Starting /dee2/code/volunteer_pipeline.sh SRR7169020 current disk space = 3058459148288 free memory = 1455954408 SRR7169020 SRAfilesize 6f2a26ba24db794943b88231a218a9b4 SRR7169020.sra SRR7169020.sra file validated SRR7169020 is paired end SRR7169020 is conventional basespace SRR7169020 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169020_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.5915 34.0 34.0 34.0 33.0 34.0 2 33.71125 34.0 34.0 34.0 33.0 34.0 3 33.71775 34.0 34.0 34.0 33.0 34.0 4 33.745 34.0 34.0 34.0 33.0 34.0 5 33.765 34.0 34.0 34.0 33.0 34.0 6 37.534 38.0 38.0 38.0 37.0 38.0 7 37.66275 38.0 38.0 38.0 38.0 38.0 8 37.74725 38.0 38.0 38.0 38.0 38.0 9 37.59075 38.0 38.0 38.0 38.0 38.0 10-14 37.68495 38.0 38.0 38.0 38.0 38.0 15-19 37.7074 38.0 38.0 38.0 38.0 38.0 20-24 37.72515 38.0 38.0 38.0 38.0 38.0 25-29 37.68935 38.0 38.0 38.0 38.0 38.0 30-34 37.66415 38.0 38.0 38.0 38.0 38.0 35-39 37.52875 38.0 38.0 38.0 38.0 38.0 40-44 37.45705 38.0 38.0 38.0 37.6 38.0 45-49 37.38495 38.0 38.0 38.0 37.0 38.0 50-54 37.354699999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.28715 38.0 38.0 38.0 37.0 38.0 60-64 37.31035 38.0 38.0 38.0 37.0 38.0 65-69 37.2451 38.0 38.0 38.0 37.0 38.0 70-74 37.19775 38.0 38.0 38.0 37.0 38.0 75-79 37.07295 38.0 38.0 38.0 36.4 38.0 80-84 37.06915 38.0 38.0 38.0 36.0 38.0 85-89 37.02374999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.9322 38.0 38.0 38.0 36.0 38.0 95-99 36.83045 38.0 38.0 38.0 36.0 38.0 100-104 36.6811 38.0 38.0 38.0 35.2 38.0 105-109 36.6211 38.0 38.0 38.0 35.0 38.0 110-114 36.4584 38.0 38.0 38.0 34.2 38.0 115-119 36.2966 38.0 38.0 38.0 34.0 38.0 120-124 36.1515 38.0 38.0 38.0 33.6 38.0 125-129 36.0043 38.0 37.8 38.0 33.4 38.0 130-134 35.7838 38.0 37.0 38.0 33.0 38.0 135-139 35.606849999999994 38.0 36.4 38.0 32.4 38.0 140-144 35.2736 38.0 36.0 38.0 31.0 38.0 145-149 34.91415 38.0 36.0 38.0 29.8 38.0 150-151 31.47025 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 2.0 11 0.0 12 2.0 13 0.0 14 2.0 15 4.0 16 0.0 17 4.0 18 3.0 19 3.0 20 3.0 21 2.0 22 8.0 23 9.0 24 3.0 25 6.0 26 14.0 27 17.0 28 17.0 29 31.0 30 24.0 31 32.0 32 44.0 33 50.0 34 88.0 35 172.0 36 461.0 37 2997.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.12036108324975 14.66900702106319 11.659979939819458 33.55065195586761 2 22.43060765191298 15.478869717429358 32.733183295823956 29.35733933483371 3 19.525000000000002 19.5 26.950000000000003 34.025 4 20.5 26.525 25.025 27.950000000000003 5 21.349999999999998 30.75 24.85 23.05 6 20.150000000000002 33.525 26.150000000000002 20.175 7 15.049999999999999 29.425 37.925 17.599999999999998 8 16.425 29.45 31.45 22.675 9 16.5 26.55 35.199999999999996 21.75 10-14 18.91 31.125000000000004 28.28 21.685 15-19 18.915000000000003 30.630000000000003 27.655 22.8 20-24 19.325 31.5 26.985 22.189999999999998 25-29 18.925 31.275 26.5 23.3 30-34 18.61 31.635 26.924999999999997 22.830000000000002 35-39 19.2 30.759999999999998 26.895000000000003 23.145 40-44 19.545 30.740000000000002 26.355 23.36 45-49 19.08 30.145 27.700000000000003 23.075000000000003 50-54 19.15 31.025000000000002 26.8 23.025000000000002 55-59 19.27 30.86 26.565 23.305 60-64 18.655 30.985000000000003 26.765 23.595 65-69 19.445 30.294999999999998 26.724999999999998 23.535 70-74 19.095000000000002 30.685000000000002 27.200000000000003 23.02 75-79 19.465 30.56 26.305 23.669999999999998 80-84 19.255 30.3 27.02 23.425 85-89 20.015 29.74 26.655 23.59 90-94 19.45 29.49 26.834999999999997 24.224999999999998 95-99 19.63 30.014999999999997 26.619999999999997 23.735 100-104 20.31 29.435 26.889999999999997 23.365 105-109 19.905 29.75 27.025 23.32 110-114 19.84 29.2 26.945000000000004 24.015 115-119 19.365 29.505 27.205000000000002 23.925 120-124 20.14 29.515 26.924999999999997 23.419999999999998 125-129 21.029999999999998 28.799999999999997 26.665 23.505000000000003 130-134 20.025000000000002 29.035 27.089999999999996 23.849999999999998 135-139 19.950000000000003 29.435 26.68 23.935000000000002 140-144 20.95 28.895 26.179999999999996 23.974999999999998 145-149 20.325 28.63 26.900000000000002 24.145 150-151 19.425 28.8875 26.6625 25.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 3.0 23 5.0 24 4.5 25 7.5 26 11.5 27 18.5 28 23.5 29 25.5 30 28.5 31 49.0 32 77.0 33 79.0 34 94.0 35 124.0 36 132.5 37 159.0 38 170.0 39 176.5 40 200.5 41 199.5 42 208.5 43 222.0 44 225.0 45 227.0 46 218.5 47 200.5 48 181.0 49 159.5 50 133.0 51 111.5 52 96.5 53 89.0 54 86.0 55 61.0 56 45.5 57 35.5 58 23.5 59 23.5 60 15.0 61 8.5 62 8.0 63 7.0 64 5.0 65 3.0 66 3.5 67 3.0 68 1.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.525 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 2.9375 0.0 0.0 0.0 0.0 136-137 3.1625 0.0 0.0 0.0 0.0 138-139 3.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTTA 10 0.006830828 145.0 1 >>END_MODULE SRR7169020 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169020_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13225 34.0 33.0 34.0 33.0 34.0 2 33.22325 34.0 33.0 34.0 33.0 34.0 3 33.212 34.0 33.0 34.0 33.0 34.0 4 33.231 34.0 33.0 34.0 33.0 34.0 5 33.18925 34.0 33.0 34.0 33.0 34.0 6 37.37575 38.0 38.0 38.0 38.0 38.0 7 37.35725 38.0 38.0 38.0 38.0 38.0 8 37.371 38.0 38.0 38.0 38.0 38.0 9 37.37025 38.0 38.0 38.0 38.0 38.0 10-14 37.325100000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.2389 38.0 38.0 38.0 37.8 38.0 20-24 37.2428 38.0 38.0 38.0 38.0 38.0 25-29 37.22825 38.0 38.0 38.0 38.0 38.0 30-34 37.217949999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.1879 38.0 38.0 38.0 38.0 38.0 40-44 37.185950000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.143249999999995 38.0 38.0 38.0 37.6 38.0 50-54 37.073750000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.08775 38.0 38.0 38.0 37.2 38.0 60-64 36.931650000000005 38.0 38.0 38.0 36.8 38.0 65-69 36.9562 38.0 38.0 38.0 37.0 38.0 70-74 36.863749999999996 38.0 38.0 38.0 36.8 38.0 75-79 36.78315 38.0 38.0 38.0 36.4 38.0 80-84 36.685050000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.606049999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.559349999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.3808 38.0 38.0 38.0 34.8 38.0 100-104 36.360699999999994 38.0 38.0 38.0 34.8 38.0 105-109 36.242900000000006 38.0 38.0 38.0 34.2 38.0 110-114 36.0614 38.0 38.0 38.0 33.8 38.0 115-119 35.836 38.0 38.0 38.0 33.4 38.0 120-124 35.4537 38.0 37.2 38.0 31.4 38.0 125-129 35.184749999999994 38.0 37.0 38.0 29.8 38.0 130-134 35.0916 38.0 36.4 38.0 30.0 38.0 135-139 34.69885 38.0 36.0 38.0 27.8 38.0 140-144 34.1992 38.0 35.0 38.0 24.4 38.0 145-149 33.36815 38.0 33.2 38.0 20.2 38.0 150-151 29.0875 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 3.0 4 4.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 3.0 11 4.0 12 4.0 13 0.0 14 5.0 15 4.0 16 5.0 17 4.0 18 3.0 19 6.0 20 7.0 21 6.0 22 10.0 23 10.0 24 7.0 25 14.0 26 14.0 27 17.0 28 24.0 29 29.0 30 23.0 31 30.0 32 51.0 33 75.0 34 86.0 35 209.0 36 494.0 37 2826.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.568284142071036 23.411705852926463 14.33216608304152 25.68784392196098 2 27.3 28.275 27.775 16.650000000000002 3 21.875 29.125 29.049999999999997 19.950000000000003 4 24.775 34.0 22.95 18.275 5 25.275 35.075 22.525000000000002 17.125 6 22.325 35.35 24.2 18.125 7 21.175 22.55 37.2 19.075 8 23.200000000000003 25.924999999999997 26.5 24.375 9 22.175 25.724999999999998 28.799999999999997 23.3 10-14 24.065 29.060000000000002 26.395000000000003 20.48 15-19 24.38 28.175 27.310000000000002 20.135 20-24 23.935000000000002 28.705000000000002 26.895000000000003 20.465 25-29 23.595 28.51 27.075 20.82 30-34 23.84 27.775 27.76 20.625 35-39 23.95 28.225 27.36 20.465 40-44 24.19 27.415 27.689999999999998 20.705000000000002 45-49 24.245 27.544999999999998 27.650000000000002 20.560000000000002 50-54 23.785 27.425 27.935 20.855 55-59 23.945 26.745 28.1 21.21 60-64 23.505000000000003 27.279999999999998 28.13 21.085 65-69 23.775 27.48 27.884999999999998 20.86 70-74 24.43 27.04 28.13 20.4 75-79 23.24 27.250000000000004 28.87 20.64 80-84 23.595 27.305 28.555000000000003 20.544999999999998 85-89 23.34 27.505000000000003 28.499999999999996 20.655 90-94 23.34 26.97 29.005 20.685000000000002 95-99 23.405 26.650000000000002 29.23 20.715 100-104 23.745 27.200000000000003 28.744999999999997 20.31 105-109 23.415 27.175 28.689999999999998 20.72 110-114 23.69 27.665 28.299999999999997 20.345 115-119 24.18 26.924999999999997 29.34 19.555 120-124 23.990000000000002 26.889999999999997 28.634999999999998 20.485 125-129 23.705000000000002 27.565 28.68 20.05 130-134 23.810000000000002 27.55 28.904999999999998 19.735 135-139 23.95 27.465 28.77 19.814999999999998 140-144 24.245 27.474999999999998 28.865000000000002 19.415 145-149 24.63 27.29 28.565 19.515 150-151 25.0125 26.950000000000003 27.962500000000002 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 2.5 26 2.0 27 2.0 28 5.5 29 8.5 30 13.0 31 17.0 32 25.0 33 36.5 34 45.5 35 70.5 36 86.0 37 97.5 38 123.0 39 160.0 40 200.5 41 209.0 42 234.0 43 274.0 44 277.0 45 273.5 46 265.0 47 253.5 48 238.5 49 208.5 50 182.0 51 152.5 52 117.5 53 93.0 54 74.0 55 57.0 56 43.0 57 29.0 58 26.0 59 23.0 60 14.5 61 8.5 62 7.5 63 8.0 64 4.5 65 1.5 66 2.5 67 3.5 68 3.0 69 3.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 1.0 76 1.5 77 0.5 78 0.0 79 1.0 80 1.0 81 0.0 82 1.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.243761028485 98.425 2 0.6806150743634989 1.35 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0750000000000002 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.575 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.125 0.0 0.0 0.0 0.0 130-131 2.4 0.0 0.0 0.0 0.0 132-133 2.675 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.2125 0.0 0.0 0.0 0.0 138-139 3.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415888 spots for SRR7169020.sra Written 415888 spots for SRR7169020.sra Read 415897 spots for SRR7169020.sra Written 415897 spots for SRR7169020.sra SRR ids: ['SRR7169020.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__ci2lp0a SRR7169020.sra spots: 8317769 blocks: [[1, 415888], [415889, 831776], [831777, 1247664], [1247665, 1663552], [1663553, 2079440], [2079441, 2495328], [2495329, 2911216], [2911217, 3327104], [3327105, 3742992], [3742993, 4158880], [4158881, 4574768], [4574769, 4990656], [4990657, 5406544], [5406545, 5822432], [5822433, 6238320], [6238321, 6654208], [6654209, 7070096], [7070097, 7485984], [7485985, 7901872], [7901873, 8317769]] SRR7169020 file size 2800204 SRR7169020 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169020 SRR7169020_1.fastq SRR7169020_2.fastq Input file: SRR7169020_1.fastq Paired file: SRR7169020_2.fastq trimmed: SRR7169020-trimmed-pair1.fastq, SRR7169020-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:23:05 2025 >> started Mon Feb 10 16:23:15 2025 >> done (9.702s) 8317769 read pairs processed; of these: 11491 ( 0.14%) short read pairs filtered out after trimming by size control 11677 ( 0.14%) empty read pairs filtered out after trimming by size control 8294601 (99.72%) read pairs available; of these: 3302221 (39.81%) trimmed read pairs available after processing 4992380 (60.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 5 0.00% 21 13 0.00% 22 5 0.00% 23 8 0.00% 24 9 0.00% 25 3 0.00% 26 8 0.00% 27 11 0.00% 28 3 0.00% 29 13 0.00% 30 5 0.00% 31 8 0.00% 32 5 0.00% 33 6 0.00% 34 8 0.00% 35 5 0.00% 36 11 0.00% 37 9 0.00% 38 13 0.00% 39 9 0.00% 40 8 0.00% 41 12 0.00% 42 11 0.00% 43 5 0.00% 44 12 0.00% 45 9 0.00% 46 10 0.00% 47 12 0.00% 48 13 0.00% 49 17 0.00% 50 14 0.00% 51 12 0.00% 52 20 0.00% 53 24 0.00% 54 24 0.00% 55 29 0.00% 56 29 0.00% 57 32 0.00% 58 30 0.00% 59 38 0.00% 60 41 0.00% 61 52 0.00% 62 61 0.00% 63 50 0.00% 64 95 0.00% 65 77 0.00% 66 91 0.00% 67 107 0.00% 68 155 0.00% 69 240 0.00% 70 219 0.00% 71 155 0.00% 72 167 0.00% 73 185 0.00% 74 194 0.00% 75 214 0.00% 76 240 0.00% 77 272 0.00% 78 317 0.00% 79 367 0.00% 80 401 0.00% 81 444 0.01% 82 505 0.01% 83 567 0.01% 84 1146 0.01% 85 1528 0.02% 86 1645 0.02% 87 1699 0.02% 88 1908 0.02% 89 2015 0.02% 90 2016 0.02% 91 2038 0.02% 92 2225 0.03% 93 2339 0.03% 94 2434 0.03% 95 2673 0.03% 96 2811 0.03% 97 3005 0.04% 98 3256 0.04% 99 3290 0.04% 100 3520 0.04% 101 3658 0.04% 102 4130 0.05% 103 4396 0.05% 104 4707 0.06% 105 4940 0.06% 106 5315 0.06% 107 5505 0.07% 108 5742 0.07% 109 6111 0.07% 110 6410 0.08% 111 6877 0.08% 112 7439 0.09% 113 7872 0.09% 114 8197 0.10% 115 8820 0.11% 116 9085 0.11% 117 9860 0.12% 118 10056 0.12% 119 10585 0.13% 120 10994 0.13% 121 11446 0.14% 122 12108 0.15% 123 12783 0.15% 124 13702 0.17% 125 14579 0.18% 126 14975 0.18% 127 16039 0.19% 128 16661 0.20% 129 17662 0.21% 130 18878 0.23% 131 19824 0.24% 132 20813 0.25% 133 22428 0.27% 134 24261 0.29% 135 26289 0.32% 136 27867 0.34% 137 30273 0.36% 138 32114 0.39% 139 34520 0.42% 140 36972 0.45% 141 39605 0.48% 142 43749 0.53% 143 49177 0.59% 144 56103 0.68% 145 66413 0.80% 146 80490 0.97% 147 106702 1.29% 148 161277 1.94% 149 315116 3.80% 150 1773399 21.38% 151 4992380 60.19% 8294601 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=11.48 fanout-score-rank=13 prefix-density=0.28 prefix-fanout=6.1 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=460.51 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=26.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=30 prefix-density=0.50 prefix-fanout=2.7 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=86.03 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=14.8 sequence=AAGAAAATGGAGGCAATGAAAATGAAGATCTTTGTTGTGTTGATGGTGGTCTTGATGGCCTTCTCAACCATGCAAAAGGCTGCAGCTGCCGATGCACCAGCACCAAGCCCAACATCTGATGCCACTATCTTTGTTCCCACGTTCTTGGCATCTCTTGTTGCTCTTGCTTTCGGGTTGCTCTTTTGAGCCAACT SRR7169020 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:24:02 Started mapping on | Feb 10 16:24:02 Finished on | Feb 10 16:25:04 Mapping speed, Million of reads per hour | 481.62 Number of input reads | 8294601 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 7758951 Uniquely mapped reads % | 93.54% Average mapped length | 296.16 Number of splices: Total | 5889696 Number of splices: Annotated (sjdb) | 5770943 Number of splices: GT/AG | 5794340 Number of splices: GC/AG | 72919 Number of splices: AT/AC | 5078 Number of splices: Non-canonical | 17359 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.67 Insertion rate per base | 0.03% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 151917 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 42020 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 394126 394126 394126 N_multimapping 151917 151917 151917 N_noFeature 211275 7650044 254489 N_ambiguous 99268 619 33200 UnstrandedReadsAssigned:7448408 PositiveStrandReadsAssigned:108288 NegativeStrandReadsAssigned:7471262 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169020 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169020-trimmed-pair1.fastq SRR7169020-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,294,601 reads, 7,480,631 reads pseudoaligned [quant] estimated average fragment length: 240.716 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR7169020.ke.tsv 34699 SRR7169020.se.tsv 87100 total ==> SRR7169020.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.28 133 8.39458 Potri.005G024800.1.v4.1 1035 795.284 36 5.08076 Potri.004G059700.1.v4.1 961 721.293 1 0.15561 Potri.007G009000.2.v4.1 1416 1176.28 0 0 Potri.003G141000.2.v4.1 2943 2703.28 134 5.56367 Potri.016G087400.1.v4.1 270 70.6692 1070 1699.42 Potri.015G069301.1.v4.1 564 326.703 0 0 Potri.010G195200.1.v4.1 1773 1533.28 35 2.56209 Potri.012G127500.1.v4.1 977 737.284 5092 775.179 ==> SRR7169020.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1172 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 143 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169020 completed mapping pipeline successfully