Starting /dee2/code/volunteer_pipeline.sh SRR7169027 current disk space = 3058023419904 free memory = 1530446988 SRR7169027 SRAfilesize 861a7d51b9b2c42ac216c05e0d13c998 SRR7169027.sra SRR7169027.sra file validated SRR7169027 is paired end SRR7169027 is conventional basespace SRR7169027 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169027_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9225 34.0 33.0 34.0 33.0 34.0 2 33.46775 34.0 34.0 34.0 33.0 34.0 3 33.482 34.0 34.0 34.0 33.0 34.0 4 33.53 34.0 34.0 34.0 33.0 34.0 5 33.5235 34.0 34.0 34.0 33.0 34.0 6 37.18 38.0 38.0 38.0 36.0 38.0 7 37.46925 38.0 38.0 38.0 37.0 38.0 8 37.54375 38.0 38.0 38.0 38.0 38.0 9 37.564 38.0 38.0 38.0 38.0 38.0 10-14 37.587450000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.604099999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.600049999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.520250000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.5312 38.0 38.0 38.0 38.0 38.0 35-39 37.442400000000006 38.0 38.0 38.0 37.6 38.0 40-44 37.3393 38.0 38.0 38.0 37.0 38.0 45-49 37.31685 38.0 38.0 38.0 37.0 38.0 50-54 37.3246 38.0 38.0 38.0 37.0 38.0 55-59 37.31845 38.0 38.0 38.0 37.0 38.0 60-64 37.24695 38.0 38.0 38.0 37.0 38.0 65-69 37.16845 38.0 38.0 38.0 36.4 38.0 70-74 37.1512 38.0 38.0 38.0 36.6 38.0 75-79 37.03855 38.0 38.0 38.0 36.0 38.0 80-84 36.985699999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.9165 38.0 38.0 38.0 36.0 38.0 90-94 36.85735 38.0 38.0 38.0 35.8 38.0 95-99 36.735400000000006 38.0 38.0 38.0 35.0 38.0 100-104 36.60045 38.0 38.0 38.0 35.0 38.0 105-109 36.43765 38.0 38.0 38.0 34.2 38.0 110-114 36.37695 38.0 38.0 38.0 34.0 38.0 115-119 36.271350000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.13225 38.0 38.0 38.0 34.0 38.0 125-129 35.935050000000004 38.0 37.6 38.0 33.2 38.0 130-134 35.60615 38.0 36.8 38.0 31.8 38.0 135-139 35.5871 38.0 36.2 38.0 31.6 38.0 140-144 35.09545 38.0 36.0 38.0 29.6 38.0 145-149 34.60335 38.0 36.0 38.0 28.2 38.0 150-151 31.664749999999998 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 1.0 16 3.0 17 1.0 18 8.0 19 12.0 20 3.0 21 1.0 22 3.0 23 8.0 24 6.0 25 10.0 26 13.0 27 22.0 28 22.0 29 23.0 30 29.0 31 46.0 32 54.0 33 82.0 34 97.0 35 173.0 36 458.0 37 2920.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.261146496815286 14.191082802547772 9.121019108280255 33.42675159235669 2 22.275 17.175 33.074999999999996 27.474999999999998 3 20.525 21.925 27.200000000000003 30.349999999999998 4 21.475 30.049999999999997 22.55 25.924999999999997 5 21.55 33.95 24.3 20.200000000000003 6 20.200000000000003 35.525 25.0 19.275000000000002 7 14.774999999999999 27.250000000000004 40.1 17.875 8 18.15 25.3 29.549999999999997 27.0 9 17.424999999999997 25.224999999999998 32.725 24.625 10-14 20.225 29.67 26.3 23.805 15-19 20.415 28.705000000000002 27.47 23.41 20-24 20.505000000000003 28.775000000000002 26.919999999999998 23.799999999999997 25-29 20.13 28.595 27.485 23.79 30-34 20.03 28.389999999999997 27.24 24.34 35-39 19.955000000000002 28.54 27.075 24.43 40-44 20.19 29.054999999999996 26.939999999999998 23.815 45-49 20.06 29.220000000000002 27.205000000000002 23.515 50-54 19.97 28.65 27.544999999999998 23.835 55-59 20.595 28.455000000000002 26.825 24.125 60-64 20.45 28.78 26.935 23.835 65-69 20.19 28.54 27.115000000000002 24.154999999999998 70-74 20.36 28.73 27.075 23.835 75-79 20.52 28.375 27.305 23.799999999999997 80-84 20.78 28.144999999999996 26.995 24.08 85-89 19.84 28.26 27.3 24.6 90-94 20.419999999999998 28.505000000000003 26.915 24.16 95-99 19.935 28.025 27.71 24.33 100-104 20.835 27.925 27.11 24.13 105-109 20.585 27.800000000000004 27.265 24.349999999999998 110-114 20.605 28.015 27.005000000000003 24.375 115-119 20.630000000000003 28.105000000000004 26.979999999999997 24.285 120-124 20.815 28.38 26.435 24.37 125-129 20.905 28.03 27.22 23.845 130-134 20.71 28.134999999999998 27.04 24.115000000000002 135-139 21.54 27.57 27.01 23.880000000000003 140-144 21.11 27.834999999999997 27.279999999999998 23.775 145-149 21.015 26.855 27.49 24.64 150-151 21.6625 26.7125 27.3625 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 0.5 22 2.5 23 2.5 24 1.0 25 0.5 26 5.5 27 9.5 28 12.0 29 18.5 30 24.5 31 29.5 32 41.5 33 50.0 34 58.0 35 80.0 36 86.0 37 91.5 38 113.5 39 131.5 40 169.5 41 208.0 42 220.5 43 236.5 44 257.5 45 255.5 46 238.5 47 239.0 48 229.0 49 209.0 50 188.5 51 153.0 52 135.0 53 112.5 54 75.5 55 65.0 56 58.0 57 45.5 58 32.5 59 27.0 60 26.0 61 12.0 62 7.0 63 9.0 64 6.0 65 4.5 66 5.0 67 4.0 68 2.5 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52080706179068 98.65 2 0.45397225725094575 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025220680958385876 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGGCAATCTCGTATGC 18 0.44999999999999996 TruSeq Adapter, Index 10 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2125 0.0125 0.0 0.0 0.0 100-101 0.32499999999999996 0.025 0.0 0.0 0.0 102-103 0.3875 0.025 0.0 0.0 0.0 104-105 0.425 0.025 0.0 0.0 0.0 106-107 0.525 0.025 0.0 0.0 0.0 108-109 0.575 0.025 0.0 0.0 0.0 110-111 0.7 0.025 0.0 0.0 0.0 112-113 0.7875 0.025 0.0 0.0 0.0 114-115 0.925 0.025 0.0 0.0 0.0 116-117 1.0375 0.025 0.0 0.0 0.0 118-119 1.1749999999999998 0.025 0.0 0.0 0.0 120-121 1.35 0.025 0.0 0.0 0.0 122-123 1.4625 0.025 0.0 0.0 0.0 124-125 1.6124999999999998 0.025 0.0 0.0 0.0 126-127 1.775 0.025 0.0 0.0 0.0 128-129 1.8624999999999998 0.025 0.0 0.0 0.0 130-131 2.0125 0.025 0.0 0.0 0.0 132-133 2.3 0.025 0.0 0.0 0.0 134-135 2.5250000000000004 0.025 0.0 0.0 0.0 136-137 2.675 0.025 0.0 0.0 0.0 138-139 2.8875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169027 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169027_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93575 33.0 33.0 34.0 32.0 34.0 2 33.056 34.0 33.0 34.0 32.0 34.0 3 33.094 34.0 33.0 34.0 33.0 34.0 4 33.016 34.0 33.0 34.0 33.0 34.0 5 33.078 34.0 33.0 34.0 33.0 34.0 6 37.31275 38.0 38.0 38.0 37.0 38.0 7 37.3295 38.0 38.0 38.0 37.0 38.0 8 37.266 38.0 38.0 38.0 37.0 38.0 9 37.23075 38.0 38.0 38.0 37.0 38.0 10-14 37.20895 38.0 38.0 38.0 37.0 38.0 15-19 37.1254 38.0 38.0 38.0 37.0 38.0 20-24 37.1094 38.0 38.0 38.0 37.0 38.0 25-29 37.06855 38.0 38.0 38.0 37.0 38.0 30-34 37.08935 38.0 38.0 38.0 37.0 38.0 35-39 37.057500000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.0082 38.0 38.0 38.0 36.8 38.0 45-49 36.9808 38.0 38.0 38.0 36.6 38.0 50-54 36.901300000000006 38.0 38.0 38.0 36.2 38.0 55-59 36.9256 38.0 38.0 38.0 36.2 38.0 60-64 36.884 38.0 38.0 38.0 36.0 38.0 65-69 36.783950000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.57965 38.0 38.0 38.0 35.4 38.0 75-79 36.5128 38.0 38.0 38.0 35.0 38.0 80-84 36.4621 38.0 38.0 38.0 35.0 38.0 85-89 36.352500000000006 38.0 38.0 38.0 34.2 38.0 90-94 36.2593 38.0 38.0 38.0 34.0 38.0 95-99 36.1428 38.0 38.0 38.0 34.0 38.0 100-104 35.9969 38.0 38.0 38.0 33.4 38.0 105-109 35.91029999999999 38.0 37.4 38.0 33.2 38.0 110-114 35.795849999999994 38.0 37.2 38.0 33.0 38.0 115-119 35.543549999999996 38.0 37.0 38.0 31.0 38.0 120-124 35.24425 38.0 36.6 38.0 29.4 38.0 125-129 35.0773 38.0 36.0 38.0 29.2 38.0 130-134 34.61305 38.0 35.6 38.0 26.6 38.0 135-139 34.23270000000001 38.0 35.0 38.0 24.0 38.0 140-144 34.03285 38.0 35.0 38.0 23.2 38.0 145-149 33.26975 38.0 34.2 38.0 17.4 38.0 150-151 29.094250000000002 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 6.0 4 2.0 5 4.0 6 3.0 7 0.0 8 0.0 9 1.0 10 4.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 4.0 17 19.0 18 0.0 19 4.0 20 11.0 21 5.0 22 9.0 23 12.0 24 13.0 25 16.0 26 25.0 27 18.0 28 25.0 29 28.0 30 41.0 31 50.0 32 68.0 33 91.0 34 113.0 35 252.0 36 596.0 37 2563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.775 20.9 13.475000000000001 24.85 2 27.89882294014525 24.64312546957175 28.625093914350114 18.83295767593288 3 21.548484089200702 30.51866700075169 28.81483337509396 19.118015534953646 4 24.423847695390783 33.967935871743485 22.419839679358716 19.188376753507015 5 24.67434869739479 35.82164328657315 21.04208416833667 18.46192384769539 6 22.975 35.775 22.2 19.05 7 20.525 22.1 35.9 21.475 8 22.88072018004501 26.65666416604151 25.406351587896975 25.056264066016503 9 22.075 24.675 29.475 23.775 10-14 24.57482993197279 28.036214485794318 25.505202080832333 21.88375350140056 15-19 23.69409525717434 28.211549055942303 26.63895427455301 21.455401412330342 20-24 24.871166258067746 27.39280532346025 26.817431330364737 20.91859708810727 25-29 24.60583612793433 28.124530757295158 26.75309074528255 20.51654236948796 30-34 24.391097774443608 27.85696424106027 26.82170542635659 20.930232558139537 35-39 23.831214335769346 27.810591650815898 26.63930323355691 21.718890779857844 40-44 24.07305479109332 27.9459594696022 26.670002501876404 21.310983237428072 45-49 24.14828155485517 26.98984441442794 26.984841662914604 21.87703236780229 50-54 24.083612541881283 27.974196129419415 26.949042356353452 20.99314897234585 55-59 24.054621848739497 27.996198479391754 26.925770308123248 21.0234093637455 60-64 24.122916770932385 28.056653821130073 26.935588809368898 20.88484059856864 65-69 24.22195536875813 27.864505153607528 27.15901130791554 20.754528169718803 70-74 24.57957957957958 27.732732732732735 27.067067067067068 20.62062062062062 75-79 23.945142399519494 27.288653085740027 27.8342259372341 20.93197857750638 80-84 24.12827054880184 27.685226874781126 27.485116814247835 20.701385762169195 85-89 24.4072036018009 28.08904452226113 26.97848924462231 20.52526263131566 90-94 24.464678807284372 27.376425855513308 27.056233740244146 21.102661596958175 95-99 24.23605901475369 27.28182045511378 27.616904226056516 20.86521630407602 100-104 24.68617154288572 27.696924231057764 26.851712928232057 20.765191297824455 105-109 24.182418241824184 27.15271527152715 27.84278427842784 20.82208220822082 110-114 24.159831966393277 27.625525105021005 27.20544108821764 21.009201840368075 115-119 24.604604604604603 27.36736736736737 27.32732732732733 20.7007007007007 120-124 24.2914371557336 27.906860290435652 27.150726089133702 20.650976464697045 125-129 24.639350831496696 27.709877780004007 26.973552394309756 20.67721899418954 130-134 24.6635649607284 28.02541397768773 26.739706838761318 20.571314222822554 135-139 24.373405372955126 27.830306668667763 26.954825153834612 20.8414628045425 140-144 24.364364364364363 27.822822822822822 27.192192192192195 20.62062062062062 145-149 25.068815374605872 27.22586457134278 27.396026224913665 20.30929382913768 150-151 24.737237237237235 27.264764764764767 28.015515515515517 19.98248248248248 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 0.5 27 1.0 28 1.5 29 5.0 30 6.5 31 9.5 32 17.5 33 20.5 34 30.5 35 37.5 36 45.5 37 70.0 38 104.0 39 142.0 40 186.5 41 226.0 42 241.5 43 253.5 44 271.0 45 286.0 46 297.5 47 290.5 48 251.5 49 210.5 50 185.5 51 155.0 52 128.0 53 116.5 54 101.5 55 76.0 56 53.0 57 44.0 58 36.0 59 24.5 60 16.0 61 11.0 62 10.5 63 9.5 64 6.5 65 3.0 66 3.5 67 3.0 68 1.5 69 2.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.22499999999999998 4 0.2 5 0.2 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.04 15-19 0.165 20-24 0.065 25-29 0.105 30-34 0.025 35-39 0.11 40-44 0.075 45-49 0.055 50-54 0.015 55-59 0.04 60-64 0.095 65-69 0.06999999999999999 70-74 0.1 75-79 0.105 80-84 0.055 85-89 0.05 90-94 0.06 95-99 0.025 100-104 0.025 105-109 0.01 110-114 0.02 115-119 0.1 120-124 0.15 125-129 0.18 130-134 0.055 135-139 0.055 140-144 0.1 145-149 0.095 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2914979757085 98.1 2 0.5819838056680162 1.15 3 0.05060728744939271 0.15 4 0.025303643724696356 0.1 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025303643724696356 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 15 0.375 Illumina Single End PCR Primer 1 (100% over 50bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2125 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.3875 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 1.9875 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.4749999999999996 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATGGT 10 0.006830828 145.0 1 >>END_MODULE Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra Read 839090 spots for SRR7169027.sra Written 839090 spots for SRR7169027.sra Read 839074 spots for SRR7169027.sra Written 839074 spots for SRR7169027.sra SRR ids: ['SRR7169027.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o0934kz1 SRR7169027.sra spots: 16781496 blocks: [[1, 839074], [839075, 1678148], [1678149, 2517222], [2517223, 3356296], [3356297, 4195370], [4195371, 5034444], [5034445, 5873518], [5873519, 6712592], [6712593, 7551666], [7551667, 8390740], [8390741, 9229814], [9229815, 10068888], [10068889, 10907962], [10907963, 11747036], [11747037, 12586110], [12586111, 13425184], [13425185, 14264258], [14264259, 15103332], [15103333, 15942406], [15942407, 16781496]] SRR7169027 file size 5664997 SRR7169027 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169027 SRR7169027_1.fastq SRR7169027_2.fastq Input file: SRR7169027_1.fastq Paired file: SRR7169027_2.fastq trimmed: SRR7169027-trimmed-pair1.fastq, SRR7169027-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:31:32 2025 >> started Mon Feb 10 17:31:51 2025 >> done (18.975s) 16781496 read pairs processed; of these: 25044 ( 0.15%) short read pairs filtered out after trimming by size control 73616 ( 0.44%) empty read pairs filtered out after trimming by size control 16682836 (99.41%) read pairs available; of these: 6733676 (40.36%) trimmed read pairs available after processing 9949160 (59.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 2 0.00% 21 9 0.00% 22 7 0.00% 23 10 0.00% 24 7 0.00% 25 7 0.00% 26 8 0.00% 27 8 0.00% 28 6 0.00% 29 4 0.00% 30 7 0.00% 31 7 0.00% 32 6 0.00% 33 7 0.00% 34 11 0.00% 35 10 0.00% 36 19 0.00% 37 8 0.00% 38 14 0.00% 39 7 0.00% 40 19 0.00% 41 11 0.00% 42 15 0.00% 43 18 0.00% 44 23 0.00% 45 26 0.00% 46 22 0.00% 47 24 0.00% 48 27 0.00% 49 30 0.00% 50 35 0.00% 51 41 0.00% 52 32 0.00% 53 37 0.00% 54 63 0.00% 55 57 0.00% 56 63 0.00% 57 72 0.00% 58 74 0.00% 59 90 0.00% 60 92 0.00% 61 96 0.00% 62 103 0.00% 63 110 0.00% 64 107 0.00% 65 172 0.00% 66 167 0.00% 67 171 0.00% 68 173 0.00% 69 247 0.00% 70 311 0.00% 71 296 0.00% 72 312 0.00% 73 397 0.00% 74 410 0.00% 75 430 0.00% 76 495 0.00% 77 489 0.00% 78 594 0.00% 79 704 0.00% 80 804 0.00% 81 856 0.01% 82 1023 0.01% 83 1265 0.01% 84 2188 0.01% 85 2945 0.02% 86 3050 0.02% 87 3102 0.02% 88 3337 0.02% 89 3393 0.02% 90 3427 0.02% 91 3676 0.02% 92 3943 0.02% 93 4209 0.03% 94 4430 0.03% 95 4757 0.03% 96 5187 0.03% 97 5312 0.03% 98 5569 0.03% 99 5864 0.04% 100 6201 0.04% 101 6656 0.04% 102 7309 0.04% 103 7941 0.05% 104 8285 0.05% 105 9161 0.05% 106 9572 0.06% 107 10141 0.06% 108 10591 0.06% 109 11088 0.07% 110 11799 0.07% 111 12598 0.08% 112 13325 0.08% 113 14372 0.09% 114 15501 0.09% 115 16339 0.10% 116 17304 0.10% 117 17972 0.11% 118 19139 0.11% 119 19847 0.12% 120 20871 0.13% 121 21977 0.13% 122 23197 0.14% 123 25213 0.15% 124 26615 0.16% 125 28448 0.17% 126 30272 0.18% 127 31604 0.19% 128 33036 0.20% 129 34900 0.21% 130 36997 0.22% 131 39390 0.24% 132 41777 0.25% 133 45364 0.27% 134 48448 0.29% 135 52166 0.31% 136 56363 0.34% 137 59731 0.36% 138 64523 0.39% 139 69500 0.42% 140 75359 0.45% 141 82793 0.50% 142 91565 0.55% 143 104638 0.63% 144 121637 0.73% 145 143910 0.86% 146 176409 1.06% 147 235042 1.41% 148 349234 2.09% 149 683754 4.10% 150 3558635 21.33% 151 9949160 59.64% 16682836 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=291.38 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.94 fanout-score-rank=22 prefix-density=0.35 prefix-fanout=3.5 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=145.05 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.4 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169027 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:32:43 Started mapping on | Feb 10 17:32:44 Finished on | Feb 10 17:35:29 Mapping speed, Million of reads per hour | 363.99 Number of input reads | 16682836 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14992349 Uniquely mapped reads % | 89.87% Average mapped length | 296.29 Number of splices: Total | 13736314 Number of splices: Annotated (sjdb) | 13513030 Number of splices: GT/AG | 13535965 Number of splices: GC/AG | 159507 Number of splices: AT/AC | 11752 Number of splices: Non-canonical | 29090 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332530 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 182902 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.88% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1377124 1377124 1377124 N_multimapping 332530 332530 332530 N_noFeature 277660 14823352 351692 N_ambiguous 154907 1097 59160 UnstrandedReadsAssigned:14559782 PositiveStrandReadsAssigned:167900 NegativeStrandReadsAssigned:14581497 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169027 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169027-trimmed-pair1.fastq SRR7169027-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,682,836 reads, 14,664,350 reads pseudoaligned [quant] estimated average fragment length: 246.643 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7169027.ke.tsv 34699 SRR7169027.se.tsv 87100 total ==> SRR7169027.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.36 265 7.98062 Potri.005G024800.1.v4.1 1035 789.357 67 4.53047 Potri.004G059700.1.v4.1 961 715.371 4 0.298449 Potri.007G009000.2.v4.1 1416 1170.36 0 0 Potri.003G141000.2.v4.1 2943 2697.36 205 4.05655 Potri.016G087400.1.v4.1 270 70.4217 2047 1551.5 Potri.015G069301.1.v4.1 564 321.667 0 0 Potri.010G195200.1.v4.1 1773 1527.36 13 0.454302 Potri.012G127500.1.v4.1 977 731.371 9871 720.386 ==> SRR7169027.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 882 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 372 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169027 completed mapping pipeline successfully