Starting /dee2/code/volunteer_pipeline.sh SRR7169050 current disk space = 3058147323904 free memory = 1479003764 SRR7169050 SRAfilesize f30ba937f3a63c2281b4113fefd66bd4 SRR7169050.sra SRR7169050.sra file validated SRR7169050 is paired end SRR7169050 is conventional basespace SRR7169050 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169050_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87025 34.0 33.0 34.0 32.0 34.0 2 33.28125 34.0 33.0 34.0 33.0 34.0 3 33.294 34.0 33.0 34.0 33.0 34.0 4 33.38125 34.0 33.0 34.0 33.0 34.0 5 33.39 34.0 33.0 34.0 33.0 34.0 6 36.92725 38.0 37.0 38.0 35.0 38.0 7 37.2815 38.0 38.0 38.0 36.0 38.0 8 37.4265 38.0 38.0 38.0 37.0 38.0 9 37.39675 38.0 38.0 38.0 37.0 38.0 10-14 37.322500000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.28245 38.0 38.0 38.0 36.8 38.0 20-24 37.14245 38.0 38.0 38.0 36.4 38.0 25-29 37.14755 38.0 38.0 38.0 36.0 38.0 30-34 37.05175 38.0 38.0 38.0 36.0 38.0 35-39 36.84055 38.0 38.0 38.0 35.2 38.0 40-44 36.74735 38.0 38.0 38.0 34.6 38.0 45-49 36.53175 38.0 37.8 38.0 34.0 38.0 50-54 36.347950000000004 38.0 37.4 38.0 33.6 38.0 55-59 36.2092 38.0 37.0 38.0 33.4 38.0 60-64 36.35 38.0 37.0 38.0 34.0 38.0 65-69 36.25914999999999 38.0 37.0 38.0 33.0 38.0 70-74 35.8587 38.0 37.0 38.0 31.0 38.0 75-79 35.99455 38.0 37.0 38.0 32.2 38.0 80-84 35.4286 38.0 36.0 38.0 28.8 38.0 85-89 35.6759 38.0 36.8 38.0 31.0 38.0 90-94 35.5124 38.0 36.4 38.0 29.8 38.0 95-99 35.11565 38.0 35.8 38.0 28.0 38.0 100-104 34.6743 38.0 35.0 38.0 26.4 38.0 105-109 34.08154999999999 38.0 34.2 38.0 20.6 38.0 110-114 34.245999999999995 38.0 34.4 38.0 23.8 38.0 115-119 34.5287 38.0 35.0 38.0 25.6 38.0 120-124 33.4837 37.8 33.6 38.0 19.0 38.0 125-129 33.17995 38.0 33.6 38.0 15.0 38.0 130-134 33.027950000000004 38.0 33.2 38.0 15.0 38.0 135-139 32.60305 37.2 33.2 38.0 16.2 38.0 140-144 31.629550000000002 36.4 31.2 38.0 14.0 38.0 145-149 30.4532 36.0 29.8 38.0 8.6 38.0 150-151 26.040875 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 2.0 9 1.0 10 2.0 11 1.0 12 1.0 13 0.0 14 2.0 15 7.0 16 3.0 17 6.0 18 8.0 19 6.0 20 6.0 21 11.0 22 24.0 23 25.0 24 30.0 25 30.0 26 31.0 27 35.0 28 43.0 29 54.0 30 77.0 31 98.0 32 140.0 33 189.0 34 273.0 35 512.0 36 1035.0 37 1347.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.704897234204516 12.991626490738392 10.124333925399645 34.17914234965745 2 23.9 16.3 31.125000000000004 28.675 3 19.7 21.8 26.75 31.75 4 22.925 28.9 23.75 24.425 5 22.525000000000002 33.575 23.849999999999998 20.05 6 18.85 37.225 24.7 19.225 7 15.4 26.525 40.425 17.65 8 18.15 26.0 29.799999999999997 26.05 9 15.925 25.575 33.975 24.525 10-14 20.01 29.64 26.805 23.544999999999998 15-19 19.5 29.205 27.665 23.630000000000003 20-24 19.68 29.310000000000002 27.455000000000002 23.555 25-29 20.04 28.93 27.575 23.455000000000002 30-34 19.96 29.409999999999997 26.674999999999997 23.955000000000002 35-39 19.805 28.59 27.334999999999997 24.27 40-44 19.945 29.18 27.165 23.71 45-49 20.16 28.65 27.389999999999997 23.799999999999997 50-54 20.02 29.110000000000003 27.045 23.825 55-59 20.49 28.485 28.015 23.01 60-64 20.705000000000002 28.465 27.534999999999997 23.294999999999998 65-69 20.585 28.720000000000002 27.235 23.46 70-74 20.549999999999997 29.085 26.93 23.435 75-79 20.055 29.220000000000002 26.765 23.96 80-84 20.865000000000002 28.49 27.245 23.400000000000002 85-89 20.395 28.395 27.245 23.965 90-94 20.59 28.375 27.015 24.02 95-99 20.27 28.689999999999998 27.134999999999998 23.905 100-104 20.525 28.525 27.415 23.535 105-109 20.72 28.294999999999998 27.625 23.36 110-114 20.32 28.815 27.025 23.84 115-119 21.055 27.92 27.439999999999998 23.585 120-124 20.595 28.194999999999997 27.134999999999998 24.075 125-129 20.674999999999997 28.455000000000002 27.005000000000003 23.865 130-134 20.41 28.485 27.265 23.84 135-139 20.575 28.32 27.47 23.635 140-144 20.535 27.605 27.644999999999996 24.215 145-149 21.055 28.115000000000002 26.919999999999998 23.91 150-151 19.8875 28.4125 28.050000000000004 23.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 2.5 25 5.5 26 6.5 27 6.5 28 10.0 29 14.0 30 19.0 31 28.5 32 33.5 33 39.5 34 43.0 35 55.0 36 87.0 37 103.5 38 122.5 39 157.0 40 185.0 41 202.0 42 234.5 43 284.0 44 297.5 45 264.0 46 259.5 47 264.5 48 228.0 49 201.5 50 187.5 51 149.5 52 111.5 53 100.5 54 82.5 55 52.5 56 38.5 57 29.5 58 20.0 59 18.5 60 15.0 61 10.5 62 7.0 63 5.5 64 4.5 65 2.0 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9125000000000001 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.2 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGAAC 10 0.006832588 144.9875 7 >>END_MODULE SRR7169050 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169050_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9325 33.0 33.0 34.0 32.0 34.0 2 32.93775 34.0 33.0 34.0 32.0 34.0 3 32.935 34.0 33.0 34.0 32.0 34.0 4 32.75525 34.0 33.0 34.0 32.0 34.0 5 32.8985 34.0 33.0 34.0 32.0 34.0 6 37.056 38.0 38.0 38.0 37.0 38.0 7 37.20025 38.0 38.0 38.0 37.0 38.0 8 37.111 38.0 38.0 38.0 37.0 38.0 9 36.89325 38.0 38.0 38.0 36.0 38.0 10-14 36.881150000000005 38.0 38.0 38.0 35.8 38.0 15-19 37.016400000000004 38.0 38.0 38.0 36.8 38.0 20-24 36.981500000000004 38.0 38.0 38.0 36.4 38.0 25-29 36.891949999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.93685 38.0 38.0 38.0 36.0 38.0 35-39 36.77475 38.0 38.0 38.0 36.0 38.0 40-44 36.7354 38.0 38.0 38.0 35.8 38.0 45-49 36.8311 38.0 38.0 38.0 36.0 38.0 50-54 36.83895 38.0 38.0 38.0 36.0 38.0 55-59 36.818799999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.6863 38.0 38.0 38.0 35.2 38.0 65-69 36.700199999999995 38.0 38.0 38.0 35.4 38.0 70-74 36.60555 38.0 38.0 38.0 35.0 38.0 75-79 36.5075 38.0 38.0 38.0 34.6 38.0 80-84 36.35295 38.0 38.0 38.0 33.8 38.0 85-89 36.247499999999995 38.0 38.0 38.0 33.8 38.0 90-94 36.02685 38.0 37.8 38.0 33.4 38.0 95-99 36.264199999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.064049999999995 38.0 38.0 38.0 33.4 38.0 105-109 35.892450000000004 38.0 38.0 38.0 33.0 38.0 110-114 35.597 38.0 37.0 38.0 30.8 38.0 115-119 35.5404 38.0 37.0 38.0 30.6 38.0 120-124 35.355450000000005 38.0 36.6 38.0 30.0 38.0 125-129 34.98435 38.0 36.0 38.0 27.8 38.0 130-134 34.61299999999999 38.0 35.6 38.0 25.8 38.0 135-139 34.301 38.0 35.0 38.0 23.6 38.0 140-144 33.9961 38.0 35.0 38.0 22.8 38.0 145-149 33.4984 38.0 34.8 38.0 21.4 38.0 150-151 29.916874999999997 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 1.0 5 2.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 3.0 12 1.0 13 5.0 14 7.0 15 3.0 16 5.0 17 5.0 18 8.0 19 2.0 20 14.0 21 8.0 22 10.0 23 8.0 24 22.0 25 22.0 26 17.0 27 30.0 28 27.0 29 41.0 30 58.0 31 65.0 32 69.0 33 98.0 34 143.0 35 224.0 36 546.0 37 2541.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.0 24.025 13.225000000000001 23.75 2 28.749999999999996 27.325 27.900000000000002 16.025 3 18.914185639229423 29.347010257693267 32.6494871153365 19.089316987740805 4 23.842882161621215 33.52514385789342 24.668501376032022 17.96347260445334 5 23.63090772693173 37.109277319329834 20.705176294073517 18.554638659664917 6 21.15 38.224999999999994 22.75 17.875 7 21.75 22.175 36.4 19.675 8 22.775000000000002 25.624999999999996 26.775 24.825 9 20.0 24.575 30.8 24.625 10-14 23.445 28.965000000000003 26.090000000000003 21.5 15-19 23.07 27.755000000000003 27.555000000000003 21.62 20-24 22.564999999999998 28.985 27.3 21.15 25-29 22.650000000000002 28.610000000000003 27.51 21.23 30-34 22.88 27.66 28.07 21.39 35-39 22.95 27.794999999999998 28.07 21.185000000000002 40-44 23.205000000000002 27.295 28.02 21.48 45-49 22.575 27.785 27.675 21.965 50-54 23.365 28.065 27.865000000000002 20.705000000000002 55-59 23.62 27.060000000000002 27.97 21.349999999999998 60-64 23.26 28.185 27.884999999999998 20.669999999999998 65-69 23.465 27.825 27.474999999999998 21.235 70-74 22.935 28.07 27.525 21.47 75-79 22.975 28.115000000000002 27.42 21.490000000000002 80-84 22.884999999999998 28.185 27.66 21.27 85-89 23.815 27.35 27.82 21.015 90-94 23.755000000000003 27.77 27.375 21.099999999999998 95-99 23.65 27.72 27.985 20.645 100-104 23.515 27.339999999999996 28.225 20.919999999999998 105-109 23.965 27.215 28.060000000000002 20.76 110-114 23.630000000000003 28.185 27.325 20.86 115-119 23.855 27.634999999999998 27.715 20.794999999999998 120-124 23.635 27.905 27.66 20.8 125-129 23.685000000000002 27.755000000000003 27.750000000000004 20.810000000000002 130-134 23.76 27.71 27.49 21.04 135-139 23.775 27.665 28.01 20.549999999999997 140-144 23.419999999999998 28.035 27.815 20.73 145-149 23.82 27.85 27.625 20.705000000000002 150-151 22.95 27.437499999999996 28.3375 21.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.5 27 3.0 28 5.5 29 8.0 30 11.5 31 14.0 32 16.5 33 29.5 34 41.5 35 53.5 36 72.0 37 93.0 38 122.0 39 149.5 40 191.5 41 240.0 42 267.5 43 283.0 44 299.0 45 301.0 46 289.5 47 278.5 48 239.5 49 198.5 50 175.5 51 147.0 52 118.0 53 92.5 54 69.0 55 50.0 56 34.0 57 26.5 58 22.0 59 14.5 60 11.5 61 8.5 62 6.0 63 4.0 64 1.5 65 3.0 66 2.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.075 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0125 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.0625 0.0 0.0 0.025 0.0 90-91 0.075 0.0 0.0 0.025 0.0 92-93 0.0875 0.0 0.0 0.025 0.0 94-95 0.1125 0.0 0.0 0.025 0.0 96-97 0.15 0.0 0.0 0.025 0.0 98-99 0.175 0.0 0.0 0.025 0.0 100-101 0.21250000000000002 0.0 0.0 0.025 0.0 102-103 0.225 0.0 0.0 0.025 0.0 104-105 0.25 0.0 0.0 0.025 0.0 106-107 0.275 0.0 0.0 0.025 0.0 108-109 0.3 0.0 0.0 0.025 0.0 110-111 0.3 0.0 0.0 0.025 0.0 112-113 0.325 0.0 0.0 0.025 0.0 114-115 0.35 0.0 0.0 0.025 0.0 116-117 0.4125 0.0 0.0 0.025 0.0 118-119 0.475 0.0 0.0 0.025 0.0 120-121 0.525 0.0 0.0 0.025 0.0 122-123 0.575 0.0 0.0 0.025 0.0 124-125 0.6375 0.0 0.0 0.025 0.0 126-127 0.6875 0.0 0.0 0.025 0.0 128-129 0.8 0.0 0.0 0.025 0.0 130-131 0.9375 0.0 0.0 0.025 0.0 132-133 0.975 0.0 0.0 0.025 0.0 134-135 1.125 0.0 0.0 0.025 0.0 136-137 1.3 0.0 0.0 0.025 0.0 138-139 1.3875000000000002 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0035366106 20.714287 55-59 >>END_MODULE Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra Read 771961 spots for SRR7169050.sra Written 771961 spots for SRR7169050.sra SRR ids: ['SRR7169050.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_geshxaep SRR7169050.sra spots: 15439220 blocks: [[1, 771961], [771962, 1543922], [1543923, 2315883], [2315884, 3087844], [3087845, 3859805], [3859806, 4631766], [4631767, 5403727], [5403728, 6175688], [6175689, 6947649], [6947650, 7719610], [7719611, 8491571], [8491572, 9263532], [9263533, 10035493], [10035494, 10807454], [10807455, 11579415], [11579416, 12351376], [12351377, 13123337], [13123338, 13895298], [13895299, 14667259], [14667260, 15439220]] SRR7169050 file size 5210144 SRR7169050 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169050 SRR7169050_1.fastq SRR7169050_2.fastq Input file: SRR7169050_1.fastq Paired file: SRR7169050_2.fastq trimmed: SRR7169050-trimmed-pair1.fastq, SRR7169050-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:17:04 2025 >> started Mon Feb 10 17:17:21 2025 >> done (16.888s) 15439220 read pairs processed; of these: 18575 ( 0.12%) short read pairs filtered out after trimming by size control 10558 ( 0.07%) empty read pairs filtered out after trimming by size control 15410087 (99.81%) read pairs available; of these: 6863196 (44.54%) trimmed read pairs available after processing 8546891 (55.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 8 0.00% 23 3 0.00% 24 3 0.00% 25 6 0.00% 26 8 0.00% 27 4 0.00% 28 4 0.00% 29 7 0.00% 30 15 0.00% 31 7 0.00% 32 8 0.00% 33 5 0.00% 34 5 0.00% 35 7 0.00% 36 7 0.00% 37 10 0.00% 38 12 0.00% 39 10 0.00% 40 11 0.00% 41 8 0.00% 42 6 0.00% 43 8 0.00% 44 22 0.00% 45 17 0.00% 46 21 0.00% 47 20 0.00% 48 28 0.00% 49 12 0.00% 50 16 0.00% 51 26 0.00% 52 24 0.00% 53 27 0.00% 54 32 0.00% 55 37 0.00% 56 49 0.00% 57 39 0.00% 58 54 0.00% 59 48 0.00% 60 63 0.00% 61 58 0.00% 62 80 0.00% 63 65 0.00% 64 94 0.00% 65 93 0.00% 66 107 0.00% 67 132 0.00% 68 129 0.00% 69 142 0.00% 70 185 0.00% 71 198 0.00% 72 213 0.00% 73 254 0.00% 74 228 0.00% 75 303 0.00% 76 340 0.00% 77 346 0.00% 78 421 0.00% 79 458 0.00% 80 486 0.00% 81 598 0.00% 82 671 0.00% 83 829 0.01% 84 1611 0.01% 85 2119 0.01% 86 2223 0.01% 87 2254 0.01% 88 2479 0.02% 89 2434 0.02% 90 2536 0.02% 91 2679 0.02% 92 2750 0.02% 93 2829 0.02% 94 3157 0.02% 95 3309 0.02% 96 3481 0.02% 97 3603 0.02% 98 3902 0.03% 99 4198 0.03% 100 4448 0.03% 101 4590 0.03% 102 5030 0.03% 103 5400 0.04% 104 5731 0.04% 105 6286 0.04% 106 6425 0.04% 107 6921 0.04% 108 7364 0.05% 109 7636 0.05% 110 8080 0.05% 111 8668 0.06% 112 9183 0.06% 113 9819 0.06% 114 10847 0.07% 115 11407 0.07% 116 12006 0.08% 117 12559 0.08% 118 13433 0.09% 119 13634 0.09% 120 14773 0.10% 121 15186 0.10% 122 16197 0.11% 123 17512 0.11% 124 19029 0.12% 125 20587 0.13% 126 21537 0.14% 127 23256 0.15% 128 24572 0.16% 129 26227 0.17% 130 27900 0.18% 131 30505 0.20% 132 32672 0.21% 133 35572 0.23% 134 38699 0.25% 135 41944 0.27% 136 45848 0.30% 137 50335 0.33% 138 55402 0.36% 139 60547 0.39% 140 67431 0.44% 141 76292 0.50% 142 87145 0.57% 143 102300 0.66% 144 120754 0.78% 145 149385 0.97% 146 193596 1.26% 147 266141 1.73% 148 410763 2.67% 149 800039 5.19% 150 3748876 24.33% 151 8546891 55.46% 15410087 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=40 prefix-density=0.21 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=57.12 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=14.4 sequence=CCTTCCTTGTCCTGGATCTTGGCCTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=40 prefix-density=0.21 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=8 fanout-score=43.25 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=11.6 sequence=TGTTGGTGGTGG SRR7169050 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:18:05 Started mapping on | Feb 10 17:18:06 Finished on | Feb 10 17:19:47 Mapping speed, Million of reads per hour | 549.27 Number of input reads | 15410087 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14453864 Uniquely mapped reads % | 93.79% Average mapped length | 296.96 Number of splices: Total | 13863900 Number of splices: Annotated (sjdb) | 13640133 Number of splices: GT/AG | 13668059 Number of splices: GC/AG | 153354 Number of splices: AT/AC | 11946 Number of splices: Non-canonical | 30541 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280609 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 39640 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.08% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 694100 694100 694100 N_multimapping 280609 280609 280609 N_noFeature 282971 14276352 355669 N_ambiguous 166200 1318 60329 UnstrandedReadsAssigned:14004693 PositiveStrandReadsAssigned:176194 NegativeStrandReadsAssigned:14037866 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169050 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169050-trimmed-pair1.fastq SRR7169050-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,410,087 reads, 13,937,936 reads pseudoaligned [quant] estimated average fragment length: 280.465 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR7169050.ke.tsv 34699 SRR7169050.se.tsv 87100 total ==> SRR7169050.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.54 277 10.5051 Potri.005G024800.1.v4.1 1035 755.535 20 1.74533 Potri.004G059700.1.v4.1 961 681.603 2 0.193464 Potri.007G009000.2.v4.1 1416 1136.54 0 0 Potri.003G141000.2.v4.1 2943 2663.54 247.089 6.11642 Potri.016G087400.1.v4.1 270 61.7322 1295 1383.12 Potri.015G069301.1.v4.1 564 293.439 0 0 Potri.010G195200.1.v4.1 1773 1493.54 4 0.176582 Potri.012G127500.1.v4.1 977 697.575 4103 387.804 ==> SRR7169050.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1366 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169050 completed mapping pipeline successfully