0 38.0 36.8 38.0 30-34 37.214150000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.136900000000004 38.0 38.0 38.0 36.4 38.0 40-44 36.9573 38.0 38.0 38.0 35.8 38.0 45-49 36.8647 38.0 38.0 38.0 35.2 38.0 50-54 36.8311 38.0 38.0 38.0 34.8 38.0 55-59 36.72795 38.0 38.0 38.0 34.6 38.0 60-64 36.607350000000004 38.0 38.0 38.0 34.2 38.0 65-69 36.5747 38.0 38.0 38.0 34.0 38.0 70-74 36.496249999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.30505 38.0 37.2 38.0 33.6 38.0 80-84 36.157050000000005 38.0 37.0 38.0 33.0 38.0 85-89 36.137550000000005 38.0 37.0 38.0 33.0 38.0 90-94 36.0283 38.0 37.0 38.0 33.0 38.0 95-99 35.699200000000005 38.0 36.6 38.0 31.4 38.0 100-104 35.324 38.0 36.0 38.0 28.8 38.0 105-109 35.2001 38.0 36.0 38.0 28.6 38.0 110-114 34.980850000000004 38.0 35.4 38.0 27.6 38.0 115-119 34.70715 38.0 35.0 38.0 26.4 38.0 120-124 33.915049999999994 38.0 34.2 38.0 20.6 38.0 125-129 33.738749999999996 38.0 34.0 38.0 21.0 38.0 130-134 33.9561 38.0 34.2 38.0 23.0 38.0 135-139 33.36845 38.0 34.0 38.0 18.6 38.0 140-144 32.58725 38.0 33.2 38.0 14.4 38.0 145-149 31.25575 36.4 31.6 38.0 8.8 38.0 150-151 27.82975 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 3.0 14 3.0 15 2.0 16 4.0 17 5.0 18 3.0 19 6.0 20 6.0 21 12.0 22 14.0 23 15.0 24 18.0 25 23.0 26 27.0 27 29.0 28 47.0 29 59.0 30 74.0 31 71.0 32 117.0 33 160.0 34 239.0 35 386.0 36 882.0 37 1791.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.68707482993197 13.061224489795919 8.870748299319727 36.38095238095238 2 23.275000000000002 15.950000000000001 34.65 26.125 3 19.650000000000002 20.9 26.8 32.65 4 22.625 28.849999999999998 24.4 24.125 5 22.705676419104776 33.458364591147784 23.830957739434858 20.005001250312578 6 18.725 35.925000000000004 24.775 20.575 7 14.35 24.7 42.025 18.925 8 17.65 25.924999999999997 30.4 26.025 9 17.05 24.4 33.375 25.174999999999997 10-14 20.025000000000002 29.86 26.905 23.21 15-19 20.385 29.195 27.405 23.015 20-24 20.49 28.694999999999997 27.175 23.64 25-29 20.32 29.659999999999997 26.705000000000002 23.315 30-34 20.11 29.195 27.200000000000003 23.494999999999997 35-39 20.085 28.4 27.894999999999996 23.62 40-44 19.965 28.92 27.36 23.755000000000003 45-49 19.955000000000002 28.95 27.46 23.635 50-54 20.3 28.749999999999996 27.815 23.135 55-59 19.580000000000002 29.48 27.07 23.87 60-64 20.53 28.64 27.22 23.61 65-69 20.474999999999998 28.89 27.084999999999997 23.549999999999997 70-74 20.05 28.455000000000002 27.310000000000002 24.185000000000002 75-79 20.515 28.09 27.639999999999997 23.755000000000003 80-84 19.945 29.294999999999998 27.195000000000004 23.565 85-89 20.255000000000003 28.08 27.47 24.195 90-94 20.61 28.76 27.334999999999997 23.294999999999998 95-99 20.294999999999998 28.62 27.485 23.599999999999998 100-104 21.12 28.299999999999997 27.18 23.400000000000002 105-109 20.66 27.51 28.255000000000003 23.575 110-114 21.005 28.34 26.955000000000002 23.7 115-119 20.495 28.720000000000002 26.86 23.925 120-124 20.195 27.515 28.499999999999996 23.79 125-129 20.05 28.46 28.044999999999998 23.445 130-134 20.385 28.22 27.71 23.685000000000002 135-139 20.990000000000002 27.375 27.0 24.635 140-144 20.64 28.365000000000002 27.235 23.76 145-149 21.085 28.555000000000003 27.345000000000002 23.015 150-151 21.0625 29.2375 26.35 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.5 24 1.0 25 1.0 26 4.0 27 6.5 28 8.0 29 13.0 30 22.5 31 32.5 32 36.5 33 38.5 34 52.0 35 69.5 36 88.0 37 108.5 38 129.5 39 161.0 40 195.0 41 210.5 42 235.5 43 263.5 44 268.0 45 257.0 46 267.5 47 268.0 48 243.5 49 213.0 50 174.5 51 145.0 52 111.5 53 87.5 54 74.5 55 59.0 56 41.5 57 31.5 58 23.5 59 14.5 60 7.5 61 6.5 62 4.5 63 2.0 64 3.5 65 5.5 66 3.5 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.125 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.0125000000000002 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.3624999999999998 0.0 0.0 0.0 0.0 134-135 1.5625 0.0 0.0 0.0 0.0 136-137 1.7875 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169018 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169018_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54475 33.0 33.0 34.0 32.0 34.0 2 32.579 33.0 33.0 34.0 32.0 34.0 3 32.52325 34.0 33.0 34.0 31.0 34.0 4 32.5435 34.0 33.0 34.0 32.0 34.0 5 32.6185 34.0 33.0 34.0 32.0 34.0 6 36.746 38.0 38.0 38.0 35.0 38.0 7 36.8845 38.0 38.0 38.0 36.0 38.0 8 36.7585 38.0 38.0 38.0 35.0 38.0 9 36.793 38.0 38.0 38.0 35.0 38.0 10-14 36.7518 38.0 38.0 38.0 35.6 38.0 15-19 36.77225 38.0 38.0 38.0 36.0 38.0 20-24 36.73685 38.0 38.0 38.0 36.0 38.0 25-29 36.64490000000001 38.0 38.0 38.0 35.4 38.0 30-34 36.488 38.0 38.0 38.0 34.6 38.0 35-39 36.545049999999996 38.0 38.0 38.0 35.0 38.0 40-44 36.547850000000004 38.0 38.0 38.0 34.8 38.0 45-49 36.49400000000001 38.0 38.0 38.0 34.8 38.0 50-54 36.371249999999996 38.0 38.0 38.0 34.0 38.0 55-59 36.278499999999994 38.0 38.0 38.0 33.8 38.0 60-64 36.34245 38.0 38.0 38.0 34.0 38.0 65-69 36.20175 38.0 38.0 38.0 34.0 38.0 70-74 36.0753 38.0 38.0 38.0 33.2 38.0 75-79 36.01945 38.0 38.0 38.0 33.0 38.0 80-84 35.91855 38.0 37.8 38.0 32.6 38.0 85-89 35.7962 38.0 37.6 38.0 32.2 38.0 90-94 35.63115 38.0 37.2 38.0 30.2 38.0 95-99 35.412800000000004 38.0 37.0 38.0 29.0 38.0 100-104 35.2575 38.0 37.0 38.0 28.6 38.0 105-109 35.177949999999996 38.0 37.0 38.0 28.4 38.0 110-114 35.02715 38.0 36.8 38.0 27.8 38.0 115-119 34.66725 38.0 36.0 38.0 26.4 38.0 120-124 34.5793 38.0 36.0 38.0 26.0 38.0 125-129 34.13620000000001 38.0 35.0 38.0 22.6 38.0 130-134 33.73155 38.0 34.8 38.0 19.4 38.0 135-139 33.2991 38.0 34.2 38.0 15.0 38.0 140-144 32.9934 38.0 34.0 38.0 14.4 38.0 145-149 32.083999999999996 38.0 33.4 38.0 8.8 38.0 150-151 27.768625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 6.0 4 1.0 5 3.0 6 3.0 7 0.0 8 2.0 9 3.0 10 3.0 11 1.0 12 3.0 13 5.0 14 3.0 15 3.0 16 8.0 17 6.0 18 9.0 19 7.0 20 16.0 21 9.0 22 13.0 23 30.0 24 22.0 25 34.0 26 39.0 27 36.0 28 33.0 29 49.0 30 76.0 31 68.0 32 93.0 33 123.0 34 173.0 35 244.0 36 591.0 37 2269.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.23381836427496 22.930255895634723 11.716006021073758 27.119919719016554 2 26.460998244293954 26.410835214446955 30.549285176824682 16.578881364434412 3 20.34110860295962 27.890644594933534 31.326812139453224 20.441434662653624 4 24.153498871331827 33.45874090795084 23.375971908703285 19.011788312014048 5 23.82743917732631 36.99523451216453 22.67368949084525 16.503636819663907 6 21.056584877315974 38.98347521281923 22.108162243365047 17.85177766649975 7 19.62453066332916 21.827284105131415 37.997496871088856 20.550688360450565 8 20.931397095643465 25.863795693540307 27.491236855282924 25.7135703555333 9 22.70906359539309 24.68703054581873 28.768152228342515 23.83575363044567 10-14 23.461673258899516 28.52851349321584 26.545836879787714 21.463976368096933 15-19 23.58155140467725 27.372427262256497 27.888226751464774 21.157794581601483 20-24 23.182091346153847 28.57071314102564 27.163461538461537 21.083733974358974 25-29 22.988333082970307 28.3661308897902 27.569976465875516 21.075559561363978 30-34 23.294942413620433 27.646469704556836 27.891837756634953 21.16675012518778 35-39 22.595022284541038 28.103560518804144 28.158645901146777 21.142771295508037 40-44 23.327323717948715 27.96474358974359 27.714342948717945 20.993589743589745 45-49 23.270723766591537 27.172551965940393 28.30954169797145 21.24718256949662 50-54 23.370055082623935 28.427641462193293 27.366049073610416 20.83625438157236 55-59 23.421303019680508 27.948319895838548 28.108568280835293 20.52180880364565 60-64 23.622796474358974 27.63922275641026 28.03485576923077 20.703125 65-69 23.766591535186578 27.4129727022289 28.1893313298272 20.631104432757326 70-74 23.86175807663411 28.199348860505886 27.342849987478086 20.596043075381917 75-79 23.65521386356807 28.03265551437444 27.76219573274567 20.54993488931183 80-84 23.625162776720423 27.08604627867375 28.127817289391967 21.160973655213862 85-89 24.402704733283244 26.982218883045327 28.51490107688455 20.100175306786877 90-94 23.476083145504635 27.292762334084646 28.49486601552717 20.736288504883547 95-99 23.57625845229151 27.86877034810919 28.404708239418987 20.150262960180314 100-104 24.61307287753569 26.872026045579766 28.3496118206862 20.165289256198346 105-109 23.70147758577511 27.658402203856745 27.878787878787882 20.761332331580267 110-114 23.486100676183323 27.21262208865515 28.880540946656648 20.420736288504884 115-119 23.551214625594792 28.149261207112446 27.913849236163284 20.385674931129476 120-124 23.085399449035812 27.878787878787882 28.404708239418987 20.631104432757326 125-129 24.065912050485828 27.08604627867375 28.42832815786838 20.419713512972052 130-134 23.521162033558728 27.978963185574756 28.234410217881294 20.265464562985226 135-139 23.9519158527423 27.518156774355123 27.618332081142 20.91159529176058 140-144 24.142248935637365 27.44302529426496 28.1893313298272 20.22539444027047 145-149 23.84673178061608 28.30954169797145 27.177560731279737 20.66616579013273 150-151 24.76846057571965 27.083854818523157 28.473091364205256 19.67459324155194 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 3.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 0.5 25 1.5 26 2.5 27 2.5 28 3.5 29 7.5 30 11.0 31 13.5 32 22.5 33 29.5 34 39.0 35 60.0 36 77.0 37 98.0 38 138.5 39 165.5 40 190.5 41 218.5 42 247.5 43 265.5 44 280.5 45 300.0 46 297.5 47 278.5 48 246.0 49 207.5 50 170.0 51 142.5 52 120.5 53 95.0 54 69.5 55 51.0 56 37.0 57 24.5 58 21.5 59 16.0 60 8.5 61 10.0 62 4.5 63 1.5 64 2.0 65 2.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.325 3 0.325 4 0.325 5 0.325 6 0.15 7 0.125 8 0.15 9 0.15 10-14 0.135 15-19 0.155 20-24 0.16 25-29 0.145 30-34 0.15 35-39 0.155 40-44 0.16 45-49 0.17500000000000002 50-54 0.15 55-59 0.155 60-64 0.16 65-69 0.17500000000000002 70-74 0.17500000000000002 75-79 0.16999999999999998 80-84 0.16999999999999998 85-89 0.17500000000000002 90-94 0.17500000000000002 95-99 0.17500000000000002 100-104 0.17500000000000002 105-109 0.17500000000000002 110-114 0.17500000000000002 115-119 0.17500000000000002 120-124 0.17500000000000002 125-129 0.16999999999999998 130-134 0.17500000000000002 135-139 0.17500000000000002 140-144 0.17500000000000002 145-149 0.17500000000000002 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.5375 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.7250000000000001 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.2625 0.0 0.0 0.0 0.0 132-133 1.3875000000000002 0.0 0.0 0.0 0.0 134-135 1.575 0.0 0.0 0.0 0.0 136-137 1.7625 0.0 0.0 0.0 0.0 138-139 2.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCAAC 10 0.0065840036 146.77216 1 >>END_MODULE Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022489 spots for SRR7169018.sra Written 1022489 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra Read 1022470 spots for SRR7169018.sra Written 1022470 spots for SRR7169018.sra SRR ids: ['SRR7169018.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_89yahvhd SRR7169018.sra spots: 20449419 blocks: [[1, 1022470], [1022471, 2044940], [2044941, 3067410], [3067411, 4089880], [4089881, 5112350], [5112351, 6134820], [6134821, 7157290], [7157291, 8179760], [8179761, 9202230], [9202231, 10224700], [10224701, 11247170], [11247171, 12269640], [12269641, 13292110], [13292111, 14314580], [14314581, 15337050], [15337051, 16359520], [16359521, 17381990], [17381991, 18404460], [18404461, 19426930], [19426931, 20449419]] SRR7169018 file size 6907936 SRR7169018 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169018 SRR7169018_1.fastq SRR7169018_2.fastq Input file: SRR7169018_1.fastq Paired file: SRR7169018_2.fastq trimmed: SRR7169018-trimmed-pair1.fastq, SRR7169018-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:14:49 2025 >> started Mon Feb 10 16:15:13 2025 >> done (24.719s) 20449419 read pairs processed; of these: 31403 ( 0.15%) short read pairs filtered out after trimming by size control 82957 ( 0.41%) empty read pairs filtered out after trimming by size control 20335059 (99.44%) read pairs available; of these: 9629597 (47.35%) trimmed read pairs available after processing 10705462 (52.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 6 0.00% 21 5 0.00% 22 13 0.00% 23 4 0.00% 24 10 0.00% 25 3 0.00% 26 6 0.00% 27 6 0.00% 28 14 0.00% 29 8 0.00% 30 10 0.00% 31 9 0.00% 32 6 0.00% 33 11 0.00% 34 5 0.00% 35 7 0.00% 36 10 0.00% 37 10 0.00% 38 9 0.00% 39 12 0.00% 40 18 0.00% 41 24 0.00% 42 19 0.00% 43 18 0.00% 44 22 0.00% 45 44 0.00% 46 32 0.00% 47 44 0.00% 48 29 0.00% 49 47 0.00% 50 31 0.00% 51 51 0.00% 52 49 0.00% 53 58 0.00% 54 59 0.00% 55 61 0.00% 56 73 0.00% 57 92 0.00% 58 92 0.00% 59 125 0.00% 60 130 0.00% 61 146 0.00% 62 133 0.00% 63 185 0.00% 64 174 0.00% 65 220 0.00% 66 231 0.00% 67 244 0.00% 68 288 0.00% 69 356 0.00% 70 357 0.00% 71 447 0.00% 72 477 0.00% 73 504 0.00% 74 601 0.00% 75 674 0.00% 76 729 0.00% 77 804 0.00% 78 861 0.00% 79 1029 0.01% 80 1221 0.01% 81 1384 0.01% 82 1531 0.01% 83 1863 0.01% 84 3018 0.01% 85 3618 0.02% 86 3840 0.02% 87 3778 0.02% 88 4098 0.02% 89 4133 0.02% 90 4452 0.02% 91 4767 0.02% 92 5164 0.03% 93 5444 0.03% 94 5554 0.03% 95 5894 0.03% 96 6338 0.03% 97 6443 0.03% 98 6991 0.03% 99 7451 0.04% 100 7902 0.04% 101 8456 0.04% 102 8963 0.04% 103 9750 0.05% 104 10571 0.05% 105 11304 0.06% 106 11870 0.06% 107 12241 0.06% 108 13117 0.06% 109 13596 0.07% 110 14620 0.07% 111 15702 0.08% 112 16742 0.08% 113 17804 0.09% 114 19328 0.10% 115 20491 0.10% 116 21707 0.11% 117 22904 0.11% 118 23994 0.12% 119 25085 0.12% 120 27061 0.13% 121 28227 0.14% 122 30334 0.15% 123 32645 0.16% 124 35046 0.17% 125 37053 0.18% 126 39505 0.19% 127 42308 0.21% 128 44546 0.22% 129 47321 0.23% 130 50534 0.25% 131 54107 0.27% 132 57880 0.28% 133 62111 0.31% 134 67091 0.33% 135 72451 0.36% 136 78197 0.38% 137 84003 0.41% 138 90550 0.45% 139 100172 0.49% 140 109679 0.54% 141 121980 0.60% 142 137475 0.68% 143 159083 0.78% 144 182953 0.90% 145 222732 1.10% 146 279277 1.37% 147 376181 1.85% 148 569692 2.80% 149 1097932 5.40% 150 4888587 24.04% 151 10705462 52.65% 20335059 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=42 prefix-density=0.17 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=243.22 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=37 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=54.64 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.4 sequence=TGTTGGTGGTGG SRR7169018 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:16:32 Started mapping on | Feb 10 16:16:33 Finished on | Feb 10 16:18:41 Mapping speed, Million of reads per hour | 571.92 Number of input reads | 20335059 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19300284 Uniquely mapped reads % | 94.91% Average mapped length | 295.76 Number of splices: Total | 18554302 Number of splices: Annotated (sjdb) | 18259569 Number of splices: GT/AG | 18286401 Number of splices: GC/AG | 212655 Number of splices: AT/AC | 15279 Number of splices: Non-canonical | 39967 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363939 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 95580 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 694781 694781 694781 N_multimapping 363939 363939 363939 N_noFeature 431563 19087965 530318 N_ambiguous 192949 1548 78228 UnstrandedReadsAssigned:18675772 PositiveStrandReadsAssigned:210771 NegativeStrandReadsAssigned:18691738 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169018 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169018-trimmed-pair1.fastq SRR7169018-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,335,059 reads, 18,640,784 reads pseudoaligned [quant] estimated average fragment length: 260.455 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR7169018.ke.tsv 34699 SRR7169018.se.tsv 87100 total ==> SRR7169018.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.54 328 9.17702 Potri.005G024800.1.v4.1 1035 775.545 38 2.41078 Potri.004G059700.1.v4.1 961 701.583 6 0.420779 Potri.007G009000.2.v4.1 1416 1156.54 0 0 Potri.003G141000.2.v4.1 2943 2683.54 382.033 7.00444 Potri.016G087400.1.v4.1 270 66.9533 2187 1607.16 Potri.015G069301.1.v4.1 564 310.578 0 0 Potri.010G195200.1.v4.1 1773 1513.54 35 1.13777 Potri.012G127500.1.v4.1 977 717.572 5178 355.041 ==> SRR7169018.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1723 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 382 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169018 completed mapping pipeline successfully