Starting /dee2/code/volunteer_pipeline.sh SRR7169026 current disk space = 3058014969856 free memory = 1529515040 SRR7169026 SRAfilesize 49bec8cb31d0d8fb7f87550589998df6 SRR7169026.sra SRR7169026.sra file validated SRR7169026 is paired end SRR7169026 is conventional basespace SRR7169026 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169026_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.569 34.0 33.0 34.0 32.0 34.0 2 33.0575 34.0 33.0 34.0 32.0 34.0 3 33.09175 34.0 33.0 34.0 32.0 34.0 4 33.00625 34.0 33.0 34.0 32.0 34.0 5 33.10725 34.0 33.0 34.0 32.0 34.0 6 36.91675 38.0 37.0 38.0 35.0 38.0 7 37.2095 38.0 38.0 38.0 36.0 38.0 8 37.29525 38.0 38.0 38.0 37.0 38.0 9 37.346 38.0 38.0 38.0 37.0 38.0 10-14 37.33165 38.0 38.0 38.0 37.0 38.0 15-19 37.28945 38.0 38.0 38.0 37.0 38.0 20-24 37.1658 38.0 38.0 38.0 36.2 38.0 25-29 37.06845 38.0 38.0 38.0 36.0 38.0 30-34 37.02405 38.0 38.0 38.0 36.0 38.0 35-39 36.886399999999995 38.0 38.0 38.0 35.6 38.0 40-44 36.7606 38.0 38.0 38.0 34.8 38.0 45-49 36.8377 38.0 38.0 38.0 35.0 38.0 50-54 36.829950000000004 38.0 38.0 38.0 35.0 38.0 55-59 36.567600000000006 38.0 38.0 38.0 34.0 38.0 60-64 36.575599999999994 38.0 38.0 38.0 34.0 38.0 65-69 36.5075 38.0 38.0 38.0 34.0 38.0 70-74 36.4958 38.0 37.8 38.0 34.0 38.0 75-79 36.3289 38.0 37.0 38.0 33.6 38.0 80-84 35.729699999999994 38.0 36.8 38.0 30.8 38.0 85-89 35.74925 38.0 37.0 38.0 30.2 38.0 90-94 35.373650000000005 38.0 36.4 38.0 29.0 38.0 95-99 35.33885 38.0 36.0 38.0 28.8 38.0 100-104 35.17195 38.0 36.0 38.0 28.4 38.0 105-109 35.28685 38.0 36.0 38.0 29.0 38.0 110-114 34.7496 38.0 35.2 38.0 26.4 38.0 115-119 34.476600000000005 38.0 34.8 38.0 25.0 38.0 120-124 34.06609999999999 37.8 34.2 38.0 23.4 38.0 125-129 33.20245 37.4 33.4 38.0 17.8 38.0 130-134 32.5991 37.2 32.0 38.0 17.2 38.0 135-139 33.15465 38.0 33.8 38.0 18.6 38.0 140-144 32.6991 38.0 33.0 38.0 14.2 38.0 145-149 31.565999999999995 36.6 31.8 38.0 11.2 38.0 150-151 27.006875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 3.0 14 0.0 15 1.0 16 2.0 17 2.0 18 2.0 19 10.0 20 10.0 21 6.0 22 9.0 23 19.0 24 18.0 25 26.0 26 35.0 27 46.0 28 47.0 29 51.0 30 67.0 31 96.0 32 167.0 33 168.0 34 253.0 35 455.0 36 910.0 37 1594.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.836094825388734 13.739485087942901 10.75707366811114 34.66734641855723 2 22.625 17.299999999999997 33.35 26.724999999999998 3 18.55 23.525 27.05 30.875000000000004 4 20.674999999999997 31.275 23.125 24.925 5 21.6 34.949999999999996 23.175 20.275000000000002 6 20.200000000000003 36.6 23.150000000000002 20.05 7 15.299999999999999 25.025 41.199999999999996 18.475 8 17.95 25.25 30.275000000000002 26.525 9 18.025 25.275 32.75 23.95 10-14 20.294999999999998 29.195 26.540000000000003 23.97 15-19 19.72 28.749999999999996 27.575 23.955000000000002 20-24 20.445 28.65 27.705000000000002 23.200000000000003 25-29 19.825 28.804999999999996 27.77 23.599999999999998 30-34 20.09 28.804999999999996 26.93 24.175 35-39 20.433064959743962 28.71430714607191 26.78901835275291 24.063609541431212 40-44 19.689999999999998 29.025000000000002 27.405 23.880000000000003 45-49 20.143021453217983 29.304395659348902 26.95404310646597 23.598539780967144 50-54 20.94 28.015 27.52 23.525 55-59 20.25 28.815 27.439999999999998 23.494999999999997 60-64 20.685000000000002 28.32 27.650000000000002 23.345 65-69 20.605 28.83 27.36 23.205000000000002 70-74 20.55602780139007 28.55642782139107 27.391369568478424 23.496174808740435 75-79 20.905 28.46 26.545 24.09 80-84 20.375294766945963 28.774271235763383 26.98309166624856 23.867342331042096 85-89 20.56135770234987 28.46957220325367 27.385017071701146 23.58405302269532 90-94 20.839392267963696 28.52128566414281 26.796369653512507 23.842952414380985 95-99 20.916084267685655 28.503192719593745 26.884207350796924 23.696515661923677 100-104 20.881600722130283 28.594353342359963 27.155107567323604 23.36893836818615 105-109 20.97470387472395 27.835775948604695 27.805661513752263 23.383858662919092 110-114 21.12153282840949 27.77749912223504 27.250840146461353 23.850127902894116 115-119 20.53159478435306 28.836509528585758 27.206619859578733 23.425275827482448 120-124 21.07 28.58 27.375 22.975 125-129 21.259960908134115 27.810354332681804 27.414423896155967 23.515260863028118 130-134 21.179732795563396 27.81951096546509 27.24981094025712 23.75094529871439 135-139 21.44766708701135 28.19167717528373 26.69861286254729 23.66204287515763 140-144 21.272863943873716 27.957905286895514 26.855424705587573 23.913806063643197 145-149 20.896048326201864 28.638308582934812 27.123080795368736 23.342562295494588 150-151 21.255796465722522 27.183857626268953 27.19639052512846 24.36395538288006 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 1.5 24 3.5 25 3.5 26 4.0 27 5.5 28 6.0 29 11.5 30 18.0 31 19.0 32 27.5 33 47.0 34 57.0 35 68.5 36 88.0 37 106.0 38 126.0 39 144.0 40 166.0 41 225.0 42 257.5 43 245.0 44 261.0 45 261.0 46 263.5 47 267.5 48 237.0 49 211.5 50 183.5 51 160.5 52 139.0 53 100.0 54 74.0 55 51.5 56 32.0 57 31.5 58 26.0 59 18.0 60 10.5 61 5.0 62 5.0 63 5.5 64 4.5 65 2.0 66 3.5 67 3.0 68 2.0 69 2.5 70 2.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.345 85-89 0.42 90-94 0.28500000000000003 95-99 0.555 100-104 0.295 105-109 0.38 110-114 0.315 115-119 0.3 120-124 0.0 125-129 0.23500000000000001 130-134 0.8250000000000001 135-139 0.8750000000000001 140-144 0.22499999999999998 145-149 0.675 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.025 0.0 0.0 0.0 92-93 0.05 0.025 0.0 0.0 0.0 94-95 0.05 0.025 0.0 0.0 0.0 96-97 0.075 0.025 0.0 0.0 0.0 98-99 0.1 0.025 0.0 0.0 0.0 100-101 0.1375 0.025 0.0 0.0 0.0 102-103 0.16249999999999998 0.025 0.0 0.0 0.0 104-105 0.175 0.025 0.0 0.0 0.0 106-107 0.2 0.025 0.0 0.0 0.0 108-109 0.225 0.025 0.0 0.0 0.0 110-111 0.225 0.025 0.0 0.0 0.0 112-113 0.2625 0.025 0.0 0.0 0.0 114-115 0.275 0.025 0.0 0.0 0.0 116-117 0.36250000000000004 0.025 0.0 0.0 0.0 118-119 0.425 0.025 0.0 0.0 0.0 120-121 0.45 0.025 0.0 0.0 0.0 122-123 0.4625 0.025 0.0 0.0 0.0 124-125 0.5 0.025 0.0 0.0 0.0 126-127 0.5874999999999999 0.025 0.0 0.0 0.0 128-129 0.725 0.025 0.0 0.0 0.0 130-131 0.825 0.025 0.0 0.0 0.0 132-133 1.1375 0.025 0.0 0.0 0.0 134-135 1.3125 0.025 0.0 0.0 0.0 136-137 1.45 0.025 0.0 0.0 0.0 138-139 1.5875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169026 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169026_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7525 33.0 33.0 34.0 32.0 34.0 2 32.8695 34.0 33.0 34.0 32.0 34.0 3 32.8705 34.0 33.0 34.0 32.0 34.0 4 32.78 34.0 33.0 34.0 32.0 34.0 5 32.77875 34.0 33.0 34.0 32.0 34.0 6 36.7975 38.0 38.0 38.0 36.0 38.0 7 36.594 38.0 38.0 38.0 36.0 38.0 8 36.23925 38.0 38.0 38.0 35.0 38.0 9 36.62675 38.0 38.0 38.0 35.0 38.0 10-14 35.93845 38.0 38.0 38.0 32.2 38.0 15-19 35.65695 38.0 38.0 38.0 33.0 38.0 20-24 36.040049999999994 38.0 38.0 38.0 33.4 38.0 25-29 36.32125 38.0 38.0 38.0 34.4 38.0 30-34 36.236850000000004 38.0 38.0 38.0 34.4 38.0 35-39 36.3351 38.0 38.0 38.0 35.0 38.0 40-44 36.3352 38.0 38.0 38.0 34.6 38.0 45-49 36.326350000000005 38.0 38.0 38.0 34.8 38.0 50-54 35.67645 38.0 38.0 38.0 32.6 38.0 55-59 34.910700000000006 38.0 38.0 38.0 27.4 38.0 60-64 35.079750000000004 38.0 38.0 38.0 28.6 38.0 65-69 35.4264 38.0 38.0 38.0 31.4 38.0 70-74 35.1284 38.0 37.8 38.0 28.8 38.0 75-79 35.053149999999995 38.0 38.0 38.0 28.2 38.0 80-84 35.197199999999995 38.0 38.0 38.0 29.6 38.0 85-89 35.2388 38.0 38.0 38.0 30.2 38.0 90-94 35.057950000000005 38.0 38.0 38.0 29.2 38.0 95-99 34.982350000000004 38.0 37.4 38.0 29.2 38.0 100-104 34.5125 38.0 37.0 38.0 25.6 38.0 105-109 34.3994 38.0 37.0 38.0 24.2 38.0 110-114 34.0743 38.0 36.2 38.0 19.8 38.0 115-119 34.1152 38.0 36.0 38.0 22.6 38.0 120-124 34.19395000000001 38.0 36.0 38.0 22.4 38.0 125-129 33.9539 38.0 36.0 38.0 21.8 38.0 130-134 33.42445 38.0 34.8 38.0 17.6 38.0 135-139 32.92555 38.0 34.2 38.0 14.2 38.0 140-144 32.63605 38.0 34.0 38.0 13.6 38.0 145-149 31.714550000000003 38.0 33.2 38.0 6.4 38.0 150-151 28.307375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 34.0 4 7.0 5 3.0 6 3.0 7 2.0 8 21.0 9 2.0 10 22.0 11 29.0 12 14.0 13 6.0 14 9.0 15 6.0 16 2.0 17 6.0 18 5.0 19 10.0 20 11.0 21 16.0 22 16.0 23 18.0 24 14.0 25 22.0 26 35.0 27 32.0 28 45.0 29 54.0 30 54.0 31 65.0 32 64.0 33 129.0 34 154.0 35 203.0 36 493.0 37 2384.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.025 20.95 14.124999999999998 26.900000000000002 2 25.674999999999997 26.25 30.55 17.525 3 20.3 28.775000000000002 32.375 18.55 4 23.425 34.150000000000006 23.599999999999998 18.825 5 24.10602650662666 37.23430857714429 21.080270067516878 17.57939484871218 6 21.187077385424494 36.18832957675933 23.89181066867017 18.732782369146005 7 20.165537998495108 21.494858289440682 37.57210935540506 20.767494356659142 8 22.69503546099291 24.797365754812564 25.6838905775076 26.82370820668693 9 20.686200851490106 25.494615577260205 29.42649636864513 24.392687202604556 10-14 23.060476481368354 29.006312360008145 26.145387904703725 21.787823253919772 15-19 22.794382427079583 28.02098873398837 27.56314625237924 21.621482586552805 20-24 22.896509801935057 27.820272529253838 27.855731725849754 21.42748594296135 25-29 23.44250801282051 28.560697115384613 26.993189102564102 21.003605769230766 30-34 22.8669458600333 27.529138705282808 27.952974418487308 21.65094101619658 35-39 23.056421603137885 28.090113647792414 27.66770592376546 21.185758825304234 40-44 23.64970105009295 27.508415816711047 27.679244335024872 21.16263879817113 45-49 23.9505924884515 27.826872866037355 27.13898373167303 21.08355091383812 50-54 23.33367357354292 27.98815964070634 27.488006532612026 21.190160253138714 55-59 23.51720201338799 27.5076539878574 27.419438534585648 21.55570546416896 60-64 23.11516155758078 27.801367025683515 28.13794531897266 20.945526097763047 65-69 23.46251912289648 28.143804181540034 27.802141764405913 20.591534931157575 70-74 23.97042210126322 28.068193488754233 27.641984184040258 20.31940022594228 75-79 23.543577394066713 27.109699236562996 28.318901470512888 21.027821898857407 80-84 23.70013331965952 27.304891805968616 28.248384781048095 20.74659009332376 85-89 24.211602351137234 27.912087912087912 27.38563761819576 20.490672118579095 90-94 23.141770330009255 27.814331242932045 28.323224015626607 20.720674411432096 95-99 23.936414123401438 27.04437764304275 27.925816477301673 21.09339175625414 100-104 23.989427860696516 27.554933665008292 28.057628524046436 20.398009950248756 105-109 23.737063223690953 27.32861973562865 27.794856030330976 21.13946101034942 110-114 23.347448874199543 27.561454244990703 27.427184466019416 21.66391241479033 115-119 24.057598354332733 27.17408074055027 28.243764463872463 20.524556441244535 120-124 23.84525680677382 27.201744156568473 27.713836637428386 21.239162399229325 125-129 23.974202721917532 27.2598009343896 28.19926873857404 20.56672760511883 130-134 23.42443977231937 27.834470027178092 27.613968514435154 21.127121686067383 135-139 23.598262202913368 27.390748786097625 27.789419882443138 21.221569128545873 140-144 23.257102558936126 27.619383437437033 27.523675196453755 21.59983880717308 145-149 23.8699565173425 27.28283951865709 27.66204874102538 21.185155222975023 150-151 24.305024228513133 26.89364957918898 28.117827084927317 20.68349910737057 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.5 8 1.5 9 1.5 10 3.0 11 4.0 12 4.5 13 6.0 14 5.0 15 2.0 16 3.0 17 6.5 18 6.5 19 5.0 20 6.5 21 7.0 22 5.5 23 6.5 24 6.5 25 6.0 26 6.0 27 5.5 28 7.5 29 12.5 30 15.0 31 14.0 32 19.0 33 29.5 34 39.5 35 48.0 36 67.0 37 96.0 38 117.5 39 154.0 40 201.5 41 225.5 42 248.5 43 266.5 44 279.0 45 285.5 46 275.5 47 264.0 48 240.5 49 211.0 50 169.0 51 137.5 52 116.5 53 90.5 54 73.0 55 56.5 56 41.5 57 28.5 58 23.0 59 18.5 60 10.0 61 5.5 62 4.0 63 2.0 64 1.5 65 1.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.17500000000000002 7 0.325 8 1.3 9 0.17500000000000002 10-14 1.78 15-19 2.8049999999999997 20-24 1.295 25-29 0.16 30-34 0.905 35-39 0.5700000000000001 40-44 0.485 45-49 0.42 50-54 2.03 55-59 3.6450000000000005 60-64 3.44 65-69 1.95 70-74 2.63 75-79 2.415 80-84 2.4899999999999998 85-89 2.175 90-94 2.73 95-99 1.865 100-104 3.52 105-109 2.41 110-114 3.18 115-119 2.775 120-124 1.385 125-129 1.54 130-134 2.495 135-139 2.175 140-144 0.74 145-149 1.11 150-151 1.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.2999999999999998 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138-139 1.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920561 spots for SRR7169026.sra Written 920561 spots for SRR7169026.sra Read 920576 spots for SRR7169026.sra Written 920576 spots for SRR7169026.sra SRR ids: ['SRR7169026.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l2uhvjcr SRR7169026.sra spots: 18411235 blocks: [[1, 920561], [920562, 1841122], [1841123, 2761683], [2761684, 3682244], [3682245, 4602805], [4602806, 5523366], [5523367, 6443927], [6443928, 7364488], [7364489, 8285049], [8285050, 9205610], [9205611, 10126171], [10126172, 11046732], [11046733, 11967293], [11967294, 12887854], [12887855, 13808415], [13808416, 14728976], [14728977, 15649537], [15649538, 16570098], [16570099, 17490659], [17490660, 18411235]] SRR7169026 file size 6217263 SRR7169026 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169026 SRR7169026_1.fastq SRR7169026_2.fastq Input file: SRR7169026_1.fastq Paired file: SRR7169026_2.fastq trimmed: SRR7169026-trimmed-pair1.fastq, SRR7169026-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:32:52 2025 >> started Mon Feb 10 17:33:19 2025 >> done (26.978s) 18411235 read pairs processed; of these: 46822 ( 0.25%) short read pairs filtered out after trimming by size control 35469 ( 0.19%) empty read pairs filtered out after trimming by size control 18328944 (99.55%) read pairs available; of these: 8097357 (44.18%) trimmed read pairs available after processing 10231587 (55.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 8 0.00% 20 9 0.00% 21 5 0.00% 22 5 0.00% 23 8 0.00% 24 4 0.00% 25 8 0.00% 26 6 0.00% 27 7 0.00% 28 6 0.00% 29 5 0.00% 30 10 0.00% 31 5 0.00% 32 6 0.00% 33 3 0.00% 34 9 0.00% 35 10 0.00% 36 9 0.00% 37 11 0.00% 38 10 0.00% 39 7 0.00% 40 15 0.00% 41 14 0.00% 42 17 0.00% 43 13 0.00% 44 14 0.00% 45 17 0.00% 46 31 0.00% 47 14 0.00% 48 23 0.00% 49 19 0.00% 50 25 0.00% 51 27 0.00% 52 27 0.00% 53 41 0.00% 54 37 0.00% 55 37 0.00% 56 47 0.00% 57 63 0.00% 58 61 0.00% 59 69 0.00% 60 79 0.00% 61 83 0.00% 62 104 0.00% 63 123 0.00% 64 125 0.00% 65 140 0.00% 66 148 0.00% 67 186 0.00% 68 199 0.00% 69 246 0.00% 70 275 0.00% 71 286 0.00% 72 347 0.00% 73 360 0.00% 74 402 0.00% 75 456 0.00% 76 560 0.00% 77 596 0.00% 78 690 0.00% 79 817 0.00% 80 924 0.01% 81 1011 0.01% 82 1210 0.01% 83 1451 0.01% 84 2896 0.02% 85 3503 0.02% 86 3649 0.02% 87 3451 0.02% 88 3752 0.02% 89 3603 0.02% 90 3768 0.02% 91 3949 0.02% 92 4344 0.02% 93 4338 0.02% 94 4562 0.02% 95 4648 0.03% 96 5064 0.03% 97 5196 0.03% 98 5779 0.03% 99 5961 0.03% 100 6868 0.04% 101 6925 0.04% 102 7319 0.04% 103 7292 0.04% 104 7811 0.04% 105 8631 0.05% 106 9165 0.05% 107 9277 0.05% 108 10101 0.06% 109 10457 0.06% 110 10861 0.06% 111 11694 0.06% 112 12462 0.07% 113 13146 0.07% 114 13996 0.08% 115 14768 0.08% 116 15803 0.09% 117 16639 0.09% 118 17480 0.10% 119 17993 0.10% 120 18905 0.10% 121 20051 0.11% 122 21362 0.12% 123 23393 0.13% 124 24242 0.13% 125 26675 0.15% 126 28350 0.15% 127 29173 0.16% 128 30990 0.17% 129 33002 0.18% 130 35446 0.19% 131 37934 0.21% 132 41728 0.23% 133 44169 0.24% 134 48127 0.26% 135 51883 0.28% 136 56863 0.31% 137 60806 0.33% 138 67562 0.37% 139 73730 0.40% 140 81278 0.44% 141 90863 0.50% 142 104142 0.57% 143 120896 0.66% 144 143947 0.79% 145 174576 0.95% 146 222511 1.21% 147 308736 1.68% 148 467940 2.55% 149 912807 4.98% 150 4386538 23.93% 151 10231587 55.82% 18328944 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=90.96 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.4 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.37 fanout-score-rank=17 prefix-density=0.33 prefix-fanout=3.9 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=42 fanout-score=76.73 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.4 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169026 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:34:05 Started mapping on | Feb 10 17:34:05 Finished on | Feb 10 17:36:02 Mapping speed, Million of reads per hour | 563.97 Number of input reads | 18328944 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17296114 Uniquely mapped reads % | 94.37% Average mapped length | 296.57 Number of splices: Total | 16359019 Number of splices: Annotated (sjdb) | 16100529 Number of splices: GT/AG | 16139176 Number of splices: GC/AG | 174599 Number of splices: AT/AC | 13092 Number of splices: Non-canonical | 32152 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283819 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 35355 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.85% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 781242 781242 781242 N_multimapping 283819 283819 283819 N_noFeature 327794 17092453 405598 N_ambiguous 198018 1112 71356 UnstrandedReadsAssigned:16770302 PositiveStrandReadsAssigned:202549 NegativeStrandReadsAssigned:16819160 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169026 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169026-trimmed-pair1.fastq SRR7169026-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,328,944 reads, 16,726,622 reads pseudoaligned [quant] estimated average fragment length: 272.236 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52401 SRR7169026.ke.tsv 34699 SRR7169026.se.tsv 87100 total ==> SRR7169026.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.76 396 13.3352 Potri.005G024800.1.v4.1 1035 763.764 32 2.4645 Potri.004G059700.1.v4.1 961 689.8 1 0.0852738 Potri.007G009000.2.v4.1 1416 1144.76 0 0 Potri.003G141000.2.v4.1 2943 2671.76 309.031 6.80366 Potri.016G087400.1.v4.1 270 64.7195 1166 1059.75 Potri.015G069301.1.v4.1 564 300.705 0 0 Potri.010G195200.1.v4.1 1773 1501.76 45 1.76258 Potri.012G127500.1.v4.1 977 705.782 3642 303.534 ==> SRR7169026.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1782 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 271 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169026 completed mapping pipeline successfully