Starting /dee2/code/volunteer_pipeline.sh SRR7169024 current disk space = 3058336497664 free memory = 1432914292 SRR7169024 SRAfilesize 49ad4f197122d1561630351883456310 SRR7169024.sra SRR7169024.sra file validated SRR7169024 is paired end SRR7169024 is conventional basespace SRR7169024 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169024_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.166 34.0 33.0 34.0 33.0 34.0 2 33.5025 34.0 34.0 34.0 33.0 34.0 3 33.4515 34.0 34.0 34.0 33.0 34.0 4 33.51125 34.0 34.0 34.0 33.0 34.0 5 33.51875 34.0 34.0 34.0 33.0 34.0 6 37.1765 38.0 38.0 38.0 36.0 38.0 7 37.45375 38.0 38.0 38.0 37.0 38.0 8 37.6055 38.0 38.0 38.0 38.0 38.0 9 37.572 38.0 38.0 38.0 38.0 38.0 10-14 37.51005 38.0 38.0 38.0 37.8 38.0 15-19 37.50150000000001 38.0 38.0 38.0 37.6 38.0 20-24 37.522949999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.45425 38.0 38.0 38.0 37.4 38.0 30-34 37.4305 38.0 38.0 38.0 37.2 38.0 35-39 37.36005 38.0 38.0 38.0 37.0 38.0 40-44 37.260799999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.20485 38.0 38.0 38.0 36.2 38.0 50-54 37.167500000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.118249999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.12745 38.0 38.0 38.0 36.0 38.0 65-69 37.09525 38.0 38.0 38.0 36.0 38.0 70-74 37.04365 38.0 38.0 38.0 36.0 38.0 75-79 37.0456 38.0 38.0 38.0 36.0 38.0 80-84 36.934200000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.859249999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.78869999999999 38.0 38.0 38.0 34.8 38.0 95-99 36.69930000000001 38.0 38.0 38.0 35.0 38.0 100-104 36.555600000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.48025 38.0 38.0 38.0 34.0 38.0 110-114 36.220600000000005 38.0 37.6 38.0 33.8 38.0 115-119 36.111599999999996 38.0 37.2 38.0 33.4 38.0 120-124 36.072649999999996 38.0 37.0 38.0 33.2 38.0 125-129 35.8823 38.0 37.0 38.0 32.8 38.0 130-134 35.596250000000005 38.0 36.0 38.0 31.0 38.0 135-139 35.4018 38.0 36.0 38.0 31.0 38.0 140-144 35.00269999999999 38.0 35.8 38.0 28.0 38.0 145-149 34.62425 38.0 35.2 38.0 27.8 38.0 150-151 31.649124999999998 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 3.0 17 3.0 18 0.0 19 2.0 20 3.0 21 5.0 22 4.0 23 4.0 24 12.0 25 14.0 26 10.0 27 18.0 28 26.0 29 27.0 30 37.0 31 63.0 32 58.0 33 85.0 34 125.0 35 229.0 36 550.0 37 2720.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.47698533131007 14.49165402124431 10.520991401112797 33.51036924633283 2 21.85 16.3 34.1 27.750000000000004 3 18.675 24.224999999999998 26.85 30.25 4 21.2 32.15 23.525 23.125 5 20.3 33.725 24.8 21.175 6 19.475 35.525 24.425 20.575 7 14.149999999999999 26.974999999999998 40.625 18.25 8 17.7 24.45 30.85 27.0 9 16.725 24.0 32.975 26.3 10-14 20.325 29.609999999999996 26.369999999999997 23.695 15-19 19.375 29.134999999999998 27.47 24.02 20-24 19.564999999999998 28.68 27.515 24.240000000000002 25-29 19.57 28.775000000000002 27.785 23.87 30-34 20.37203720372037 28.76787678767877 27.672767276727672 23.187318731873187 35-39 20.495 28.315 27.05 24.14 40-44 19.835 28.660000000000004 27.58 23.925 45-49 20.45 28.110000000000003 27.705000000000002 23.735 50-54 20.21 29.065 27.12 23.605 55-59 20.34 28.470000000000002 26.889999999999997 24.3 60-64 20.175 28.89 26.715 24.22 65-69 20.715 28.065 27.139999999999997 24.08 70-74 20.76 29.43 26.46 23.35 75-79 20.665 28.299999999999997 27.42 23.615 80-84 20.665 28.075 27.474999999999998 23.785 85-89 20.565 28.139999999999997 27.735 23.56 90-94 20.485 28.634999999999998 26.765 24.115000000000002 95-99 20.525 29.110000000000003 26.945000000000004 23.419999999999998 100-104 20.64 28.27 27.334999999999997 23.755000000000003 105-109 20.549999999999997 28.17 27.365000000000002 23.915 110-114 20.325 28.744999999999997 26.810000000000002 24.12 115-119 20.73 28.02 27.589999999999996 23.66 120-124 20.080000000000002 28.005000000000003 27.43 24.485 125-129 20.655 27.765 27.689999999999998 23.89 130-134 20.715 28.425 26.88 23.98 135-139 20.285 27.894999999999996 26.905 24.915000000000003 140-144 20.765 28.37 27.04 23.825 145-149 20.560000000000002 28.294999999999998 27.224999999999998 23.919999999999998 150-151 21.1375 28.487499999999997 27.250000000000004 23.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 4.5 26 5.0 27 5.0 28 8.0 29 12.0 30 17.5 31 24.5 32 31.0 33 37.0 34 45.5 35 73.0 36 91.0 37 105.0 38 132.0 39 154.0 40 177.5 41 211.0 42 255.5 43 268.5 44 269.0 45 263.5 46 250.5 47 255.5 48 235.5 49 204.5 50 177.5 51 151.5 52 125.5 53 101.0 54 78.5 55 54.0 56 35.0 57 24.5 58 24.0 59 21.5 60 16.0 61 9.0 62 7.5 63 7.0 64 5.0 65 4.0 66 3.0 67 2.5 68 2.0 69 3.0 70 3.5 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.3625 0.0 0.0 0.0 0.0 136-137 1.575 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGTAC 10 0.006832588 144.9875 8 >>END_MODULE SRR7169024 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169024_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93925 33.0 33.0 34.0 32.0 34.0 2 32.996 34.0 33.0 34.0 32.0 34.0 3 33.0325 34.0 33.0 34.0 32.0 34.0 4 32.93525 34.0 33.0 34.0 32.0 34.0 5 32.9805 34.0 33.0 34.0 32.0 34.0 6 37.174 38.0 38.0 38.0 37.0 38.0 7 37.23425 38.0 38.0 38.0 37.0 38.0 8 37.2775 38.0 38.0 38.0 37.0 38.0 9 37.241 38.0 38.0 38.0 37.0 38.0 10-14 37.18035 38.0 38.0 38.0 37.0 38.0 15-19 37.110850000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.07695 38.0 38.0 38.0 37.0 38.0 25-29 37.104949999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.085750000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.04375 38.0 38.0 38.0 36.8 38.0 40-44 36.98635 38.0 38.0 38.0 36.2 38.0 45-49 36.98375 38.0 38.0 38.0 36.2 38.0 50-54 36.9351 38.0 38.0 38.0 36.0 38.0 55-59 36.9173 38.0 38.0 38.0 36.0 38.0 60-64 36.8586 38.0 38.0 38.0 36.0 38.0 65-69 36.8154 38.0 38.0 38.0 36.0 38.0 70-74 36.729499999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.626999999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.5658 38.0 38.0 38.0 34.8 38.0 85-89 36.5139 38.0 38.0 38.0 34.2 38.0 90-94 36.3572 38.0 38.0 38.0 34.0 38.0 95-99 36.2611 38.0 38.0 38.0 34.0 38.0 100-104 36.1639 38.0 37.8 38.0 33.4 38.0 105-109 36.027950000000004 38.0 37.8 38.0 33.2 38.0 110-114 35.76995 38.0 37.0 38.0 32.2 38.0 115-119 35.58515 38.0 37.0 38.0 31.0 38.0 120-124 35.459450000000004 38.0 36.6 38.0 30.4 38.0 125-129 35.0563 38.0 36.0 38.0 28.0 38.0 130-134 34.8515 38.0 35.8 38.0 27.8 38.0 135-139 34.3938 38.0 35.0 38.0 24.8 38.0 140-144 33.80800000000001 38.0 35.0 38.0 22.2 38.0 145-149 33.33645 38.0 35.0 38.0 17.0 38.0 150-151 29.580125000000002 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 3.0 6 1.0 7 2.0 8 0.0 9 1.0 10 1.0 11 3.0 12 0.0 13 1.0 14 1.0 15 3.0 16 1.0 17 3.0 18 3.0 19 6.0 20 9.0 21 6.0 22 10.0 23 14.0 24 12.0 25 26.0 26 18.0 27 30.0 28 21.0 29 36.0 30 53.0 31 59.0 32 65.0 33 100.0 34 166.0 35 241.0 36 589.0 37 2506.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.300000000000004 21.2 13.875000000000002 25.624999999999996 2 26.863431715857928 25.812906453226613 30.7903951975988 16.53326663331666 3 20.851063829787233 28.735919899874844 30.813516896120152 19.59949937421777 4 24.361542313470206 32.999499248873306 24.18627941912869 18.452679018527792 5 23.773773773773772 36.33633633633634 21.77177177177177 18.11811811811812 6 20.75 36.275 24.55 18.425 7 20.125 21.55 38.1 20.225 8 22.125 24.9 25.674999999999997 27.3 9 20.549999999999997 25.624999999999996 29.299999999999997 24.525 10-14 23.42117105855293 28.846442322116104 25.786289314465723 21.94609730486524 15-19 22.839135654261707 27.85614245698279 27.355942376950782 21.948779511804723 20-24 23.778566785017752 28.194229134370158 26.964044606691 21.06315947392109 25-29 22.884576915383075 27.845569113822766 27.920584116823367 21.349269853970796 30-34 23.65854878231735 27.794169125368807 27.689153373005954 20.858128719307896 35-39 23.655 28.345 27.22 20.78 40-44 23.308496274441165 27.999199879981994 27.53413011951793 21.15817372605891 45-49 23.176158807940396 27.736386819340968 28.181409070453523 20.906045302265113 50-54 23.336166808340415 27.9813990699535 27.811390569528477 20.87104355217761 55-59 23.965 26.915 27.99 21.13 60-64 23.015 27.325 28.705000000000002 20.955 65-69 23.68118405920296 27.59637981899095 28.146407320366016 20.57602880144007 70-74 23.474999999999998 27.250000000000004 27.825 21.45 75-79 23.461173058652932 28.0114005700285 27.36136806840342 21.166058302915143 80-84 23.761188059402972 27.33136656832842 27.83639181959098 21.071053552677636 85-89 23.9 27.639999999999997 27.950000000000003 20.51 90-94 23.61 27.605 28.325 20.46 95-99 23.56 27.16 28.485 20.794999999999998 100-104 23.905 27.48 28.22 20.395 105-109 24.32 27.18 28.000000000000004 20.5 110-114 24.005000000000003 26.625 28.235 21.135 115-119 24.226211310565528 26.996349817490874 28.531426571328566 20.24601230061503 120-124 23.97239723972397 27.447744774477446 27.792779277927792 20.787078707870787 125-129 24.34 27.525 27.525 20.61 130-134 24.455 27.560000000000002 27.450000000000003 20.535 135-139 23.915 27.715 27.72 20.65 140-144 24.265 27.860000000000003 27.529999999999998 20.345 145-149 24.555 27.584999999999997 28.01 19.85 150-151 23.962500000000002 27.525 27.925 20.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.5 26 1.5 27 2.0 28 3.5 29 4.5 30 8.0 31 12.5 32 17.0 33 30.0 34 41.0 35 57.5 36 68.0 37 95.0 38 125.0 39 148.0 40 195.5 41 220.0 42 236.0 43 267.0 44 287.5 45 298.5 46 300.5 47 281.0 48 246.0 49 218.0 50 183.0 51 157.0 52 127.0 53 86.5 54 75.5 55 59.5 56 33.5 57 23.0 58 23.5 59 15.0 60 7.0 61 7.5 62 8.0 63 6.0 64 3.0 65 1.5 66 2.5 67 3.5 68 3.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.125 4 0.15 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.04 20-24 0.015 25-29 0.02 30-34 0.015 35-39 0.0 40-44 0.015 45-49 0.005 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9125000000000001 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.55 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGAAT 10 0.006830828 145.0 1 GAAAACA 10 0.006830828 145.0 2 GGTTCCC 10 0.006830828 145.0 1 >>END_MODULE Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814825 spots for SRR7169024.sra Written 814825 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra Read 814823 spots for SRR7169024.sra Written 814823 spots for SRR7169024.sra SRR ids: ['SRR7169024.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ys4kfitr SRR7169024.sra spots: 16296462 blocks: [[1, 814823], [814824, 1629646], [1629647, 2444469], [2444470, 3259292], [3259293, 4074115], [4074116, 4888938], [4888939, 5703761], [5703762, 6518584], [6518585, 7333407], [7333408, 8148230], [8148231, 8963053], [8963054, 9777876], [9777877, 10592699], [10592700, 11407522], [11407523, 12222345], [12222346, 13037168], [13037169, 13851991], [13851992, 14666814], [14666815, 15481637], [15481638, 16296462]] SRR7169024 file size 5500635 SRR7169024 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169024 SRR7169024_1.fastq SRR7169024_2.fastq Input file: SRR7169024_1.fastq Paired file: SRR7169024_2.fastq trimmed: SRR7169024-trimmed-pair1.fastq, SRR7169024-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:47:37 2025 >> started Mon Feb 10 16:47:56 2025 >> done (19.489s) 16296462 read pairs processed; of these: 19271 ( 0.12%) short read pairs filtered out after trimming by size control 10499 ( 0.06%) empty read pairs filtered out after trimming by size control 16266692 (99.82%) read pairs available; of these: 6380342 (39.22%) trimmed read pairs available after processing 9886350 (60.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 8 0.00% 21 6 0.00% 22 8 0.00% 23 1 0.00% 24 2 0.00% 25 5 0.00% 26 8 0.00% 27 4 0.00% 28 3 0.00% 29 8 0.00% 30 5 0.00% 31 1 0.00% 32 6 0.00% 33 9 0.00% 34 8 0.00% 35 9 0.00% 36 9 0.00% 37 6 0.00% 38 10 0.00% 39 9 0.00% 40 6 0.00% 41 8 0.00% 42 11 0.00% 43 10 0.00% 44 10 0.00% 45 9 0.00% 46 9 0.00% 47 13 0.00% 48 13 0.00% 49 11 0.00% 50 23 0.00% 51 23 0.00% 52 29 0.00% 53 29 0.00% 54 33 0.00% 55 34 0.00% 56 28 0.00% 57 46 0.00% 58 44 0.00% 59 50 0.00% 60 55 0.00% 61 67 0.00% 62 67 0.00% 63 75 0.00% 64 84 0.00% 65 131 0.00% 66 125 0.00% 67 108 0.00% 68 162 0.00% 69 182 0.00% 70 224 0.00% 71 256 0.00% 72 221 0.00% 73 280 0.00% 74 306 0.00% 75 341 0.00% 76 387 0.00% 77 433 0.00% 78 446 0.00% 79 503 0.00% 80 560 0.00% 81 683 0.00% 82 844 0.01% 83 905 0.01% 84 1752 0.01% 85 2257 0.01% 86 2263 0.01% 87 2466 0.02% 88 2511 0.02% 89 2492 0.02% 90 2781 0.02% 91 2855 0.02% 92 3126 0.02% 93 3294 0.02% 94 3440 0.02% 95 3698 0.02% 96 3833 0.02% 97 4165 0.03% 98 4398 0.03% 99 4558 0.03% 100 4911 0.03% 101 5141 0.03% 102 5587 0.03% 103 6196 0.04% 104 6494 0.04% 105 6929 0.04% 106 7483 0.05% 107 7769 0.05% 108 8058 0.05% 109 8478 0.05% 110 9076 0.06% 111 9669 0.06% 112 10315 0.06% 113 11080 0.07% 114 11922 0.07% 115 12727 0.08% 116 13741 0.08% 117 14444 0.09% 118 15200 0.09% 119 15804 0.10% 120 16731 0.10% 121 17825 0.11% 122 18921 0.12% 123 20162 0.12% 124 21575 0.13% 125 23538 0.14% 126 24813 0.15% 127 26454 0.16% 128 27736 0.17% 129 29492 0.18% 130 31429 0.19% 131 33740 0.21% 132 36163 0.22% 133 39285 0.24% 134 42363 0.26% 135 45797 0.28% 136 49994 0.31% 137 53950 0.33% 138 59232 0.36% 139 64756 0.40% 140 70347 0.43% 141 78024 0.48% 142 86295 0.53% 143 99700 0.61% 144 115938 0.71% 145 139967 0.86% 146 172954 1.06% 147 234155 1.44% 148 351093 2.16% 149 684698 4.21% 150 3414286 20.99% 151 9886350 60.78% 16266692 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=42 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=254.51 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=33 prefix-density=0.31 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=260.32 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=29.4 sequence=AAGAAGAAGAAA SRR7169024 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:48:46 Started mapping on | Feb 10 16:48:46 Finished on | Feb 10 16:50:13 Mapping speed, Million of reads per hour | 673.10 Number of input reads | 16266692 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15400823 Uniquely mapped reads % | 94.68% Average mapped length | 296.87 Number of splices: Total | 15058657 Number of splices: Annotated (sjdb) | 14819913 Number of splices: GT/AG | 14839497 Number of splices: GC/AG | 176674 Number of splices: AT/AC | 12116 Number of splices: Non-canonical | 30370 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283536 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 37948 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 600016 600016 600016 N_multimapping 283536 283536 283536 N_noFeature 314261 15253980 380352 N_ambiguous 149217 884 67826 UnstrandedReadsAssigned:14937345 PositiveStrandReadsAssigned:145959 NegativeStrandReadsAssigned:14952645 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169024 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169024-trimmed-pair1.fastq SRR7169024-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,266,692 reads, 14,836,618 reads pseudoaligned [quant] estimated average fragment length: 270.779 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR7169024.ke.tsv 34699 SRR7169024.se.tsv 87100 total ==> SRR7169024.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.22 279 9.79863 Potri.005G024800.1.v4.1 1035 765.221 42 3.36992 Potri.004G059700.1.v4.1 961 691.36 4 0.355233 Potri.007G009000.2.v4.1 1416 1146.22 0 0 Potri.003G141000.2.v4.1 2943 2673.22 255.054 5.85808 Potri.016G087400.1.v4.1 270 64.4444 1497 1426.25 Potri.015G069301.1.v4.1 564 302.609 0 0 Potri.010G195200.1.v4.1 1773 1503.22 23 0.939426 Potri.012G127500.1.v4.1 977 707.265 5256 456.279 ==> SRR7169024.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 949 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169024 completed mapping pipeline successfully