Starting /dee2/code/volunteer_pipeline.sh SRR7169023 current disk space = 3058220523520 free memory = 1226725364 SRR7169023 SRAfilesize 69e5f69c426ec6aa75825c9170df437f SRR7169023.sra SRR7169023.sra file validated SRR7169023 is paired end SRR7169023 is conventional basespace SRR7169023 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169023_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.30775 34.0 34.0 34.0 33.0 34.0 2 33.48175 34.0 34.0 34.0 33.0 34.0 3 33.4785 34.0 34.0 34.0 33.0 34.0 4 33.4895 34.0 34.0 34.0 33.0 34.0 5 33.5225 34.0 34.0 34.0 33.0 34.0 6 37.3165 38.0 38.0 38.0 36.0 38.0 7 37.45425 38.0 38.0 38.0 37.0 38.0 8 37.492 38.0 38.0 38.0 37.0 38.0 9 37.41825 38.0 38.0 38.0 37.0 38.0 10-14 37.5505 38.0 38.0 38.0 37.8 38.0 15-19 37.58315 38.0 38.0 38.0 38.0 38.0 20-24 37.48595 38.0 38.0 38.0 37.8 38.0 25-29 37.4585 38.0 38.0 38.0 37.8 38.0 30-34 37.41585 38.0 38.0 38.0 37.2 38.0 35-39 37.30055 38.0 38.0 38.0 36.8 38.0 40-44 37.19955 38.0 38.0 38.0 37.0 38.0 45-49 37.20225000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.146499999999996 38.0 38.0 38.0 36.2 38.0 55-59 37.0257 38.0 38.0 38.0 36.0 38.0 60-64 37.03765 38.0 38.0 38.0 36.0 38.0 65-69 36.93875 38.0 38.0 38.0 36.0 38.0 70-74 36.93865 38.0 38.0 38.0 36.0 38.0 75-79 36.765249999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.67045 38.0 38.0 38.0 35.0 38.0 85-89 36.50365 38.0 38.0 38.0 34.0 38.0 90-94 36.333299999999994 38.0 38.0 38.0 33.6 38.0 95-99 36.160000000000004 38.0 37.4 38.0 32.4 38.0 100-104 35.796800000000005 38.0 37.0 38.0 31.0 38.0 105-109 35.52635 38.0 37.0 38.0 30.0 38.0 110-114 35.020300000000006 38.0 36.0 38.0 28.2 38.0 115-119 34.70165000000001 38.0 35.6 38.0 27.2 38.0 120-124 33.95575 38.0 34.2 38.0 22.8 38.0 125-129 33.513250000000006 38.0 33.2 38.0 20.0 38.0 130-134 32.90865 38.0 33.0 38.0 16.8 38.0 135-139 32.17895 37.8 31.4 38.0 13.6 38.0 140-144 30.994999999999997 36.2 28.2 38.0 12.6 38.0 145-149 29.036849999999998 36.0 26.4 38.0 2.0 38.0 150-151 21.443375 18.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 1.0 12 1.0 13 2.0 14 2.0 15 0.0 16 3.0 17 3.0 18 6.0 19 6.0 20 10.0 21 21.0 22 14.0 23 15.0 24 14.0 25 15.0 26 26.0 27 31.0 28 37.0 29 39.0 30 67.0 31 75.0 32 91.0 33 139.0 34 270.0 35 473.0 36 1103.0 37 1532.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.26156941649899 14.88933601609658 13.078470824949697 36.77062374245473 2 23.65 16.275000000000002 32.300000000000004 27.775 3 21.4 22.95 24.6 31.05 4 21.3 30.625000000000004 23.025000000000002 25.05 5 21.346346346346344 34.58458458458458 23.823823823823822 20.245245245245243 6 20.1 35.5 24.375 20.025000000000002 7 14.774999999999999 25.45 40.9 18.875 8 17.75 26.3 29.125 26.825 9 17.0 26.3 32.525 24.175 10-14 20.485 29.935000000000002 25.740000000000002 23.84 15-19 20.19 28.794999999999998 27.465 23.549999999999997 20-24 19.17 29.085 27.705000000000002 24.04 25-29 19.91 28.955 27.255000000000003 23.880000000000003 30-34 20.215 29.349999999999998 26.57 23.865 35-39 19.455 29.304999999999996 27.68 23.56 40-44 20.345 28.95 26.729999999999997 23.974999999999998 45-49 20.72 28.53 26.88 23.87 50-54 20.255000000000003 28.71 27.235 23.799999999999997 55-59 21.04 27.955000000000002 27.639999999999997 23.365 60-64 19.919999999999998 29.205 27.425 23.45 65-69 20.57 28.945 27.169999999999998 23.315 70-74 20.205000000000002 27.825 27.605 24.365000000000002 75-79 20.34 28.125 27.065 24.47 80-84 20.23 28.384999999999998 27.43 23.955000000000002 85-89 20.0 28.744999999999997 27.215 24.04 90-94 20.515 28.525 27.155 23.805 95-99 20.27 28.715000000000003 27.12 23.895 100-104 20.544999999999998 28.139999999999997 27.725 23.59 105-109 20.89 27.685 27.305 24.12 110-114 20.79 28.125 27.115000000000002 23.97 115-119 20.885 27.66 27.565 23.89 120-124 20.785 28.18 26.845000000000002 24.19 125-129 20.979999999999997 28.22 26.534999999999997 24.265 130-134 21.105 28.34 26.935 23.62 135-139 20.82 27.67 27.395000000000003 24.115000000000002 140-144 20.945 27.639999999999997 27.08 24.335 145-149 20.974999999999998 28.060000000000002 26.82 24.145 150-151 21.025 27.287499999999998 27.375 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 2.0 22 3.0 23 1.5 24 1.5 25 4.0 26 6.0 27 8.0 28 11.0 29 12.0 30 16.0 31 23.5 32 33.5 33 46.5 34 62.0 35 71.0 36 86.5 37 113.0 38 114.0 39 143.0 40 186.0 41 191.0 42 216.0 43 255.0 44 265.0 45 262.0 46 270.5 47 273.5 48 252.0 49 210.5 50 178.0 51 145.0 52 112.5 53 102.5 54 86.5 55 63.5 56 44.0 57 29.0 58 23.0 59 18.0 60 11.5 61 10.5 62 10.0 63 4.5 64 3.0 65 4.0 66 3.5 67 2.5 68 1.5 69 1.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.6125 0.0 0.0 0.0 0.0 130-131 1.8625 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.4124999999999996 0.0 0.0 0.0 0.0 138-139 2.6500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCCTA 10 0.006577216 146.82278 1 ATGATAT 10 0.006832588 144.9875 7 >>END_MODULE SRR7169023 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169023_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.767 33.0 33.0 34.0 32.0 34.0 2 32.86 34.0 33.0 34.0 32.0 34.0 3 32.788 34.0 33.0 34.0 31.0 34.0 4 32.724 34.0 33.0 34.0 32.0 34.0 5 32.715 34.0 33.0 34.0 31.0 34.0 6 36.88925 38.0 38.0 38.0 36.0 38.0 7 36.96125 38.0 38.0 38.0 36.0 38.0 8 36.95475 38.0 38.0 38.0 36.0 38.0 9 36.9705 38.0 38.0 38.0 36.0 38.0 10-14 36.84675 38.0 38.0 38.0 36.0 38.0 15-19 36.809850000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.71995 38.0 38.0 38.0 35.8 38.0 25-29 36.654250000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.643299999999996 38.0 38.0 38.0 35.4 38.0 35-39 36.5769 38.0 38.0 38.0 35.0 38.0 40-44 36.5234 38.0 38.0 38.0 35.0 38.0 45-49 36.376850000000005 38.0 38.0 38.0 34.2 38.0 50-54 36.1785 38.0 38.0 38.0 33.8 38.0 55-59 36.0712 38.0 37.8 38.0 33.4 38.0 60-64 35.96125000000001 38.0 37.4 38.0 32.8 38.0 65-69 35.82445 38.0 37.0 38.0 33.0 38.0 70-74 35.66295 38.0 37.0 38.0 31.0 38.0 75-79 35.385149999999996 38.0 36.8 38.0 29.4 38.0 80-84 35.19005 38.0 36.0 38.0 28.6 38.0 85-89 35.0133 38.0 36.0 38.0 28.2 38.0 90-94 34.5779 38.0 35.4 38.0 26.0 38.0 95-99 34.232800000000005 38.0 34.6 38.0 24.2 38.0 100-104 33.6734 38.0 33.8 38.0 20.8 38.0 105-109 32.90195 37.8 32.6 38.0 15.0 38.0 110-114 32.3688 37.4 31.4 38.0 14.8 38.0 115-119 31.38565 37.0 29.2 38.0 13.0 38.0 120-124 30.1119 36.2 26.8 38.0 11.8 38.0 125-129 28.9658 34.6 23.2 38.0 7.4 38.0 130-134 27.868850000000002 33.2 20.0 38.0 2.0 38.0 135-139 27.0226 33.0 16.0 38.0 2.0 38.0 140-144 25.10995 32.2 12.8 38.0 2.0 38.0 145-149 22.5139 30.0 3.8 37.2 2.0 38.0 150-151 16.0975 14.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 5.0 4 4.0 5 1.0 6 4.0 7 2.0 8 1.0 9 2.0 10 2.0 11 3.0 12 1.0 13 7.0 14 5.0 15 11.0 16 7.0 17 10.0 18 20.0 19 22.0 20 23.0 21 28.0 22 18.0 23 57.0 24 34.0 25 46.0 26 49.0 27 66.0 28 67.0 29 72.0 30 127.0 31 157.0 32 217.0 33 330.0 34 455.0 35 698.0 36 955.0 37 471.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.699999999999996 21.0 16.675 26.625 2 27.41612418627942 26.189283925888834 28.267401101652478 18.12719078617927 3 21.102756892230577 29.04761904761905 29.398496240601503 20.451127819548873 4 23.809523809523807 32.55639097744361 23.809523809523807 19.824561403508774 5 24.711779448621556 34.3609022556391 22.406015037593985 18.521303258145362 6 20.645645645645647 37.03703703703704 22.6976976976977 19.61961961961962 7 20.425531914893615 20.375469336670836 38.97371714643304 20.225281602002504 8 22.95369211514393 25.732165206508135 24.85607008760951 26.458072590738425 9 22.3973973973974 25.125125125125123 28.128128128128125 24.34934934934935 10-14 23.848577286592988 27.2890933640046 26.008901335200278 22.85342801420213 15-19 23.5 28.51 26.27 21.72 20-24 23.615627032164475 28.077634935721075 26.591966384873196 21.714771647241257 25-29 23.775 27.905 27.04 21.279999999999998 30-34 23.06383830298179 28.126876125675405 27.04622773664199 21.76305783470082 35-39 23.435858964741186 28.042010502625658 27.021755438859714 21.500375093773442 40-44 23.38701610483145 27.353205961788536 27.38821646493948 21.871561468440532 45-49 23.985590633912043 27.20768499524691 27.29274028118277 21.51398408965828 50-54 24.312431243124312 27.887788778877887 26.51765176517652 21.282128212821284 55-59 23.949579831932773 27.460984393757503 26.885754301720688 21.703681472589036 60-64 23.6747349469894 26.880376075215047 27.855571114222844 21.589317863572717 65-69 23.544999999999998 27.694999999999997 27.455000000000002 21.305 70-74 24.47734320296089 26.96809042712814 27.37321196358908 21.181354406321898 75-79 24.02980596119224 27.0754150830166 27.625525105021005 21.269253850770152 80-84 23.893584037605642 28.264239635945394 26.573986097914688 21.26819022853428 85-89 23.87955182072829 27.62605042016807 27.55602240896359 20.938375350140056 90-94 24.09240924092409 27.052705270527056 27.412741274127413 21.44214421442144 95-99 23.549999999999997 28.175 27.060000000000002 21.215 100-104 23.93 27.71 27.245 21.115000000000002 105-109 23.585 28.165000000000003 27.07 21.18 110-114 24.15 27.055 27.82 20.974999999999998 115-119 24.97999199679872 27.315926370548222 26.395558223289317 21.308523409363744 120-124 23.715415019762844 28.138289888427476 27.302746785410513 20.84354830639916 125-129 24.264116940328396 27.563075690829 27.162595114136966 21.010212254705646 130-134 24.214528717230337 27.521512907744643 27.076245747448468 21.187712627576545 135-139 23.402871579368654 27.350042523387863 27.575166341487815 21.671919555755665 140-144 23.978392437353076 27.36957935277347 27.05446906417246 21.597559145700995 145-149 24.357435743574356 27.807780778077806 27.32773277327733 20.507050705070505 150-151 25.575 26.2875 27.375 20.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 1.5 27 2.5 28 1.5 29 4.0 30 6.0 31 6.0 32 10.0 33 14.5 34 23.5 35 37.0 36 58.5 37 88.0 38 117.5 39 143.0 40 181.5 41 220.5 42 248.5 43 267.0 44 275.5 45 298.0 46 306.5 47 283.5 48 245.0 49 217.5 50 195.0 51 160.0 52 134.0 53 108.0 54 81.5 55 64.5 56 54.0 57 40.5 58 19.5 59 10.5 60 12.5 61 10.5 62 5.0 63 5.0 64 5.5 65 2.5 66 2.0 67 1.5 68 0.0 69 0.0 70 1.0 71 1.0 72 1.5 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 1.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 1.0 92 1.5 93 1.0 94 1.0 95 1.0 96 1.5 97 2.5 98 2.5 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.25 4 0.25 5 0.25 6 0.1 7 0.125 8 0.125 9 0.1 10-14 0.015 15-19 0.0 20-24 0.045 25-29 0.0 30-34 0.06 35-39 0.025 40-44 0.03 45-49 0.065 50-54 0.01 55-59 0.04 60-64 0.02 65-69 0.0 70-74 0.03 75-79 0.02 80-84 0.015 85-89 0.04 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.04 120-124 0.065 125-129 0.12 130-134 0.06 135-139 0.055 140-144 0.034999999999999996 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5285678328718851 1.05 3 0.0 0.0 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.55 0.0 0.0 0.0 0.0 130-131 1.7625 0.0 0.0 0.0 0.0 132-133 1.9249999999999998 0.0 0.0 0.0 0.0 134-135 2.0374999999999996 0.0 0.0 0.0 0.0 136-137 2.1 0.0 0.0 0.0 0.0 138-139 2.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAAGT 10 0.006830828 145.0 9 >>END_MODULE Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829211 spots for SRR7169023.sra Written 829211 spots for SRR7169023.sra Read 829228 spots for SRR7169023.sra Written 829228 spots for SRR7169023.sra SRR ids: ['SRR7169023.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v42koh17 SRR7169023.sra spots: 16584237 blocks: [[1, 829211], [829212, 1658422], [1658423, 2487633], [2487634, 3316844], [3316845, 4146055], [4146056, 4975266], [4975267, 5804477], [5804478, 6633688], [6633689, 7462899], [7462900, 8292110], [8292111, 9121321], [9121322, 9950532], [9950533, 10779743], [10779744, 11608954], [11608955, 12438165], [12438166, 13267376], [13267377, 14096587], [14096588, 14925798], [14925799, 15755009], [15755010, 16584237]] SRR7169023 file size 5598153 SRR7169023 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169023 SRR7169023_1.fastq SRR7169023_2.fastq Input file: SRR7169023_1.fastq Paired file: SRR7169023_2.fastq trimmed: SRR7169023-trimmed-pair1.fastq, SRR7169023-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:03:43 2025 >> started Mon Feb 10 17:04:12 2025 >> done (29.067s) 16584237 read pairs processed; of these: 26238 ( 0.16%) short read pairs filtered out after trimming by size control 17894 ( 0.11%) empty read pairs filtered out after trimming by size control 16540105 (99.73%) read pairs available; of these: 7251279 (43.84%) trimmed read pairs available after processing 9288826 (56.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 4 0.00% 23 5 0.00% 24 0 0.00% 25 5 0.00% 26 6 0.00% 27 12 0.00% 28 4 0.00% 29 10 0.00% 30 6 0.00% 31 7 0.00% 32 5 0.00% 33 5 0.00% 34 7 0.00% 35 3 0.00% 36 5 0.00% 37 9 0.00% 38 7 0.00% 39 15 0.00% 40 13 0.00% 41 8 0.00% 42 9 0.00% 43 20 0.00% 44 17 0.00% 45 18 0.00% 46 10 0.00% 47 21 0.00% 48 17 0.00% 49 22 0.00% 50 26 0.00% 51 44 0.00% 52 37 0.00% 53 35 0.00% 54 44 0.00% 55 38 0.00% 56 47 0.00% 57 45 0.00% 58 57 0.00% 59 79 0.00% 60 86 0.00% 61 106 0.00% 62 105 0.00% 63 136 0.00% 64 140 0.00% 65 146 0.00% 66 190 0.00% 67 191 0.00% 68 230 0.00% 69 302 0.00% 70 324 0.00% 71 362 0.00% 72 356 0.00% 73 437 0.00% 74 472 0.00% 75 511 0.00% 76 570 0.00% 77 602 0.00% 78 795 0.00% 79 832 0.01% 80 858 0.01% 81 1106 0.01% 82 1225 0.01% 83 1455 0.01% 84 2459 0.01% 85 3272 0.02% 86 3335 0.02% 87 3496 0.02% 88 3660 0.02% 89 3822 0.02% 90 3951 0.02% 91 4082 0.02% 92 4283 0.03% 93 4718 0.03% 94 4951 0.03% 95 5291 0.03% 96 5574 0.03% 97 5910 0.04% 98 6122 0.04% 99 6430 0.04% 100 7101 0.04% 101 7554 0.05% 102 8080 0.05% 103 8691 0.05% 104 8939 0.05% 105 9836 0.06% 106 10304 0.06% 107 10851 0.07% 108 11240 0.07% 109 11835 0.07% 110 12687 0.08% 111 13407 0.08% 112 14435 0.09% 113 15344 0.09% 114 16526 0.10% 115 17308 0.10% 116 18249 0.11% 117 19289 0.12% 118 20257 0.12% 119 21416 0.13% 120 22781 0.14% 121 23911 0.14% 122 25734 0.16% 123 27302 0.17% 124 29364 0.18% 125 30890 0.19% 126 32723 0.20% 127 34666 0.21% 128 36117 0.22% 129 38557 0.23% 130 40396 0.24% 131 43267 0.26% 132 46382 0.28% 133 50262 0.30% 134 52898 0.32% 135 57582 0.35% 136 61733 0.37% 137 67046 0.41% 138 72934 0.44% 139 78119 0.47% 140 85910 0.52% 141 95341 0.58% 142 106284 0.64% 143 121934 0.74% 144 141225 0.85% 145 170263 1.03% 146 212169 1.28% 147 284891 1.72% 148 425342 2.57% 149 794689 4.80% 150 3593592 21.73% 151 9288826 56.16% 16540105 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=43 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=239.49 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=45 prefix-density=0.22 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=39.71 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.7 sequence=TCAAGGAAGCTTTCAG SRR7169023 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:05:14 Started mapping on | Feb 10 17:05:14 Finished on | Feb 10 17:06:47 Mapping speed, Million of reads per hour | 640.26 Number of input reads | 16540105 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15438911 Uniquely mapped reads % | 93.34% Average mapped length | 295.76 Number of splices: Total | 14254262 Number of splices: Annotated (sjdb) | 14028046 Number of splices: GT/AG | 14051257 Number of splices: GC/AG | 163850 Number of splices: AT/AC | 11141 Number of splices: Non-canonical | 28014 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295319 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 33606 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 828143 828143 828143 N_multimapping 295319 295319 295319 N_noFeature 288025 15260593 354948 N_ambiguous 174548 895 62570 UnstrandedReadsAssigned:14976338 PositiveStrandReadsAssigned:177423 NegativeStrandReadsAssigned:15021393 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169023 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169023-trimmed-pair1.fastq SRR7169023-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,540,105 reads, 14,948,018 reads pseudoaligned [quant] estimated average fragment length: 260.628 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7169023.ke.tsv 34699 SRR7169023.se.tsv 87100 total ==> SRR7169023.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.37 252 8.36694 Potri.005G024800.1.v4.1 1035 775.372 48 3.61417 Potri.004G059700.1.v4.1 961 701.404 1 0.0832356 Potri.007G009000.2.v4.1 1416 1156.37 0 0 Potri.003G141000.2.v4.1 2943 2683.37 218.029 4.74362 Potri.016G087400.1.v4.1 270 68.5516 1911.59 1628 Potri.015G069301.1.v4.1 564 309.066 0 0 Potri.010G195200.1.v4.1 1773 1513.37 30 1.15732 Potri.012G127500.1.v4.1 977 717.391 4863 395.754 ==> SRR7169023.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 234 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169023 completed mapping pipeline successfully