Starting /dee2/code/volunteer_pipeline.sh SRR7169051 current disk space = 3058168750080 free memory = 1071752400 SRR7169051 SRAfilesize a718b996547e001fa4c40c0b069679fe SRR7169051.sra SRR7169051.sra file validated SRR7169051 is paired end SRR7169051 is conventional basespace SRR7169051 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169051_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67 34.0 33.0 34.0 32.0 34.0 2 33.282 34.0 33.0 34.0 33.0 34.0 3 33.32425 34.0 33.0 34.0 33.0 34.0 4 33.4435 34.0 33.0 34.0 33.0 34.0 5 33.39125 34.0 33.0 34.0 33.0 34.0 6 37.0675 38.0 37.0 38.0 36.0 38.0 7 37.3595 38.0 38.0 38.0 37.0 38.0 8 37.468 38.0 38.0 38.0 37.0 38.0 9 37.434 38.0 38.0 38.0 37.0 38.0 10-14 37.0936 38.0 38.0 38.0 36.0 38.0 15-19 37.1146 38.0 38.0 38.0 36.2 38.0 20-24 37.32525 38.0 38.0 38.0 36.8 38.0 25-29 37.243700000000004 38.0 38.0 38.0 36.6 38.0 30-34 37.2704 38.0 38.0 38.0 36.6 38.0 35-39 37.207550000000005 38.0 38.0 38.0 36.4 38.0 40-44 37.07825 38.0 38.0 38.0 35.8 38.0 45-49 36.86435 38.0 38.0 38.0 35.0 38.0 50-54 36.70325 38.0 38.0 38.0 34.4 38.0 55-59 36.33865 38.0 37.6 38.0 33.6 38.0 60-64 36.64280000000001 38.0 37.8 38.0 34.2 38.0 65-69 36.34025 38.0 37.4 38.0 33.4 38.0 70-74 36.254749999999994 38.0 37.2 38.0 33.2 38.0 75-79 36.2541 38.0 37.2 38.0 33.4 38.0 80-84 36.25475 38.0 37.0 38.0 33.4 38.0 85-89 35.9456 38.0 37.0 38.0 31.8 38.0 90-94 35.78275 38.0 36.6 38.0 31.0 38.0 95-99 35.840199999999996 38.0 36.8 38.0 31.6 38.0 100-104 35.2693 38.0 36.0 38.0 28.4 38.0 105-109 34.5458 38.0 35.0 38.0 23.8 38.0 110-114 34.9116 38.0 35.2 38.0 27.2 38.0 115-119 35.1155 38.0 35.8 38.0 28.2 38.0 120-124 34.789 38.0 35.0 38.0 27.0 38.0 125-129 34.08105 38.0 34.4 38.0 23.6 38.0 130-134 34.389950000000006 38.0 35.0 38.0 26.0 38.0 135-139 33.8288 38.0 34.0 38.0 22.6 38.0 140-144 32.800799999999995 37.2 33.2 38.0 15.8 38.0 145-149 32.30479999999999 37.4 33.0 38.0 13.8 38.0 150-151 28.55975 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 3.0 14 2.0 15 2.0 16 1.0 17 2.0 18 3.0 19 3.0 20 7.0 21 8.0 22 7.0 23 12.0 24 13.0 25 14.0 26 26.0 27 33.0 28 41.0 29 72.0 30 69.0 31 83.0 32 129.0 33 138.0 34 247.0 35 404.0 36 891.0 37 1787.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.484662576687114 13.369120654396728 9.560327198364007 34.58588957055215 2 23.150000000000002 15.325 33.125 28.4 3 20.575 19.3 27.450000000000003 32.675 4 21.925 27.474999999999998 24.075 26.525 5 22.45 32.9 24.075 20.575 6 21.0 34.825 23.075000000000003 21.099999999999998 7 16.2 27.700000000000003 37.475 18.625 8 18.15 26.400000000000002 29.849999999999998 25.6 9 17.625 25.45 33.675 23.25 10-14 19.5 30.115 27.125 23.26 15-19 19.85 29.185 27.51 23.455000000000002 20-24 19.895 29.165000000000003 27.35 23.59 25-29 19.57 29.375 27.18 23.875 30-34 19.919999999999998 29.080000000000002 27.365000000000002 23.635 35-39 20.595 28.78 27.284999999999997 23.34 40-44 20.885 28.375 27.575 23.165 45-49 20.5 28.449999999999996 27.555000000000003 23.494999999999997 50-54 20.34 28.249999999999996 27.275 24.135 55-59 20.525 28.33 27.54 23.605 60-64 20.765 28.57 27.38 23.285 65-69 20.380000000000003 29.085 27.055 23.48 70-74 20.411226174395917 28.425634098754315 27.179948971934564 23.983190754915203 75-79 20.606181854556365 28.7186155846754 27.21816544963489 23.45703711113334 80-84 20.5330799619943 28.539280892133824 26.8440266039906 24.083612541881283 85-89 19.97 28.389999999999997 27.279999999999998 24.36 90-94 20.37203720372037 28.412841284128415 27.59275927592759 23.622362236223623 95-99 20.305 28.265 27.255000000000003 24.175 100-104 20.731036551827593 28.421421071053555 27.49137456872844 23.356167808390417 105-109 20.505000000000003 28.15 27.625 23.72 110-114 20.76622986896069 27.688306491947586 27.493247974392315 24.05221566469941 115-119 20.43010752688172 28.592148037009252 27.196799199799948 23.78094523630908 120-124 20.783117467620144 28.549282392358855 27.139070860629094 23.528529279391908 125-129 20.722614222088776 28.414152029224844 27.198118400640542 23.66511534804584 130-134 20.891044552227612 28.086404320216012 27.886394319715986 23.13615680784039 135-139 20.84 28.04 27.029999999999998 24.09 140-144 20.986049302465123 27.966398319915996 27.631381569078457 23.416170808540425 145-149 21.10105505275264 28.091404570228512 27.44137206860343 23.36616830841542 150-151 20.55256907113389 28.041005125640705 27.278409801225152 24.128016002000248 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 1.0 23 2.0 24 2.0 25 1.5 26 4.0 27 7.5 28 6.0 29 9.5 30 16.5 31 18.0 32 31.5 33 41.0 34 52.0 35 66.5 36 82.5 37 98.5 38 124.0 39 157.0 40 174.0 41 205.5 42 235.5 43 259.5 44 276.5 45 280.0 46 282.0 47 268.5 48 250.5 49 226.0 50 173.5 51 133.0 52 116.5 53 93.5 54 83.0 55 70.5 56 45.5 57 28.5 58 16.5 59 10.5 60 10.5 61 11.5 62 6.0 63 2.0 64 4.0 65 3.5 66 1.0 67 2.5 68 2.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.055 75-79 0.03 80-84 0.015 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.03 115-119 0.025 120-124 0.015 125-129 0.08499999999999999 130-134 0.005 135-139 0.0 140-144 0.005 145-149 0.005 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.625 0.0 0.0 0.0 0.0 132-133 0.7625 0.0 0.0 0.0 0.0 134-135 0.85 0.0 0.0 0.0 0.0 136-137 0.9125000000000001 0.0 0.0 0.0 0.0 138-139 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGCC 10 0.006894607 144.55 3 CATAAGT 10 0.006894607 144.55 6 >>END_MODULE SRR7169051 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169051_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.859 33.0 33.0 34.0 32.0 34.0 2 33.05675 34.0 33.0 34.0 32.0 34.0 3 33.00575 34.0 33.0 34.0 32.0 34.0 4 33.02125 34.0 33.0 34.0 32.0 34.0 5 33.00775 34.0 33.0 34.0 32.0 34.0 6 37.1065 38.0 38.0 38.0 37.0 38.0 7 36.98275 38.0 38.0 38.0 36.0 38.0 8 37.11425 38.0 38.0 38.0 37.0 38.0 9 36.73925 38.0 38.0 38.0 35.0 38.0 10-14 36.871599999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.89535 38.0 38.0 38.0 36.4 38.0 20-24 36.812400000000004 38.0 38.0 38.0 35.8 38.0 25-29 36.9335 38.0 38.0 38.0 36.4 38.0 30-34 36.95815 38.0 38.0 38.0 36.6 38.0 35-39 36.57645 38.0 38.0 38.0 35.2 38.0 40-44 36.634499999999996 38.0 38.0 38.0 35.0 38.0 45-49 36.83525 38.0 38.0 38.0 36.0 38.0 50-54 36.843149999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.6853 38.0 38.0 38.0 35.6 38.0 60-64 36.73355 38.0 38.0 38.0 35.8 38.0 65-69 36.704449999999994 38.0 38.0 38.0 35.6 38.0 70-74 36.321250000000006 38.0 38.0 38.0 34.0 38.0 75-79 36.3968 38.0 38.0 38.0 34.0 38.0 80-84 36.419399999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.1374 38.0 38.0 38.0 33.4 38.0 90-94 36.12585 38.0 38.0 38.0 33.6 38.0 95-99 36.195049999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.07959999999999 38.0 38.0 38.0 33.8 38.0 105-109 35.7939 38.0 37.4 38.0 31.6 38.0 110-114 35.52265 38.0 37.0 38.0 30.2 38.0 115-119 35.32455 38.0 36.8 38.0 29.6 38.0 120-124 35.4572 38.0 36.8 38.0 30.6 38.0 125-129 35.30005 38.0 36.4 38.0 30.4 38.0 130-134 34.622 38.0 35.4 38.0 26.0 38.0 135-139 33.99720000000001 38.0 34.8 38.0 21.8 38.0 140-144 34.21815 38.0 35.0 38.0 23.8 38.0 145-149 33.87305 38.0 35.0 38.0 22.4 38.0 150-151 30.433500000000002 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 2.0 5 7.0 6 3.0 7 1.0 8 0.0 9 1.0 10 2.0 11 3.0 12 1.0 13 1.0 14 5.0 15 3.0 16 4.0 17 3.0 18 5.0 19 7.0 20 6.0 21 8.0 22 9.0 23 10.0 24 15.0 25 17.0 26 39.0 27 32.0 28 23.0 29 47.0 30 58.0 31 64.0 32 73.0 33 99.0 34 145.0 35 215.0 36 536.0 37 2546.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.484696437531355 23.406924234821876 13.723030607124937 24.385348720521826 2 27.35 25.624999999999996 28.599999999999998 18.425 3 20.549999999999997 28.175 31.7 19.575 4 23.35 32.675 25.525 18.45 5 24.175 35.75 21.375 18.7 6 20.65 37.7 22.825 18.825 7 19.5 21.975 38.800000000000004 19.725 8 22.325 27.150000000000002 26.125 24.4 9 20.875 26.0 29.049999999999997 24.075 10-14 23.438203371179913 28.534987245535937 26.42424848697044 21.60256089631371 15-19 22.926878063419025 28.37851355406622 27.798339501850556 20.8962688806642 20-24 23.460557250762843 28.417788004602073 27.38732429593317 20.734330448701915 25-29 22.83054749274347 28.305474927434695 27.499749774797316 21.364227805024523 30-34 22.999549617174598 27.64850122604214 28.058850022519145 21.293099134264125 35-39 23.01956663163689 27.853675624280637 28.314066956913376 20.812690787169092 40-44 22.856999799719606 28.049268976567195 27.768876426997796 21.3248547967154 45-49 23.38988139918931 28.203973377370765 27.433318320572486 20.972826902867435 50-54 22.79006907598358 28.30613675042547 27.86064671138252 21.043147462208427 55-59 23.49852477871681 27.659148872330853 27.85417812671901 20.988148222233335 60-64 22.87944753040084 27.398288545263473 28.314066956913376 21.408196967422306 65-69 23.573859087269817 26.871497197758202 28.377702161729385 21.176941553242596 70-74 23.076538269134566 27.793896948474238 27.903951975987994 21.225612806403202 75-79 23.600060051043386 27.65350547965771 27.93374368212981 20.812690787169092 80-84 23.121589828302547 27.832006807829003 28.147369474896127 20.89903388897232 85-89 23.56060227102196 28.027612425591514 27.482367065179332 20.92941823820719 90-94 23.924354612767658 27.61656994196518 27.591554932959777 20.867520512307383 95-99 23.56091700870958 27.810591650815898 27.630393432776053 20.99809790769847 100-104 23.809523809523807 27.826130452180877 27.751100440176067 20.61324529811925 105-109 23.41309571485783 28.228874649579495 27.41289547456948 20.94513416099319 110-114 23.382213102447324 27.801411340773736 27.88649216755918 20.929883389219757 115-119 23.474648380799838 27.603984183392562 28.094499224185395 20.826868211622205 120-124 23.367198838896954 27.92152544917672 27.521145087833442 21.190130624092888 125-129 23.935345043286794 27.528399139268377 27.823650102587198 20.71260571485763 130-134 23.81167042324067 27.853744052091162 27.558226897069872 20.776358627598295 135-139 23.28293952743292 27.573087705246298 27.78334000800961 21.360632759311173 140-144 23.658390068081697 27.88346015218262 27.54805766920304 20.910092110532638 145-149 23.583016222711798 27.79891848588023 27.678750250350493 20.93931504105748 150-151 23.947895791583164 27.066633266533067 28.106212424849698 20.879258517034067 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 3.0 25 2.5 26 1.0 27 1.5 28 2.5 29 9.0 30 13.0 31 14.0 32 23.0 33 33.5 34 39.0 35 51.5 36 81.5 37 100.0 38 127.0 39 166.5 40 196.0 41 235.5 42 254.5 43 279.0 44 308.5 45 285.0 46 252.0 47 257.0 48 245.0 49 202.0 50 186.0 51 159.0 52 113.5 53 85.0 54 65.5 55 55.5 56 45.0 57 31.0 58 17.0 59 10.5 60 10.5 61 9.0 62 7.0 63 5.0 64 3.5 65 5.0 66 3.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.03 20-24 0.045 25-29 0.09 30-34 0.08499999999999999 35-39 0.08499999999999999 40-44 0.13999999999999999 45-49 0.08499999999999999 50-54 0.11 55-59 0.015 60-64 0.08499999999999999 65-69 0.08 70-74 0.05 75-79 0.08499999999999999 80-84 0.11499999999999999 85-89 0.045 90-94 0.06 95-99 0.11 100-104 0.04 105-109 0.12 110-114 0.095 115-119 0.105 120-124 0.095 125-129 0.08499999999999999 130-134 0.17500000000000002 135-139 0.12 140-144 0.12 145-149 0.13999999999999999 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.6555723651033787 1.3 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.5874999999999999 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.6125 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.65 0.0 0.0 0.0 0.0 132-133 0.7875 0.0 0.0 0.0 0.0 134-135 0.875 0.0 0.0 0.0 0.0 136-137 0.9624999999999999 0.0 0.0 0.0 0.0 138-139 1.0499999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATCAA 10 0.0070833815 143.25 2 >>END_MODULE Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996675 spots for SRR7169051.sra Written 996675 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra Read 996673 spots for SRR7169051.sra Written 996673 spots for SRR7169051.sra SRR ids: ['SRR7169051.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4n4d7fla SRR7169051.sra spots: 19933462 blocks: [[1, 996673], [996674, 1993346], [1993347, 2990019], [2990020, 3986692], [3986693, 4983365], [4983366, 5980038], [5980039, 6976711], [6976712, 7973384], [7973385, 8970057], [8970058, 9966730], [9966731, 10963403], [10963404, 11960076], [11960077, 12956749], [12956750, 13953422], [13953423, 14950095], [14950096, 15946768], [15946769, 16943441], [16943442, 17940114], [17940115, 18936787], [18936788, 19933462]] SRR7169051 file size 6733095 SRR7169051 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169051 SRR7169051_1.fastq SRR7169051_2.fastq Input file: SRR7169051_1.fastq Paired file: SRR7169051_2.fastq trimmed: SRR7169051-trimmed-pair1.fastq, SRR7169051-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:16:31 2025 >> started Mon Feb 10 17:16:56 2025 >> done (24.603s) 19933462 read pairs processed; of these: 20584 ( 0.10%) short read pairs filtered out after trimming by size control 12820 ( 0.06%) empty read pairs filtered out after trimming by size control 19900058 (99.83%) read pairs available; of these: 9451252 (47.49%) trimmed read pairs available after processing 10448806 (52.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 9 0.00% 21 5 0.00% 22 2 0.00% 23 6 0.00% 24 10 0.00% 25 3 0.00% 26 3 0.00% 27 9 0.00% 28 2 0.00% 29 4 0.00% 30 17 0.00% 31 4 0.00% 32 6 0.00% 33 9 0.00% 34 16 0.00% 35 15 0.00% 36 14 0.00% 37 20 0.00% 38 13 0.00% 39 13 0.00% 40 22 0.00% 41 15 0.00% 42 27 0.00% 43 23 0.00% 44 32 0.00% 45 15 0.00% 46 23 0.00% 47 43 0.00% 48 39 0.00% 49 38 0.00% 50 39 0.00% 51 39 0.00% 52 37 0.00% 53 37 0.00% 54 56 0.00% 55 41 0.00% 56 54 0.00% 57 66 0.00% 58 82 0.00% 59 70 0.00% 60 97 0.00% 61 99 0.00% 62 103 0.00% 63 156 0.00% 64 178 0.00% 65 195 0.00% 66 272 0.00% 67 263 0.00% 68 191 0.00% 69 302 0.00% 70 289 0.00% 71 322 0.00% 72 323 0.00% 73 355 0.00% 74 360 0.00% 75 399 0.00% 76 459 0.00% 77 553 0.00% 78 556 0.00% 79 686 0.00% 80 724 0.00% 81 880 0.00% 82 857 0.00% 83 1180 0.01% 84 2145 0.01% 85 2670 0.01% 86 2773 0.01% 87 2785 0.01% 88 2807 0.01% 89 3075 0.02% 90 3158 0.02% 91 3288 0.02% 92 3388 0.02% 93 3744 0.02% 94 3981 0.02% 95 3967 0.02% 96 4277 0.02% 97 4652 0.02% 98 4843 0.02% 99 5183 0.03% 100 5695 0.03% 101 5912 0.03% 102 6411 0.03% 103 6951 0.03% 104 7345 0.04% 105 7918 0.04% 106 8103 0.04% 107 8899 0.04% 108 9079 0.05% 109 9671 0.05% 110 10414 0.05% 111 11161 0.06% 112 11734 0.06% 113 12896 0.06% 114 13699 0.07% 115 14425 0.07% 116 15493 0.08% 117 16527 0.08% 118 17607 0.09% 119 18551 0.09% 120 19055 0.10% 121 20239 0.10% 122 21655 0.11% 123 23720 0.12% 124 25206 0.13% 125 27320 0.14% 126 29377 0.15% 127 31046 0.16% 128 33151 0.17% 129 35372 0.18% 130 38526 0.19% 131 41288 0.21% 132 44456 0.22% 133 48946 0.25% 134 53225 0.27% 135 58376 0.29% 136 64415 0.32% 137 71034 0.36% 138 79124 0.40% 139 88173 0.44% 140 99021 0.50% 141 112590 0.57% 142 131906 0.66% 143 148923 0.75% 144 179837 0.90% 145 225510 1.13% 146 291211 1.46% 147 396334 1.99% 148 607084 3.05% 149 1195010 6.01% 150 4924105 24.74% 151 10448806 52.51% 19900058 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=23 prefix-density=0.27 prefix-fanout=2.7 sequence=CCCTCACGGAAGACTGAGAGAAGCTTTTCATCGGAGCGAGAGTTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=71.29 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.8 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=7.35 fanout-score-rank=9 prefix-density=0.38 prefix-fanout=5.2 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=43.81 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.3 sequence=CTCTTCACTTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCAACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169051 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:17:41 Started mapping on | Feb 10 17:17:42 Finished on | Feb 10 17:19:57 Mapping speed, Million of reads per hour | 530.67 Number of input reads | 19900058 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18791705 Uniquely mapped reads % | 94.43% Average mapped length | 296.68 Number of splices: Total | 16767684 Number of splices: Annotated (sjdb) | 16500687 Number of splices: GT/AG | 16548859 Number of splices: GC/AG | 172934 Number of splices: AT/AC | 12084 Number of splices: Non-canonical | 33807 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319883 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 35345 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 811125 811125 811125 N_multimapping 319883 319883 319883 N_noFeature 422248 18527193 514638 N_ambiguous 250138 1413 76947 UnstrandedReadsAssigned:18119319 PositiveStrandReadsAssigned:263099 NegativeStrandReadsAssigned:18200120 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169051 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169051-trimmed-pair1.fastq SRR7169051-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,900,058 reads, 18,060,273 reads pseudoaligned [quant] estimated average fragment length: 276.653 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7169051.ke.tsv 34699 SRR7169051.se.tsv 87100 total ==> SRR7169051.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.35 326 10.5505 Potri.005G024800.1.v4.1 1035 759.347 41 3.04462 Potri.004G059700.1.v4.1 961 685.377 0 0 Potri.007G009000.2.v4.1 1416 1140.35 0 0 Potri.003G141000.2.v4.1 2943 2667.35 265.095 5.60417 Potri.016G087400.1.v4.1 270 60.8621 1055.57 977.981 Potri.015G069301.1.v4.1 564 295.057 0 0 Potri.010G195200.1.v4.1 1773 1497.35 19 0.715518 Potri.012G127500.1.v4.1 977 701.372 1948 156.614 ==> SRR7169051.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1771 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 528 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169051 completed mapping pipeline successfully