Starting /dee2/code/volunteer_pipeline.sh SRR7169019 current disk space = 3058610102272 free memory = 1399133852 SRR7169019 SRAfilesize f6d4b73573c561adcc347bc703843e3a SRR7169019.sra SRR7169019.sra file validated SRR7169019 is paired end SRR7169019 is conventional basespace SRR7169019 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169019_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.31075 34.0 34.0 34.0 33.0 34.0 2 33.54225 34.0 34.0 34.0 33.0 34.0 3 33.529 34.0 34.0 34.0 33.0 34.0 4 33.57425 34.0 34.0 34.0 33.0 34.0 5 33.588 34.0 34.0 34.0 33.0 34.0 6 37.25675 38.0 38.0 38.0 36.0 38.0 7 37.48025 38.0 38.0 38.0 37.0 38.0 8 37.56825 38.0 38.0 38.0 38.0 38.0 9 37.6035 38.0 38.0 38.0 38.0 38.0 10-14 37.552 38.0 38.0 38.0 38.0 38.0 15-19 37.537650000000006 38.0 38.0 38.0 37.8 38.0 20-24 37.5713 38.0 38.0 38.0 38.0 38.0 25-29 37.482899999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.4704 38.0 38.0 38.0 37.6 38.0 35-39 37.40865 38.0 38.0 38.0 37.0 38.0 40-44 37.301199999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.29205 38.0 38.0 38.0 37.0 38.0 50-54 37.244899999999994 38.0 38.0 38.0 36.8 38.0 55-59 37.20375 38.0 38.0 38.0 36.4 38.0 60-64 37.138 38.0 38.0 38.0 36.0 38.0 65-69 37.143350000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.035450000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.06365 38.0 38.0 38.0 36.0 38.0 80-84 36.9808 38.0 38.0 38.0 36.0 38.0 85-89 36.92835 38.0 38.0 38.0 35.6 38.0 90-94 36.82785 38.0 38.0 38.0 35.0 38.0 95-99 36.7589 38.0 38.0 38.0 35.0 38.0 100-104 36.6346 38.0 38.0 38.0 34.6 38.0 105-109 36.533550000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.376999999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.22430000000001 38.0 37.6 38.0 33.8 38.0 120-124 36.08475 38.0 37.4 38.0 33.2 38.0 125-129 35.8834 38.0 37.0 38.0 33.0 38.0 130-134 35.6936 38.0 36.2 38.0 32.0 38.0 135-139 35.5114 38.0 36.0 38.0 31.2 38.0 140-144 35.1594 38.0 36.0 38.0 30.6 38.0 145-149 34.61465 38.0 35.4 38.0 28.4 38.0 150-151 31.861625 36.5 33.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 4.0 18 3.0 19 4.0 20 5.0 21 7.0 22 3.0 23 6.0 24 7.0 25 7.0 26 13.0 27 13.0 28 33.0 29 18.0 30 32.0 31 46.0 32 51.0 33 69.0 34 130.0 35 198.0 36 613.0 37 2736.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.543231661204935 10.789009326947316 12.32669523569448 41.34106377615326 2 20.75 14.575 34.8 29.875 3 18.825 18.55 26.5 36.125 4 22.275 27.0 22.525000000000002 28.199999999999996 5 22.175 32.1 25.05 20.674999999999997 6 18.625 35.35 25.775 20.25 7 14.899999999999999 25.8 40.35 18.95 8 17.525 26.375 30.525000000000002 25.575 9 16.2 24.224999999999998 35.65 23.925 10-14 19.43 30.255 27.060000000000002 23.255 15-19 19.57 28.689999999999998 27.62 24.12 20-24 19.794999999999998 28.689999999999998 27.04 24.474999999999998 25-29 19.755 28.955 26.845000000000002 24.445 30-34 19.996999699969997 28.79287928792879 27.147714771477148 24.062406240624064 35-39 20.43 27.61 27.615000000000002 24.345 40-44 20.365 29.244999999999997 26.5 23.89 45-49 19.755 28.294999999999998 27.105 24.845 50-54 19.445 28.349999999999998 27.255000000000003 24.95 55-59 20.215 28.439999999999998 26.88 24.465 60-64 19.685 28.395 27.1 24.82 65-69 19.98 27.900000000000002 27.49 24.63 70-74 20.305 27.725 27.48 24.490000000000002 75-79 20.855 27.845 27.405 23.895 80-84 20.165 28.055000000000003 27.279999999999998 24.5 85-89 20.21 28.33 27.060000000000002 24.4 90-94 20.745 27.405 27.42 24.43 95-99 20.235 27.32 27.639999999999997 24.805 100-104 20.71 27.815 27.065 24.41 105-109 21.015 28.18 26.625 24.18 110-114 20.43 27.74 27.334999999999997 24.495 115-119 20.535 27.605 27.38 24.48 120-124 20.865000000000002 27.689999999999998 27.175 24.27 125-129 20.62 27.97 27.05 24.36 130-134 20.79 27.310000000000002 26.995 24.905 135-139 20.75 27.900000000000002 27.065 24.285 140-144 21.295 27.18 27.08 24.445 145-149 20.915 27.79 26.375 24.92 150-151 20.3375 28.325 26.974999999999998 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 2.5 26 4.5 27 6.0 28 8.5 29 10.5 30 16.0 31 27.5 32 34.5 33 37.0 34 41.0 35 56.0 36 84.0 37 112.0 38 130.0 39 153.5 40 186.5 41 202.5 42 213.5 43 225.0 44 246.0 45 270.5 46 274.0 47 263.0 48 234.0 49 194.5 50 171.5 51 151.0 52 124.5 53 111.0 54 96.0 55 71.5 56 47.0 57 39.0 58 34.0 59 26.5 60 18.5 61 13.0 62 12.5 63 9.5 64 6.0 65 5.0 66 7.0 67 5.5 68 4.0 69 3.0 70 1.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.807061790668348 1.6 3 0.0 0.0 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.4249999999999998 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.65 0.0 0.0 0.0 0.0 134-135 1.75 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTAAC 10 0.006830828 145.0 3 >>END_MODULE SRR7169019 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169019_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04475 33.0 33.0 34.0 32.0 34.0 2 33.15975 34.0 33.0 34.0 33.0 34.0 3 33.22225 34.0 33.0 34.0 33.0 34.0 4 33.16125 34.0 33.0 34.0 33.0 34.0 5 33.15525 34.0 33.0 34.0 33.0 34.0 6 37.42125 38.0 38.0 38.0 37.0 38.0 7 37.39075 38.0 38.0 38.0 37.0 38.0 8 37.4275 38.0 38.0 38.0 38.0 38.0 9 37.404 38.0 38.0 38.0 38.0 38.0 10-14 37.4064 38.0 38.0 38.0 37.6 38.0 15-19 37.36415 38.0 38.0 38.0 37.4 38.0 20-24 37.318400000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.3502 38.0 38.0 38.0 37.2 38.0 30-34 37.371750000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.3549 38.0 38.0 38.0 37.0 38.0 40-44 37.360350000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.28000000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.2829 38.0 38.0 38.0 37.0 38.0 55-59 37.23295 38.0 38.0 38.0 37.0 38.0 60-64 37.162850000000006 38.0 38.0 38.0 36.8 38.0 65-69 37.1579 38.0 38.0 38.0 36.6 38.0 70-74 37.0472 38.0 38.0 38.0 36.2 38.0 75-79 37.0364 38.0 38.0 38.0 36.0 38.0 80-84 36.95585 38.0 38.0 38.0 35.8 38.0 85-89 36.8463 38.0 38.0 38.0 35.6 38.0 90-94 36.81535 38.0 38.0 38.0 35.0 38.0 95-99 36.661 38.0 38.0 38.0 35.0 38.0 100-104 36.6322 38.0 38.0 38.0 34.8 38.0 105-109 36.49 38.0 38.0 38.0 34.0 38.0 110-114 36.28975 38.0 38.0 38.0 33.8 38.0 115-119 36.21145 38.0 38.0 38.0 34.0 38.0 120-124 35.98765 38.0 37.6 38.0 33.0 38.0 125-129 35.6914 38.0 36.4 38.0 31.4 38.0 130-134 35.54225 38.0 36.0 38.0 31.0 38.0 135-139 35.089600000000004 38.0 35.8 38.0 29.2 38.0 140-144 34.64960000000001 38.0 35.0 38.0 27.8 38.0 145-149 34.20395 38.0 35.0 38.0 25.6 38.0 150-151 30.862875000000003 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 2.0 17 3.0 18 2.0 19 4.0 20 3.0 21 4.0 22 11.0 23 10.0 24 6.0 25 18.0 26 10.0 27 27.0 28 29.0 29 27.0 30 32.0 31 40.0 32 57.0 33 83.0 34 140.0 35 199.0 36 526.0 37 2760.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.425 20.8 16.475 29.299999999999997 2 27.25225225225225 26.276276276276278 29.854854854854857 16.616616616616618 3 20.995995995995994 27.55255255255255 31.28128128128128 20.17017017017017 4 24.236354531797698 32.67401101652479 23.885828743114672 19.203805708562843 5 25.625625625625624 33.58358358358358 22.6976976976977 18.093093093093092 6 21.224999999999998 36.6 22.95 19.225 7 21.05 21.675 38.125 19.15 8 23.525 24.349999999999998 28.249999999999996 23.875 9 21.875 24.275 30.599999999999998 23.25 10-14 23.611180559027954 28.7764388219411 25.6062803140157 22.00610030501525 15-19 24.135688197328264 27.748036223545302 26.817431330364737 21.298844248761696 20-24 23.31082770692673 27.81695423855964 27.341835458864715 21.530382595648913 25-29 23.472041612483746 27.938381514454335 27.678303491047313 20.911273382014606 30-34 23.392339233923394 28.01780178017802 27.33273327332733 21.257125712571256 35-39 23.74 27.800000000000004 27.46 21.0 40-44 23.87358103715557 28.064209631444715 26.929039355903384 21.133169975496322 45-49 23.886194309715485 27.641382069103454 27.496374818740936 20.976048802440122 50-54 24.16620831041552 27.936396819840994 27.251362568128407 20.64603230161508 55-59 23.74 27.3 27.700000000000003 21.26 60-64 23.875 27.455000000000002 27.435 21.235 65-69 23.981199059953 27.536376818840942 27.10635531776589 21.37606880344017 70-74 24.465 26.939999999999998 28.405 20.19 75-79 23.971198559928 27.646382319115958 27.611380569028455 20.771038551927596 80-84 24.116205810290513 27.546377318865943 27.801390069503473 20.536026801340068 85-89 24.235 27.175 27.474999999999998 21.115000000000002 90-94 24.075 27.715 27.625 20.585 95-99 24.435000000000002 27.935 27.529999999999998 20.1 100-104 24.395 27.689999999999998 27.445000000000004 20.47 105-109 24.175 26.834999999999997 28.215 20.775 110-114 24.310000000000002 28.335 27.0 20.355 115-119 24.676233811690583 27.366368318415923 27.826391319565978 20.131006550327516 120-124 24.52245224522452 27.412741274127413 27.37273727372737 20.692069206920692 125-129 24.855 28.255000000000003 26.46 20.43 130-134 24.555 27.67 27.495000000000005 20.28 135-139 25.180000000000003 27.51 26.96 20.349999999999998 140-144 24.72 27.944999999999997 26.825 20.51 145-149 24.415 27.685 27.405 20.495 150-151 24.762500000000003 27.450000000000003 27.55 20.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 2.0 26 2.0 27 4.0 28 5.0 29 8.0 30 11.0 31 9.5 32 17.0 33 28.5 34 41.5 35 48.5 36 67.0 37 110.0 38 141.0 39 168.0 40 181.5 41 195.0 42 239.0 43 268.5 44 276.0 45 263.5 46 255.0 47 252.0 48 240.0 49 210.0 50 183.0 51 161.0 52 126.5 53 109.0 54 86.0 55 63.0 56 47.5 57 36.0 58 27.0 59 18.5 60 13.5 61 13.0 62 17.0 63 16.0 64 9.0 65 2.5 66 2.5 67 4.5 68 3.5 69 3.0 70 4.0 71 2.5 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.15 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.065 20-24 0.025 25-29 0.03 30-34 0.01 35-39 0.0 40-44 0.015 45-49 0.005 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26767676767678 98.275 2 0.6060606060606061 1.2 3 0.025252525252525252 0.075 4 0.050505050505050504 0.2 5 0.050505050505050504 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCA 5 0.125 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.4 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.675 0.0 0.0 0.0 0.0 134-135 1.7625000000000002 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138-139 2.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753373 spots for SRR7169019.sra Written 753373 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra Read 753359 spots for SRR7169019.sra Written 753359 spots for SRR7169019.sra SRR ids: ['SRR7169019.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tzg4201s SRR7169019.sra spots: 15067194 blocks: [[1, 753359], [753360, 1506718], [1506719, 2260077], [2260078, 3013436], [3013437, 3766795], [3766796, 4520154], [4520155, 5273513], [5273514, 6026872], [6026873, 6780231], [6780232, 7533590], [7533591, 8286949], [8286950, 9040308], [9040309, 9793667], [9793668, 10547026], [10547027, 11300385], [11300386, 12053744], [12053745, 12807103], [12807104, 13560462], [13560463, 14313821], [14313822, 15067194]] SRR7169019 file size 5084077 SRR7169019 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169019 SRR7169019_1.fastq SRR7169019_2.fastq Input file: SRR7169019_1.fastq Paired file: SRR7169019_2.fastq trimmed: SRR7169019-trimmed-pair1.fastq, SRR7169019-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:16:28 2025 >> started Mon Feb 10 16:16:45 2025 >> done (17.116s) 15067194 read pairs processed; of these: 11475 ( 0.08%) short read pairs filtered out after trimming by size control 8225 ( 0.05%) empty read pairs filtered out after trimming by size control 15047494 (99.87%) read pairs available; of these: 5812823 (38.63%) trimmed read pairs available after processing 9234671 (61.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 8 0.00% 24 2 0.00% 25 4 0.00% 26 2 0.00% 27 4 0.00% 28 5 0.00% 29 3 0.00% 30 3 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 3 0.00% 35 4 0.00% 36 1 0.00% 37 3 0.00% 38 3 0.00% 39 6 0.00% 40 9 0.00% 41 7 0.00% 42 6 0.00% 43 10 0.00% 44 8 0.00% 45 7 0.00% 46 12 0.00% 47 11 0.00% 48 12 0.00% 49 17 0.00% 50 21 0.00% 51 15 0.00% 52 28 0.00% 53 22 0.00% 54 23 0.00% 55 35 0.00% 56 21 0.00% 57 35 0.00% 58 41 0.00% 59 39 0.00% 60 62 0.00% 61 53 0.00% 62 67 0.00% 63 70 0.00% 64 66 0.00% 65 76 0.00% 66 94 0.00% 67 102 0.00% 68 123 0.00% 69 150 0.00% 70 159 0.00% 71 176 0.00% 72 169 0.00% 73 207 0.00% 74 247 0.00% 75 296 0.00% 76 289 0.00% 77 345 0.00% 78 354 0.00% 79 391 0.00% 80 489 0.00% 81 532 0.00% 82 657 0.00% 83 754 0.01% 84 1241 0.01% 85 1622 0.01% 86 1739 0.01% 87 1885 0.01% 88 2056 0.01% 89 2148 0.01% 90 2194 0.01% 91 2320 0.02% 92 2460 0.02% 93 2676 0.02% 94 2893 0.02% 95 3117 0.02% 96 3323 0.02% 97 3512 0.02% 98 3892 0.03% 99 4140 0.03% 100 4354 0.03% 101 4647 0.03% 102 4889 0.03% 103 5437 0.04% 104 5805 0.04% 105 6284 0.04% 106 6491 0.04% 107 6947 0.05% 108 7279 0.05% 109 7695 0.05% 110 8338 0.06% 111 8627 0.06% 112 9364 0.06% 113 10079 0.07% 114 10768 0.07% 115 11663 0.08% 116 12270 0.08% 117 13117 0.09% 118 14024 0.09% 119 14551 0.10% 120 15571 0.10% 121 15949 0.11% 122 17167 0.11% 123 18354 0.12% 124 19712 0.13% 125 20898 0.14% 126 22430 0.15% 127 23605 0.16% 128 25108 0.17% 129 26832 0.18% 130 28208 0.19% 131 30159 0.20% 132 32745 0.22% 133 35450 0.24% 134 37507 0.25% 135 40373 0.27% 136 43842 0.29% 137 47492 0.32% 138 52553 0.35% 139 56868 0.38% 140 61391 0.41% 141 69072 0.46% 142 76372 0.51% 143 86733 0.58% 144 100745 0.67% 145 122374 0.81% 146 151512 1.01% 147 205988 1.37% 148 312838 2.08% 149 618407 4.11% 150 3176340 21.11% 151 9234671 61.37% 15047494 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.5 sequence=CCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCGCCGAAGCGGCCTTGGGTCCAAAAAGAGGGGCAGCGCCCCGCCTCCGATTCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACCTTCGCCGAAGCTCCCACTTATCCTACACCTCTCAAGTCAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=245.55 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=28.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=34 prefix-density=0.25 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=258.12 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.1 sequence=AAGAAGAAGAAA SRR7169019 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:17:39 Started mapping on | Feb 10 16:17:39 Finished on | Feb 10 16:19:42 Mapping speed, Million of reads per hour | 440.41 Number of input reads | 15047494 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13524473 Uniquely mapped reads % | 89.88% Average mapped length | 297.18 Number of splices: Total | 13000707 Number of splices: Annotated (sjdb) | 12795977 Number of splices: GT/AG | 12813139 Number of splices: GC/AG | 150117 Number of splices: AT/AC | 10226 Number of splices: Non-canonical | 27225 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297062 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 771780 % of reads mapped to too many loci | 5.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1236001 1236001 1236001 N_multimapping 297062 297062 297062 N_noFeature 298275 13393381 355792 N_ambiguous 130011 1073 55638 UnstrandedReadsAssigned:13096187 PositiveStrandReadsAssigned:130019 NegativeStrandReadsAssigned:13113043 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169019 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169019-trimmed-pair1.fastq SRR7169019-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,047,494 reads, 13,529,839 reads pseudoaligned [quant] estimated average fragment length: 261.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52401 SRR7169019.ke.tsv 34699 SRR7169019.se.tsv 87100 total ==> SRR7169019.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.37 237 8.91332 Potri.005G024800.1.v4.1 1035 774.371 38 3.24332 Potri.004G059700.1.v4.1 961 700.414 4 0.37745 Potri.007G009000.2.v4.1 1416 1155.37 0 0 Potri.003G141000.2.v4.1 2943 2682.37 203.056 5.00325 Potri.016G087400.1.v4.1 270 65.7945 1558 1565.06 Potri.015G069301.1.v4.1 564 308.799 0 0 Potri.010G195200.1.v4.1 1773 1512.37 31 1.35475 Potri.012G127500.1.v4.1 977 716.398 5769 532.232 ==> SRR7169019.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1356 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 299 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169019 completed mapping pipeline successfully