Starting /dee2/code/volunteer_pipeline.sh SRR7169022 current disk space = 3058282373120 free memory = 1153255548 SRR7169022 SRAfilesize 87fe24533a0eb4263819e74e4fd3b677 SRR7169022.sra SRR7169022.sra file validated SRR7169022 is paired end SRR7169022 is conventional basespace SRR7169022 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169022_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07575 34.0 33.0 34.0 33.0 34.0 2 33.47875 34.0 34.0 34.0 33.0 34.0 3 33.4635 34.0 34.0 34.0 33.0 34.0 4 33.5485 34.0 34.0 34.0 33.0 34.0 5 33.506 34.0 34.0 34.0 33.0 34.0 6 37.09125 38.0 38.0 38.0 36.0 38.0 7 37.41025 38.0 38.0 38.0 37.0 38.0 8 37.49075 38.0 38.0 38.0 37.0 38.0 9 37.50525 38.0 38.0 38.0 38.0 38.0 10-14 37.533249999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.54065 38.0 38.0 38.0 38.0 38.0 20-24 37.555400000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.51774999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.52025 38.0 38.0 38.0 38.0 38.0 35-39 37.36665 38.0 38.0 38.0 37.0 38.0 40-44 37.303999999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.378099999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.30415000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.25335 38.0 38.0 38.0 36.8 38.0 60-64 37.216 38.0 38.0 38.0 36.4 38.0 65-69 37.1267 38.0 38.0 38.0 36.0 38.0 70-74 37.1774 38.0 38.0 38.0 36.4 38.0 75-79 37.0621 38.0 38.0 38.0 36.0 38.0 80-84 37.0 38.0 38.0 38.0 36.0 38.0 85-89 36.99665 38.0 38.0 38.0 36.0 38.0 90-94 36.86025 38.0 38.0 38.0 35.6 38.0 95-99 36.78105000000001 38.0 38.0 38.0 35.2 38.0 100-104 36.595600000000005 38.0 38.0 38.0 34.8 38.0 105-109 36.41795 38.0 38.0 38.0 34.0 38.0 110-114 36.34565 38.0 38.0 38.0 34.0 38.0 115-119 36.26565 38.0 38.0 38.0 34.0 38.0 120-124 35.99305 38.0 37.6 38.0 33.4 38.0 125-129 35.8745 38.0 37.0 38.0 32.8 38.0 130-134 35.64795 38.0 36.6 38.0 32.2 38.0 135-139 35.424549999999996 38.0 36.2 38.0 31.4 38.0 140-144 34.9593 38.0 36.0 38.0 28.4 38.0 145-149 34.449250000000006 38.0 35.4 38.0 27.4 38.0 150-151 31.75725 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 1.0 14 0.0 15 1.0 16 2.0 17 3.0 18 4.0 19 1.0 20 8.0 21 4.0 22 6.0 23 4.0 24 10.0 25 17.0 26 16.0 27 14.0 28 29.0 29 34.0 30 40.0 31 34.0 32 48.0 33 63.0 34 111.0 35 214.0 36 471.0 37 2862.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.77856599949328 12.79452748923233 9.298201165442107 36.12870534583228 2 21.8 16.175 34.325 27.700000000000003 3 18.175 22.45 28.7 30.675 4 23.425 30.25 22.8 23.525 5 21.925 33.575 25.5 19.0 6 19.325 35.275 25.174999999999997 20.225 7 13.5 27.450000000000003 41.325 17.724999999999998 8 17.875 25.575 30.55 26.0 9 16.75 25.424999999999997 33.525 24.3 10-14 19.845 29.755 27.0 23.400000000000002 15-19 19.505 29.18 27.500000000000004 23.815 20-24 19.48 29.349999999999998 27.900000000000002 23.27 25-29 19.755 28.57 27.52 24.154999999999998 30-34 20.025000000000002 29.145 27.37 23.46 35-39 19.994999999999997 28.325 27.52 24.16 40-44 20.150000000000002 28.67 27.435 23.745 45-49 19.695 28.955 27.16 24.19 50-54 20.265 28.854999999999997 27.375 23.505000000000003 55-59 20.84 28.54 26.979999999999997 23.64 60-64 20.119999999999997 29.03 27.54 23.31 65-69 20.419999999999998 28.615000000000002 27.525 23.44 70-74 19.915 29.025000000000002 26.805 24.255 75-79 20.325 29.134999999999998 27.43 23.11 80-84 20.595 28.705000000000002 27.200000000000003 23.5 85-89 20.285 28.965000000000003 26.995 23.755000000000003 90-94 19.950000000000003 29.32 27.060000000000002 23.669999999999998 95-99 20.7 28.494999999999997 27.355 23.45 100-104 20.865000000000002 28.595 27.105 23.435 105-109 20.525 28.634999999999998 27.505000000000003 23.335 110-114 21.055 27.800000000000004 27.66 23.485 115-119 20.305 28.605000000000004 27.55 23.54 120-124 20.955 28.415000000000003 27.04 23.59 125-129 20.54 28.395 27.644999999999996 23.419999999999998 130-134 21.404999999999998 28.37 27.029999999999998 23.195 135-139 20.8 28.83 26.979999999999997 23.39 140-144 20.810000000000002 28.655 26.775 23.76 145-149 21.575 28.025 26.700000000000003 23.7 150-151 21.1375 28.125 26.8125 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 0.5 24 2.0 25 3.5 26 5.5 27 10.0 28 10.5 29 13.5 30 23.5 31 32.0 32 39.5 33 46.5 34 60.0 35 71.5 36 102.5 37 133.0 38 135.5 39 156.5 40 172.0 41 185.5 42 207.5 43 250.0 44 263.5 45 257.5 46 277.0 47 257.5 48 234.0 49 214.0 50 174.0 51 135.5 52 118.5 53 98.0 54 82.5 55 67.0 56 40.0 57 30.5 58 25.5 59 18.5 60 11.0 61 5.5 62 4.5 63 4.0 64 2.5 65 3.0 66 2.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.4875 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.2875 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.575 0.0 0.0 0.0 0.0 136-137 2.6875 0.0 0.0 0.0 0.0 138-139 2.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATCAT 10 0.006832588 144.9875 4 >>END_MODULE SRR7169022 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169022_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.945 33.0 33.0 34.0 32.0 34.0 2 33.01675 34.0 33.0 34.0 32.0 34.0 3 33.049 34.0 33.0 34.0 32.0 34.0 4 33.01825 34.0 33.0 34.0 33.0 34.0 5 33.00775 34.0 33.0 34.0 33.0 34.0 6 37.19175 38.0 38.0 38.0 37.0 38.0 7 37.232 38.0 38.0 38.0 37.0 38.0 8 37.24675 38.0 38.0 38.0 37.0 38.0 9 37.2625 38.0 38.0 38.0 37.0 38.0 10-14 37.1699 38.0 38.0 38.0 37.0 38.0 15-19 37.1484 38.0 38.0 38.0 37.0 38.0 20-24 37.09515 38.0 38.0 38.0 37.0 38.0 25-29 37.0972 38.0 38.0 38.0 37.0 38.0 30-34 37.1046 38.0 38.0 38.0 37.0 38.0 35-39 37.03735 38.0 38.0 38.0 37.0 38.0 40-44 36.9491 38.0 38.0 38.0 36.2 38.0 45-49 37.001549999999995 38.0 38.0 38.0 36.6 38.0 50-54 36.88405 38.0 38.0 38.0 36.0 38.0 55-59 36.92935000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.83194999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.834199999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.746 38.0 38.0 38.0 35.8 38.0 75-79 36.68025 38.0 38.0 38.0 35.8 38.0 80-84 36.6265 38.0 38.0 38.0 35.0 38.0 85-89 36.4973 38.0 38.0 38.0 34.4 38.0 90-94 36.41265 38.0 38.0 38.0 34.0 38.0 95-99 36.28175 38.0 38.0 38.0 34.0 38.0 100-104 36.1469 38.0 38.0 38.0 33.8 38.0 105-109 35.94315 38.0 37.8 38.0 33.0 38.0 110-114 35.85295 38.0 37.4 38.0 33.0 38.0 115-119 35.592349999999996 38.0 37.0 38.0 31.0 38.0 120-124 35.368900000000004 38.0 36.8 38.0 30.6 38.0 125-129 35.21555 38.0 36.4 38.0 29.4 38.0 130-134 34.7496 38.0 36.0 38.0 27.8 38.0 135-139 34.3143 38.0 35.2 38.0 24.8 38.0 140-144 33.9536 38.0 35.0 38.0 22.6 38.0 145-149 33.243199999999995 38.0 34.2 38.0 16.8 38.0 150-151 28.7225 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 8.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 2.0 14 6.0 15 3.0 16 4.0 17 7.0 18 10.0 19 10.0 20 11.0 21 10.0 22 10.0 23 13.0 24 15.0 25 11.0 26 21.0 27 23.0 28 31.0 29 26.0 30 44.0 31 47.0 32 63.0 33 94.0 34 130.0 35 221.0 36 550.0 37 2619.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.550000000000004 22.15 12.7 24.6 2 27.37737737737738 25.350350350350347 30.03003003003003 17.24224224224224 3 20.01503006012024 27.429859719438877 32.03907815631262 20.516032064128257 4 23.29075882794891 34.15977961432507 22.789882294014525 19.759579263711498 5 24.32364729458918 35.39579158316633 22.24448897795591 18.03607214428858 6 20.150000000000002 37.4 24.075 18.375 7 20.075000000000003 20.974999999999998 38.625 20.325 8 21.875 24.4 28.15 25.575 9 20.9 24.75 29.849999999999998 24.5 10-14 23.454690938187635 28.280656131226245 26.430286057211443 21.834366873374673 15-19 23.359198998748436 27.804755944931163 27.13892365456821 21.697121401752188 20-24 23.21160580290145 27.228614307153578 27.973986993496748 21.585792896448226 25-29 23.140041026667333 28.10326712363036 27.863111022164404 20.8935808275379 30-34 23.331999599879964 27.773331999599883 27.688306491947586 21.20636190857257 35-39 23.196237366156307 27.304112879015314 27.969578705093568 21.530071049734815 40-44 23.190435696063226 28.17767995598019 27.337301785803614 21.294582562152968 45-49 23.45438175270108 27.886154461784713 27.871148459383754 20.78831532613045 50-54 23.551177558877946 27.936396819840994 27.481374068703435 21.03105155257763 55-59 23.575893973493372 27.776944236059016 28.127031757939484 20.520130032508128 60-64 23.6041624974985 27.62657594556734 27.966780068040826 20.80248148889334 65-69 23.499099459675808 27.731638983390035 27.806684010406247 20.962577546527918 70-74 23.661295165649086 27.389650685617056 27.855069562606342 21.093984586127515 75-79 24.11549817344743 27.203122654256116 28.15393084121503 20.52744833108142 80-84 23.409363745498197 27.921168467386952 27.981192476990795 20.688275310124048 85-89 24.259851970394077 27.720544108821766 27.675535107021403 20.344068813762753 90-94 23.727118135440634 27.083124937481244 28.26848054416325 20.921276382914876 95-99 23.598539780967144 27.734160124018604 27.89418412761914 20.77311596739511 100-104 24.240000000000002 27.425 27.700000000000003 20.635 105-109 23.801190059502975 27.301365068253414 28.16140807040352 20.73603680184009 110-114 23.69 27.694999999999997 28.084999999999997 20.53 115-119 24.535855477155582 27.283190712105288 27.64850122604214 20.53245258469699 120-124 23.780915189746672 27.540803043957148 28.216681686192054 20.461600080104137 125-129 24.032443799128824 27.477094077003954 27.762479347118614 20.72798277674861 130-134 23.92957182873149 27.47098839535814 28.08623449379752 20.513205282112846 135-139 23.980995248812203 27.881970492623154 28.057014253563388 20.080020005001252 140-144 24.03543011559826 28.249011659910924 27.62848421157984 20.087074012910975 145-149 24.503377533149862 27.950963222416814 27.435576682511886 20.11008256192144 150-151 24.6996996996997 28.928928928928926 26.288788788788786 20.082582582582585 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 1.5 26 1.5 27 2.5 28 3.5 29 6.0 30 8.0 31 13.0 32 18.5 33 22.0 34 30.0 35 54.5 36 79.5 37 98.0 38 118.0 39 157.5 40 200.5 41 221.0 42 238.0 43 264.0 44 297.0 45 295.5 46 279.0 47 266.0 48 252.5 49 228.5 50 192.5 51 161.5 52 125.5 53 96.5 54 73.5 55 51.5 56 37.5 57 27.5 58 21.0 59 15.5 60 9.0 61 5.0 62 2.5 63 5.5 64 5.0 65 1.0 66 1.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.2 4 0.17500000000000002 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.125 20-24 0.05 25-29 0.065 30-34 0.03 35-39 0.06999999999999999 40-44 0.045 45-49 0.04 50-54 0.005 55-59 0.025 60-64 0.06 65-69 0.06 70-74 0.09 75-79 0.08499999999999999 80-84 0.04 85-89 0.02 90-94 0.03 95-99 0.015 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.08499999999999999 120-124 0.13 125-129 0.135 130-134 0.04 135-139 0.025 140-144 0.08499999999999999 145-149 0.075 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.425 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 2.8625 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACAGC 10 0.006830828 145.0 145 >>END_MODULE Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711326 spots for SRR7169022.sra Written 711326 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra Read 711313 spots for SRR7169022.sra Written 711313 spots for SRR7169022.sra SRR ids: ['SRR7169022.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_omrl3u_h SRR7169022.sra spots: 14226273 blocks: [[1, 711313], [711314, 1422626], [1422627, 2133939], [2133940, 2845252], [2845253, 3556565], [3556566, 4267878], [4267879, 4979191], [4979192, 5690504], [5690505, 6401817], [6401818, 7113130], [7113131, 7824443], [7824444, 8535756], [8535757, 9247069], [9247070, 9958382], [9958383, 10669695], [10669696, 11381008], [11381009, 12092321], [12092322, 12803634], [12803635, 13514947], [13514948, 14226273]] SRR7169022 file size 4799116 SRR7169022 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169022 SRR7169022_1.fastq SRR7169022_2.fastq Input file: SRR7169022_1.fastq Paired file: SRR7169022_2.fastq trimmed: SRR7169022-trimmed-pair1.fastq, SRR7169022-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:52:11 2025 >> started Mon Feb 10 16:52:27 2025 >> done (16.687s) 14226273 read pairs processed; of these: 16734 ( 0.12%) short read pairs filtered out after trimming by size control 10401 ( 0.07%) empty read pairs filtered out after trimming by size control 14199138 (99.81%) read pairs available; of these: 5796847 (40.83%) trimmed read pairs available after processing 8402291 (59.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 3 0.00% 26 4 0.00% 27 6 0.00% 28 6 0.00% 29 3 0.00% 30 5 0.00% 31 2 0.00% 32 3 0.00% 33 5 0.00% 34 6 0.00% 35 6 0.00% 36 7 0.00% 37 3 0.00% 38 3 0.00% 39 8 0.00% 40 6 0.00% 41 3 0.00% 42 8 0.00% 43 16 0.00% 44 13 0.00% 45 10 0.00% 46 10 0.00% 47 17 0.00% 48 9 0.00% 49 17 0.00% 50 20 0.00% 51 25 0.00% 52 26 0.00% 53 24 0.00% 54 34 0.00% 55 24 0.00% 56 22 0.00% 57 45 0.00% 58 35 0.00% 59 58 0.00% 60 50 0.00% 61 62 0.00% 62 84 0.00% 63 96 0.00% 64 73 0.00% 65 110 0.00% 66 102 0.00% 67 117 0.00% 68 129 0.00% 69 170 0.00% 70 209 0.00% 71 237 0.00% 72 246 0.00% 73 268 0.00% 74 330 0.00% 75 391 0.00% 76 446 0.00% 77 453 0.00% 78 513 0.00% 79 552 0.00% 80 665 0.00% 81 778 0.01% 82 894 0.01% 83 1042 0.01% 84 1841 0.01% 85 2286 0.02% 86 2365 0.02% 87 2530 0.02% 88 2511 0.02% 89 2754 0.02% 90 2828 0.02% 91 3151 0.02% 92 3398 0.02% 93 3768 0.03% 94 3958 0.03% 95 4230 0.03% 96 4371 0.03% 97 4575 0.03% 98 4828 0.03% 99 5307 0.04% 100 5631 0.04% 101 6127 0.04% 102 6529 0.05% 103 7190 0.05% 104 7636 0.05% 105 8091 0.06% 106 8684 0.06% 107 8988 0.06% 108 9269 0.07% 109 10043 0.07% 110 10675 0.08% 111 11260 0.08% 112 11951 0.08% 113 12845 0.09% 114 13771 0.10% 115 14826 0.10% 116 15761 0.11% 117 16363 0.12% 118 17062 0.12% 119 17912 0.13% 120 18767 0.13% 121 19826 0.14% 122 21103 0.15% 123 22346 0.16% 124 24027 0.17% 125 25437 0.18% 126 26794 0.19% 127 28332 0.20% 128 29602 0.21% 129 31419 0.22% 130 33068 0.23% 131 34795 0.25% 132 36940 0.26% 133 40219 0.28% 134 43026 0.30% 135 46098 0.32% 136 49546 0.35% 137 53028 0.37% 138 57161 0.40% 139 61266 0.43% 140 66405 0.47% 141 73060 0.51% 142 80969 0.57% 143 91942 0.65% 144 106484 0.75% 145 127050 0.89% 146 153667 1.08% 147 204297 1.44% 148 302824 2.13% 149 589074 4.15% 150 3014428 21.23% 151 8402291 59.17% 14199138 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=257.10 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=16.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=128.29 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=14.1 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCT SRR7169022 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:53:29 Started mapping on | Feb 10 16:53:33 Finished on | Feb 10 16:54:56 Mapping speed, Million of reads per hour | 615.87 Number of input reads | 14199138 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12758160 Uniquely mapped reads % | 89.85% Average mapped length | 292.32 Number of splices: Total | 11713266 Number of splices: Annotated (sjdb) | 11526215 Number of splices: GT/AG | 11547844 Number of splices: GC/AG | 130801 Number of splices: AT/AC | 9738 Number of splices: Non-canonical | 24883 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 219864 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 28578 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.37% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1235917 1235917 1235917 N_multimapping 219864 219864 219864 N_noFeature 276071 12611424 333068 N_ambiguous 157017 1387 66138 UnstrandedReadsAssigned:12325072 PositiveStrandReadsAssigned:145349 NegativeStrandReadsAssigned:12358954 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169022 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169022-trimmed-pair1.fastq SRR7169022-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,199,138 reads, 12,802,830 reads pseudoaligned [quant] estimated average fragment length: 246.564 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7169022.ke.tsv 34699 SRR7169022.se.tsv 87100 total ==> SRR7169022.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.44 212 9.06125 Potri.005G024800.1.v4.1 1035 789.436 32 3.07083 Potri.004G059700.1.v4.1 961 715.484 2 0.211764 Potri.007G009000.2.v4.1 1416 1170.44 0 0 Potri.003G141000.2.v4.1 2943 2697.44 214 6.01015 Potri.016G087400.1.v4.1 270 75.2955 1107.77 1114.56 Potri.015G069301.1.v4.1 564 323.745 0 0 Potri.010G195200.1.v4.1 1773 1527.44 12 0.59517 Potri.012G127500.1.v4.1 977 731.46 3783 391.804 ==> SRR7169022.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1308 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 213 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169022 completed mapping pipeline successfully