Starting /dee2/code/volunteer_pipeline.sh SRR7169025 current disk space = 3058351738880 free memory = 1345032388 SRR7169025 SRAfilesize 39ce750f4b3d3a5008b4269158c417d3 SRR7169025.sra SRR7169025.sra file validated SRR7169025 is paired end SRR7169025 is conventional basespace SRR7169025 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169025_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.24675 34.0 34.0 34.0 33.0 34.0 2 33.4785 34.0 34.0 34.0 33.0 34.0 3 33.47925 34.0 34.0 34.0 33.0 34.0 4 33.451 34.0 34.0 34.0 33.0 34.0 5 33.4895 34.0 34.0 34.0 33.0 34.0 6 37.171 38.0 37.0 38.0 36.0 38.0 7 37.43775 38.0 38.0 38.0 37.0 38.0 8 37.476 38.0 38.0 38.0 37.0 38.0 9 37.499 38.0 38.0 38.0 38.0 38.0 10-14 37.52795 38.0 38.0 38.0 37.6 38.0 15-19 37.510749999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.5428 38.0 38.0 38.0 38.0 38.0 25-29 37.4857 38.0 38.0 38.0 38.0 38.0 30-34 37.46915 38.0 38.0 38.0 37.8 38.0 35-39 37.386849999999995 38.0 38.0 38.0 37.4 38.0 40-44 37.318799999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.25025 38.0 38.0 38.0 37.0 38.0 50-54 37.2041 38.0 38.0 38.0 37.0 38.0 55-59 37.18195 38.0 38.0 38.0 36.6 38.0 60-64 37.170899999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.148849999999996 38.0 38.0 38.0 36.6 38.0 70-74 37.118550000000006 38.0 38.0 38.0 36.2 38.0 75-79 37.057100000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.01245 38.0 38.0 38.0 36.0 38.0 85-89 36.89235 38.0 38.0 38.0 35.8 38.0 90-94 36.83165 38.0 38.0 38.0 35.8 38.0 95-99 36.80585 38.0 38.0 38.0 35.6 38.0 100-104 36.6374 38.0 38.0 38.0 35.0 38.0 105-109 36.58765 38.0 38.0 38.0 35.0 38.0 110-114 36.4086 38.0 38.0 38.0 34.0 38.0 115-119 36.3331 38.0 38.0 38.0 34.0 38.0 120-124 36.20385 38.0 38.0 38.0 34.0 38.0 125-129 36.0021 38.0 37.6 38.0 33.4 38.0 130-134 35.7694 38.0 37.0 38.0 33.0 38.0 135-139 35.57945 38.0 36.4 38.0 31.4 38.0 140-144 35.27935 38.0 36.0 38.0 31.2 38.0 145-149 34.7394 38.0 35.8 38.0 28.6 38.0 150-151 32.189499999999995 37.0 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 3.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 3.0 20 8.0 21 4.0 22 6.0 23 3.0 24 14.0 25 13.0 26 12.0 27 16.0 28 24.0 29 23.0 30 39.0 31 40.0 32 45.0 33 63.0 34 126.0 35 184.0 36 451.0 37 2912.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.73139974779319 14.905422446406053 10.76923076923077 33.593947036569986 2 22.650000000000002 14.75 33.475 29.125 3 20.125 20.8 27.900000000000002 31.175000000000004 4 22.75 29.625 23.150000000000002 24.474999999999998 5 22.45 32.6 23.65 21.3 6 20.474999999999998 34.575 25.525 19.425 7 14.799999999999999 27.650000000000002 39.725 17.825 8 19.425 27.125 28.275 25.174999999999997 9 16.575 26.724999999999998 32.6 24.099999999999998 10-14 20.035 30.575000000000003 27.195000000000004 22.195 15-19 19.885 29.39 27.150000000000002 23.575 20-24 19.845 29.75 27.169999999999998 23.235 25-29 19.615 29.244999999999997 27.49 23.65 30-34 20.200000000000003 29.78 26.834999999999997 23.185 35-39 20.285 29.465000000000003 26.724999999999998 23.525 40-44 19.794999999999998 28.935 27.51 23.76 45-49 19.465 28.815 27.275 24.445 50-54 19.78 29.599999999999998 27.235 23.385 55-59 20.105 28.655 27.62 23.62 60-64 20.885 29.049999999999997 26.6 23.465 65-69 19.975 28.275 27.315 24.435000000000002 70-74 19.965 28.785 27.415 23.835 75-79 20.380000000000003 28.965000000000003 26.735 23.919999999999998 80-84 20.3 28.585 26.86 24.255 85-89 20.395 28.660000000000004 27.205000000000002 23.74 90-94 20.599999999999998 28.544999999999998 26.605 24.25 95-99 20.495 28.965000000000003 26.840000000000003 23.7 100-104 21.0 28.749999999999996 26.979999999999997 23.27 105-109 20.119999999999997 28.03 26.97 24.88 110-114 20.71 28.015 27.025 24.25 115-119 20.419999999999998 28.689999999999998 26.965 23.925 120-124 20.380000000000003 28.58 26.8 24.240000000000002 125-129 20.685000000000002 27.939999999999998 27.04 24.335 130-134 21.36 27.985 27.025 23.630000000000003 135-139 20.9 28.225 26.845000000000002 24.03 140-144 21.41 27.825 26.58 24.185000000000002 145-149 21.81 28.32 26.735 23.135 150-151 21.5 27.925 26.637499999999996 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 2.5 21 4.0 22 2.0 23 1.5 24 2.5 25 3.5 26 7.0 27 10.5 28 12.0 29 22.0 30 30.5 31 38.0 32 51.5 33 54.0 34 60.5 35 70.0 36 86.5 37 122.0 38 132.5 39 143.0 40 164.5 41 189.5 42 228.0 43 235.0 44 242.5 45 258.5 46 242.5 47 223.0 48 226.5 49 221.5 50 176.0 51 134.5 52 122.5 53 108.5 54 89.0 55 68.5 56 46.0 57 37.0 58 34.0 59 26.0 60 18.5 61 12.0 62 8.0 63 4.5 64 3.0 65 2.5 66 2.0 67 2.5 68 3.0 69 2.0 70 2.5 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.5125 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 2.9 0.0 0.0 0.0 0.0 134-135 3.2125 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGCTC 10 0.006830828 145.0 2 GAGCATT 10 0.006830828 145.0 9 TCATATT 10 0.006830828 145.0 9 AAAAAAA 130 0.0070306947 8.923077 85-89 >>END_MODULE SRR7169025 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169025_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91075 33.0 33.0 34.0 32.0 34.0 2 33.02925 34.0 33.0 34.0 32.0 34.0 3 33.0515 34.0 33.0 34.0 32.0 34.0 4 33.00625 34.0 33.0 34.0 32.0 34.0 5 33.001 34.0 33.0 34.0 33.0 34.0 6 37.30775 38.0 38.0 38.0 37.0 38.0 7 37.33 38.0 38.0 38.0 37.0 38.0 8 37.27375 38.0 38.0 38.0 37.0 38.0 9 37.2655 38.0 38.0 38.0 37.0 38.0 10-14 37.181650000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.20905 38.0 38.0 38.0 37.0 38.0 20-24 37.15785 38.0 38.0 38.0 37.0 38.0 25-29 37.17715 38.0 38.0 38.0 37.0 38.0 30-34 37.17999999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.08045 38.0 38.0 38.0 37.0 38.0 40-44 37.133449999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.03255 38.0 38.0 38.0 37.0 38.0 50-54 37.057550000000006 38.0 38.0 38.0 37.0 38.0 55-59 36.983799999999995 38.0 38.0 38.0 36.8 38.0 60-64 36.96345 38.0 38.0 38.0 36.2 38.0 65-69 36.8995 38.0 38.0 38.0 36.0 38.0 70-74 36.85574999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.79344999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.761 38.0 38.0 38.0 35.8 38.0 85-89 36.621449999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.556349999999995 38.0 38.0 38.0 35.0 38.0 95-99 36.4024 38.0 38.0 38.0 34.2 38.0 100-104 36.367000000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.238800000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.044000000000004 38.0 38.0 38.0 33.6 38.0 115-119 35.80925 38.0 37.6 38.0 32.6 38.0 120-124 35.68325 38.0 37.6 38.0 32.2 38.0 125-129 35.413149999999995 38.0 36.4 38.0 31.0 38.0 130-134 35.14695 38.0 36.0 38.0 29.4 38.0 135-139 34.8317 38.0 35.8 38.0 27.8 38.0 140-144 34.39785 38.0 35.0 38.0 26.4 38.0 145-149 33.955499999999994 38.0 35.0 38.0 23.0 38.0 150-151 30.638875 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 0.0 5 1.0 6 2.0 7 1.0 8 2.0 9 2.0 10 0.0 11 0.0 12 1.0 13 3.0 14 2.0 15 4.0 16 0.0 17 5.0 18 3.0 19 10.0 20 4.0 21 3.0 22 11.0 23 14.0 24 11.0 25 20.0 26 27.0 27 23.0 28 22.0 29 24.0 30 35.0 31 63.0 32 57.0 33 66.0 34 112.0 35 206.0 36 514.0 37 2741.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.224999999999994 22.400000000000002 14.799999999999999 24.575 2 27.406851712928233 26.70667666916729 28.532133033258315 17.35433858464616 3 21.966474856142106 28.071053289967473 30.297723292469353 19.664748561421067 4 24.5995995995996 33.00800800800801 23.823823823823822 18.56856856856857 5 26.294721040780583 33.700275206404804 21.4160620465349 18.58894170627971 6 22.025 36.7 22.625 18.65 7 21.7 21.45 36.6 20.25 8 23.400000000000002 24.4 26.825 25.374999999999996 9 22.0 25.2 28.7 24.099999999999998 10-14 24.14 28.845 25.014999999999997 22.0 15-19 23.74856228434265 27.60914137120568 27.17407611141671 21.468220233034955 20-24 23.76618830941547 27.86639331966598 26.79133956697835 21.576078803940195 25-29 23.60118005900295 28.131406570328515 27.02135106755338 21.246062303115156 30-34 23.835 28.375 26.674999999999997 21.115000000000002 35-39 23.89 27.735 27.0 21.375 40-44 24.305 27.74 26.965 20.990000000000002 45-49 23.985 26.784999999999997 27.6 21.63 50-54 23.445 28.055000000000003 27.315 21.185000000000002 55-59 23.605 27.529999999999998 27.74 21.125 60-64 23.919999999999998 27.455000000000002 27.455000000000002 21.17 65-69 23.915 27.68 27.32 21.085 70-74 24.455 27.185 27.445000000000004 20.915 75-79 23.75 27.445000000000004 28.139999999999997 20.665 80-84 23.565 27.325 27.944999999999997 21.165 85-89 24.07 27.685 27.26 20.985 90-94 23.724999999999998 27.43 27.884999999999998 20.96 95-99 23.655 27.22 27.83 21.295 100-104 24.57 27.250000000000004 27.07 21.11 105-109 24.185000000000002 26.75 28.34 20.724999999999998 110-114 23.56 27.92 28.13 20.39 115-119 24.115000000000002 26.97 28.235 20.68 120-124 23.736186809340467 27.65638281914096 27.956397819890995 20.651032551627583 125-129 24.775 27.48 27.525 20.22 130-134 24.515 27.060000000000002 27.915 20.51 135-139 24.044999999999998 27.785 27.715 20.455000000000002 140-144 24.295 27.355 27.894999999999996 20.455000000000002 145-149 24.84 27.310000000000002 27.35 20.5 150-151 24.887500000000003 26.8125 27.6625 20.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.0 22 1.0 23 1.5 24 1.0 25 0.0 26 0.5 27 3.5 28 4.5 29 3.5 30 5.0 31 10.5 32 17.5 33 27.0 34 36.0 35 44.0 36 53.0 37 71.5 38 100.0 39 129.5 40 180.0 41 226.0 42 233.0 43 249.0 44 299.5 45 299.5 46 281.0 47 279.5 48 244.5 49 221.5 50 207.0 51 163.5 52 127.0 53 116.0 54 93.0 55 65.5 56 52.0 57 40.5 58 26.5 59 17.5 60 13.5 61 12.0 62 11.0 63 8.5 64 4.0 65 1.5 66 3.5 67 3.5 68 2.0 69 0.5 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.075 4 0.1 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.015 20-24 0.005 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.425 0.0 0.0 0.0 0.0 130-131 2.6 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760986 spots for SRR7169025.sra Written 760986 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra Read 760971 spots for SRR7169025.sra Written 760971 spots for SRR7169025.sra SRR ids: ['SRR7169025.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1wjate_p SRR7169025.sra spots: 15219435 blocks: [[1, 760971], [760972, 1521942], [1521943, 2282913], [2282914, 3043884], [3043885, 3804855], [3804856, 4565826], [4565827, 5326797], [5326798, 6087768], [6087769, 6848739], [6848740, 7609710], [7609711, 8370681], [8370682, 9131652], [9131653, 9892623], [9892624, 10653594], [10653595, 11414565], [11414566, 12175536], [12175537, 12936507], [12936508, 13697478], [13697479, 14458449], [14458450, 15219435]] SRR7169025 file size 5135666 SRR7169025 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169025 SRR7169025_1.fastq SRR7169025_2.fastq Input file: SRR7169025_1.fastq Paired file: SRR7169025_2.fastq trimmed: SRR7169025-trimmed-pair1.fastq, SRR7169025-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:49:57 2025 >> started Mon Feb 10 16:50:14 2025 >> done (16.583s) 15219435 read pairs processed; of these: 29603 ( 0.19%) short read pairs filtered out after trimming by size control 16236 ( 0.11%) empty read pairs filtered out after trimming by size control 15173596 (99.70%) read pairs available; of these: 6007604 (39.59%) trimmed read pairs available after processing 9165992 (60.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 7 0.00% 21 5 0.00% 22 9 0.00% 23 7 0.00% 24 11 0.00% 25 8 0.00% 26 7 0.00% 27 7 0.00% 28 10 0.00% 29 10 0.00% 30 8 0.00% 31 8 0.00% 32 5 0.00% 33 9 0.00% 34 7 0.00% 35 9 0.00% 36 10 0.00% 37 18 0.00% 38 10 0.00% 39 13 0.00% 40 9 0.00% 41 14 0.00% 42 11 0.00% 43 11 0.00% 44 19 0.00% 45 17 0.00% 46 18 0.00% 47 18 0.00% 48 20 0.00% 49 40 0.00% 50 31 0.00% 51 31 0.00% 52 32 0.00% 53 39 0.00% 54 38 0.00% 55 36 0.00% 56 46 0.00% 57 50 0.00% 58 57 0.00% 59 70 0.00% 60 84 0.00% 61 104 0.00% 62 92 0.00% 63 112 0.00% 64 107 0.00% 65 137 0.00% 66 138 0.00% 67 170 0.00% 68 210 0.00% 69 267 0.00% 70 417 0.00% 71 372 0.00% 72 360 0.00% 73 332 0.00% 74 436 0.00% 75 502 0.00% 76 544 0.00% 77 638 0.00% 78 728 0.00% 79 765 0.01% 80 943 0.01% 81 1116 0.01% 82 1225 0.01% 83 1398 0.01% 84 2628 0.02% 85 3593 0.02% 86 3561 0.02% 87 3796 0.03% 88 4033 0.03% 89 4118 0.03% 90 4289 0.03% 91 4504 0.03% 92 4615 0.03% 93 5049 0.03% 94 5433 0.04% 95 5830 0.04% 96 6280 0.04% 97 6385 0.04% 98 6805 0.04% 99 6957 0.05% 100 7824 0.05% 101 8210 0.05% 102 8729 0.06% 103 9134 0.06% 104 10074 0.07% 105 10608 0.07% 106 11091 0.07% 107 11605 0.08% 108 12377 0.08% 109 13109 0.09% 110 13688 0.09% 111 14462 0.10% 112 15184 0.10% 113 16528 0.11% 114 17227 0.11% 115 18424 0.12% 116 19458 0.13% 117 20614 0.14% 118 21282 0.14% 119 22041 0.15% 120 23261 0.15% 121 24012 0.16% 122 25323 0.17% 123 27229 0.18% 124 28647 0.19% 125 30321 0.20% 126 31808 0.21% 127 33502 0.22% 128 35039 0.23% 129 36699 0.24% 130 38759 0.26% 131 40745 0.27% 132 43002 0.28% 133 46200 0.30% 134 49295 0.32% 135 52274 0.34% 136 55996 0.37% 137 59134 0.39% 138 64329 0.42% 139 68790 0.45% 140 73469 0.48% 141 80238 0.53% 142 86727 0.57% 143 97116 0.64% 144 110802 0.73% 145 130182 0.86% 146 156228 1.03% 147 206015 1.36% 148 299490 1.97% 149 571176 3.76% 150 3010259 19.84% 151 9165992 60.41% 15173596 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=35 prefix-density=0.28 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=218.26 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=17.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=38 prefix-density=0.28 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=55.30 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=13.5 sequence=TGTTGGTGGTGG SRR7169025 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:51:05 Started mapping on | Feb 10 16:51:06 Finished on | Feb 10 16:53:21 Mapping speed, Million of reads per hour | 404.63 Number of input reads | 15173596 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13890726 Uniquely mapped reads % | 91.55% Average mapped length | 295.63 Number of splices: Total | 11955699 Number of splices: Annotated (sjdb) | 11759975 Number of splices: GT/AG | 11785729 Number of splices: GC/AG | 132213 Number of splices: AT/AC | 9167 Number of splices: Non-canonical | 28590 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279676 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 65110 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.10% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1025122 1025122 1025122 N_multimapping 279676 279676 279676 N_noFeature 279350 13715079 346975 N_ambiguous 161924 1113 53086 UnstrandedReadsAssigned:13449452 PositiveStrandReadsAssigned:174534 NegativeStrandReadsAssigned:13490665 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169025 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169025-trimmed-pair1.fastq SRR7169025-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,173,596 reads, 13,470,073 reads pseudoaligned [quant] estimated average fragment length: 236.274 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7169025.ke.tsv 34699 SRR7169025.se.tsv 87100 total ==> SRR7169025.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.73 229 7.94552 Potri.005G024800.1.v4.1 1035 799.726 32 2.47503 Potri.004G059700.1.v4.1 961 725.732 4 0.340922 Potri.007G009000.2.v4.1 1416 1180.73 0 0 Potri.003G141000.2.v4.1 2943 2707.73 192 4.38599 Potri.016G087400.1.v4.1 270 73.946 1141.48 954.825 Potri.015G069301.1.v4.1 564 330.781 0 0 Potri.010G195200.1.v4.1 1773 1537.73 12 0.482696 Potri.012G127500.1.v4.1 977 741.726 2804 233.833 ==> SRR7169025.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1194 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7169025 completed mapping pipeline successfully