Starting /dee2/code/volunteer_pipeline.sh SRR7169052 current disk space = 3058066763776 free memory = 1014511100 SRR7169052 SRAfilesize ab8f1eea33294ec8be690a73b9fd2598 SRR7169052.sra SRR7169052.sra file validated SRR7169052 is paired end SRR7169052 is conventional basespace SRR7169052 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169052_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85225 34.0 33.0 34.0 32.0 34.0 2 33.354 34.0 33.0 34.0 33.0 34.0 3 33.258 34.0 33.0 34.0 33.0 34.0 4 33.37525 34.0 33.0 34.0 33.0 34.0 5 33.3335 34.0 33.0 34.0 33.0 34.0 6 36.88375 38.0 37.0 38.0 35.0 38.0 7 37.25 38.0 38.0 38.0 36.0 38.0 8 37.37225 38.0 38.0 38.0 37.0 38.0 9 37.45725 38.0 38.0 38.0 37.0 38.0 10-14 37.43215 38.0 38.0 38.0 37.0 38.0 15-19 37.37605 38.0 38.0 38.0 37.0 38.0 20-24 37.3284 38.0 38.0 38.0 37.0 38.0 25-29 37.30884999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.2599 38.0 38.0 38.0 37.0 38.0 35-39 37.127500000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.89695 38.0 38.0 38.0 35.6 38.0 45-49 36.68425 38.0 38.0 38.0 34.4 38.0 50-54 36.578649999999996 38.0 38.0 38.0 34.0 38.0 55-59 36.517649999999996 38.0 38.0 38.0 34.0 38.0 60-64 36.4756 38.0 38.0 38.0 34.0 38.0 65-69 36.3734 38.0 37.6 38.0 34.0 38.0 70-74 36.2375 38.0 37.0 38.0 33.2 38.0 75-79 36.16225 38.0 37.0 38.0 33.0 38.0 80-84 36.0445 38.0 37.0 38.0 32.8 38.0 85-89 35.89405000000001 38.0 37.0 38.0 31.2 38.0 90-94 35.637 38.0 36.6 38.0 29.8 38.0 95-99 35.5004 38.0 36.0 38.0 29.0 38.0 100-104 35.31735 38.0 36.0 38.0 29.0 38.0 105-109 35.20015 38.0 36.0 38.0 29.0 38.0 110-114 34.839749999999995 38.0 35.2 38.0 27.0 38.0 115-119 34.549899999999994 38.0 35.0 38.0 25.8 38.0 120-124 34.17205 38.0 34.6 38.0 23.0 38.0 125-129 33.86055 38.0 34.2 38.0 22.6 38.0 130-134 33.3151 38.0 34.0 38.0 16.2 38.0 135-139 32.8425 38.0 33.6 38.0 15.0 38.0 140-144 32.3395 37.8 33.0 38.0 14.0 38.0 145-149 31.46685 37.0 32.2 38.0 9.0 38.0 150-151 27.268 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 3.0 16 4.0 17 3.0 18 8.0 19 6.0 20 10.0 21 10.0 22 10.0 23 15.0 24 26.0 25 43.0 26 39.0 27 41.0 28 37.0 29 56.0 30 65.0 31 70.0 32 104.0 33 129.0 34 244.0 35 388.0 36 934.0 37 1748.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.91008382016764 13.055626111252222 10.896621793243586 34.13766827533655 2 25.3 13.8 31.525 29.375 3 21.025 17.575 25.2 36.199999999999996 4 22.475 25.15 23.175 29.2 5 22.525000000000002 29.225 25.575 22.675 6 21.85 32.175 24.375 21.6 7 15.299999999999999 27.275 39.7 17.724999999999998 8 19.625 26.974999999999998 30.175 23.225 9 17.375 26.55 32.525 23.549999999999997 10-14 19.81 30.12 27.33 22.74 15-19 19.605 28.975 26.985 24.435000000000002 20-24 20.25 29.2 27.04 23.51 25-29 20.23 28.32 27.395000000000003 24.055 30-34 20.16 29.375 26.88 23.585 35-39 20.365 28.939999999999998 26.705000000000002 23.990000000000002 40-44 20.4 29.215000000000003 26.650000000000002 23.735 45-49 20.73 28.910000000000004 26.415 23.945 50-54 19.77 29.01 27.400000000000002 23.82 55-59 19.925 29.15 27.315 23.61 60-64 20.54 28.965000000000003 26.855 23.64 65-69 20.75 28.765 27.1 23.385 70-74 20.11 29.005 26.955000000000002 23.93 75-79 20.560000000000002 28.275 27.439999999999998 23.724999999999998 80-84 20.424999999999997 28.13 27.029999999999998 24.415 85-89 20.22 28.634999999999998 26.889999999999997 24.255 90-94 20.95 28.155 26.919999999999998 23.974999999999998 95-99 20.54 28.325 27.145000000000003 23.990000000000002 100-104 20.645 28.605000000000004 26.965 23.785 105-109 20.735 27.98 27.389999999999997 23.895 110-114 20.979999999999997 27.839999999999996 27.560000000000002 23.62 115-119 20.955 28.415000000000003 27.139999999999997 23.49 120-124 21.85 27.575 26.88 23.695 125-129 20.745 28.53 26.924999999999997 23.799999999999997 130-134 20.901045052252613 28.97144857242862 26.73133656682834 23.396169808490423 135-139 21.011050552527628 28.461423071153558 26.55132756637832 23.976198809940495 140-144 20.945 28.12 26.640000000000004 24.295 145-149 21.224999999999998 28.205000000000002 26.619999999999997 23.95 150-151 20.962500000000002 29.049999999999997 26.950000000000003 23.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 3.0 24 5.0 25 8.0 26 9.0 27 7.5 28 7.5 29 11.0 30 13.0 31 21.0 32 33.5 33 46.5 34 49.0 35 61.0 36 80.0 37 95.0 38 116.5 39 131.5 40 177.0 41 221.0 42 229.0 43 241.0 44 255.0 45 259.0 46 268.0 47 252.5 48 228.5 49 209.5 50 170.5 51 159.5 52 145.0 53 114.5 54 90.5 55 68.0 56 52.5 57 40.5 58 31.0 59 19.0 60 14.5 61 10.0 62 9.5 63 11.0 64 6.5 65 4.0 66 3.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 1.0 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.3250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169052 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169052_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6315 33.0 33.0 34.0 32.0 34.0 2 32.76775 33.0 33.0 34.0 32.0 34.0 3 32.77125 34.0 33.0 34.0 32.0 34.0 4 32.79475 34.0 33.0 34.0 32.0 34.0 5 32.77 34.0 33.0 34.0 32.0 34.0 6 36.88625 38.0 38.0 38.0 36.0 38.0 7 36.89525 38.0 38.0 38.0 36.0 38.0 8 36.97775 38.0 38.0 38.0 37.0 38.0 9 37.03775 38.0 38.0 38.0 36.0 38.0 10-14 36.931250000000006 38.0 38.0 38.0 36.2 38.0 15-19 36.85355 38.0 38.0 38.0 36.0 38.0 20-24 36.798500000000004 38.0 38.0 38.0 36.2 38.0 25-29 36.783699999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.77405 38.0 38.0 38.0 36.0 38.0 35-39 36.758300000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.669799999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.7567 38.0 38.0 38.0 36.0 38.0 50-54 36.57945 38.0 38.0 38.0 35.6 38.0 55-59 36.6533 38.0 38.0 38.0 35.4 38.0 60-64 36.554050000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.5073 38.0 38.0 38.0 35.0 38.0 70-74 36.46715 38.0 38.0 38.0 35.0 38.0 75-79 36.343149999999994 38.0 38.0 38.0 34.4 38.0 80-84 36.26005 38.0 38.0 38.0 34.0 38.0 85-89 36.275999999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.1114 38.0 38.0 38.0 33.8 38.0 95-99 35.96505 38.0 38.0 38.0 33.4 38.0 100-104 35.9406 38.0 38.0 38.0 33.0 38.0 105-109 35.7737 38.0 38.0 38.0 32.6 38.0 110-114 35.554100000000005 38.0 37.2 38.0 31.0 38.0 115-119 35.41055 38.0 37.0 38.0 31.0 38.0 120-124 35.26595 38.0 37.0 38.0 29.8 38.0 125-129 34.9007 38.0 36.0 38.0 27.8 38.0 130-134 34.66845 38.0 36.0 38.0 27.2 38.0 135-139 34.33785 38.0 36.0 38.0 24.4 38.0 140-144 34.024899999999995 38.0 35.4 38.0 22.6 38.0 145-149 33.108799999999995 38.0 35.0 38.0 12.0 38.0 150-151 29.354625 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 5.0 4 5.0 5 1.0 6 4.0 7 1.0 8 2.0 9 1.0 10 6.0 11 5.0 12 1.0 13 1.0 14 1.0 15 3.0 16 6.0 17 4.0 18 8.0 19 11.0 20 4.0 21 14.0 22 14.0 23 10.0 24 21.0 25 24.0 26 28.0 27 29.0 28 23.0 29 40.0 30 51.0 31 63.0 32 72.0 33 102.0 34 142.0 35 173.0 36 475.0 37 2637.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.484371092773195 22.355588897224308 15.628907226806701 24.5311327831958 2 27.831957989497376 25.95648912228057 27.00675168792198 19.204801200300075 3 20.880220055013755 29.48237059264816 29.35733933483371 20.280070017504375 4 23.825 33.825 23.825 18.525 5 25.674999999999997 33.625 22.225 18.475 6 20.175 37.724999999999994 24.0 18.099999999999998 7 22.075 22.075 35.975 19.875 8 23.599999999999998 24.7 26.775 24.925 9 22.425 25.974999999999998 28.775000000000002 22.825 10-14 23.119999999999997 28.285 26.415 22.18 15-19 23.7 27.62 27.575 21.105 20-24 23.57 28.625 27.065 20.74 25-29 23.585 27.555000000000003 27.295 21.565 30-34 23.669999999999998 27.450000000000003 27.894999999999996 20.985 35-39 22.955000000000002 28.01 27.445000000000004 21.59 40-44 23.285 27.894999999999996 27.615000000000002 21.205 45-49 23.044999999999998 27.694999999999997 27.685 21.575 50-54 23.48 28.000000000000004 27.36 21.16 55-59 23.544999999999998 27.785 27.500000000000004 21.17 60-64 23.494999999999997 27.43 27.765 21.310000000000002 65-69 24.025 27.865000000000002 27.165 20.945 70-74 23.915 27.169999999999998 27.71 21.205 75-79 23.486440508355848 27.734414089862902 27.919543680576403 20.859601721204843 80-84 23.380000000000003 27.275 27.925 21.42 85-89 23.69 27.250000000000004 27.785 21.275 90-94 23.635 28.09 27.305 20.97 95-99 23.75 27.43 27.825 20.995 100-104 23.755000000000003 27.07 27.61 21.565 105-109 23.48 26.895000000000003 28.49 21.135 110-114 24.52 26.729999999999997 27.125 21.625 115-119 23.98 27.61 27.55 20.86 120-124 24.104999999999997 27.229999999999997 27.295 21.37 125-129 23.68 28.000000000000004 27.435 20.885 130-134 24.115000000000002 27.834999999999997 26.974999999999998 21.075 135-139 24.46 27.715 27.615000000000002 20.21 140-144 24.135 27.465 27.255000000000003 21.145 145-149 23.93617021276596 27.313327980730627 27.36852669610598 21.38197511039743 150-151 25.09438711301284 28.102189781021895 27.170903599295244 19.632519506670025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.5 24 3.5 25 3.0 26 2.5 27 1.5 28 2.0 29 4.5 30 7.0 31 10.5 32 12.5 33 20.5 34 32.0 35 46.0 36 67.0 37 84.0 38 107.5 39 142.5 40 192.0 41 224.0 42 239.5 43 276.5 44 299.0 45 304.0 46 293.0 47 281.5 48 263.0 49 215.5 50 177.5 51 150.0 52 120.0 53 106.0 54 83.5 55 52.5 56 40.5 57 34.0 58 26.0 59 17.0 60 15.0 61 12.0 62 7.0 63 5.0 64 3.0 65 2.5 66 3.0 67 2.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.06999999999999999 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.36 150-151 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.95 0.0 0.0 0.0 0.0 132-133 1.075 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.2999999999999998 0.0 0.0 0.0 0.0 138-139 1.4249999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808337 spots for SRR7169052.sra Written 808337 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra Read 808327 spots for SRR7169052.sra Written 808327 spots for SRR7169052.sra SRR ids: ['SRR7169052.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6c8z75yx SRR7169052.sra spots: 16166550 blocks: [[1, 808327], [808328, 1616654], [1616655, 2424981], [2424982, 3233308], [3233309, 4041635], [4041636, 4849962], [4849963, 5658289], [5658290, 6466616], [6466617, 7274943], [7274944, 8083270], [8083271, 8891597], [8891598, 9699924], [9699925, 10508251], [10508252, 11316578], [11316579, 12124905], [12124906, 12933232], [12933233, 13741559], [13741560, 14549886], [14549887, 15358213], [15358214, 16166550]] SRR7169052 file size 5456612 SRR7169052 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169052 SRR7169052_1.fastq SRR7169052_2.fastq Input file: SRR7169052_1.fastq Paired file: SRR7169052_2.fastq trimmed: SRR7169052-trimmed-pair1.fastq, SRR7169052-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:28:19 2025 >> started Mon Feb 10 17:28:39 2025 >> done (19.992s) 16166550 read pairs processed; of these: 29446 ( 0.18%) short read pairs filtered out after trimming by size control 23831 ( 0.15%) empty read pairs filtered out after trimming by size control 16113273 (99.67%) read pairs available; of these: 7163866 (44.46%) trimmed read pairs available after processing 8949407 (55.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 5 0.00% 21 7 0.00% 22 2 0.00% 23 8 0.00% 24 10 0.00% 25 4 0.00% 26 6 0.00% 27 7 0.00% 28 5 0.00% 29 8 0.00% 30 6 0.00% 31 5 0.00% 32 5 0.00% 33 15 0.00% 34 12 0.00% 35 14 0.00% 36 15 0.00% 37 22 0.00% 38 18 0.00% 39 9 0.00% 40 19 0.00% 41 19 0.00% 42 20 0.00% 43 17 0.00% 44 19 0.00% 45 26 0.00% 46 24 0.00% 47 31 0.00% 48 27 0.00% 49 40 0.00% 50 26 0.00% 51 42 0.00% 52 44 0.00% 53 42 0.00% 54 47 0.00% 55 58 0.00% 56 57 0.00% 57 63 0.00% 58 80 0.00% 59 80 0.00% 60 91 0.00% 61 105 0.00% 62 104 0.00% 63 107 0.00% 64 136 0.00% 65 164 0.00% 66 166 0.00% 67 213 0.00% 68 201 0.00% 69 239 0.00% 70 280 0.00% 71 257 0.00% 72 314 0.00% 73 340 0.00% 74 341 0.00% 75 389 0.00% 76 451 0.00% 77 480 0.00% 78 532 0.00% 79 611 0.00% 80 695 0.00% 81 733 0.00% 82 953 0.01% 83 1077 0.01% 84 2348 0.01% 85 3045 0.02% 86 3060 0.02% 87 3136 0.02% 88 3210 0.02% 89 3319 0.02% 90 3247 0.02% 91 3409 0.02% 92 3448 0.02% 93 3747 0.02% 94 3808 0.02% 95 4071 0.03% 96 4209 0.03% 97 4615 0.03% 98 4738 0.03% 99 4978 0.03% 100 5449 0.03% 101 5609 0.03% 102 5947 0.04% 103 6369 0.04% 104 6779 0.04% 105 7314 0.05% 106 7786 0.05% 107 8176 0.05% 108 8735 0.05% 109 9158 0.06% 110 9705 0.06% 111 10169 0.06% 112 10864 0.07% 113 11582 0.07% 114 12387 0.08% 115 13257 0.08% 116 13861 0.09% 117 14750 0.09% 118 15238 0.09% 119 16272 0.10% 120 17056 0.11% 121 18287 0.11% 122 19175 0.12% 123 20493 0.13% 124 21645 0.13% 125 23322 0.14% 126 25021 0.16% 127 26886 0.17% 128 28425 0.18% 129 30264 0.19% 130 32458 0.20% 131 34812 0.22% 132 37880 0.24% 133 40904 0.25% 134 43795 0.27% 135 46893 0.29% 136 51574 0.32% 137 56574 0.35% 138 63841 0.40% 139 69761 0.43% 140 77793 0.48% 141 86847 0.54% 142 99709 0.62% 143 109234 0.68% 144 127819 0.79% 145 155121 0.96% 146 194261 1.21% 147 268989 1.67% 148 413528 2.57% 149 843623 5.24% 150 3810129 23.65% 151 8949407 55.54% 16113273 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=94.55 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.9 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=41 prefix-density=0.25 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=30 fanout-score=22.23 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=7.9 sequence=GAGGCTGCTTTGAGAGAGGG SRR7169052 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:29:37 Started mapping on | Feb 10 17:29:38 Finished on | Feb 10 17:32:07 Mapping speed, Million of reads per hour | 389.31 Number of input reads | 16113273 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14824408 Uniquely mapped reads % | 92.00% Average mapped length | 296.53 Number of splices: Total | 13748098 Number of splices: Annotated (sjdb) | 13532002 Number of splices: GT/AG | 13559412 Number of splices: GC/AG | 152442 Number of splices: AT/AC | 10535 Number of splices: Non-canonical | 25709 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295169 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 18167 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.02% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1020628 1020628 1020628 N_multimapping 295169 295169 295169 N_noFeature 278891 14649315 344989 N_ambiguous 166320 1001 56661 UnstrandedReadsAssigned:14379197 PositiveStrandReadsAssigned:174092 NegativeStrandReadsAssigned:14422758 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169052 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169052-trimmed-pair1.fastq SRR7169052-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,113,273 reads, 14,337,176 reads pseudoaligned [quant] estimated average fragment length: 270.672 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR7169052.ke.tsv 34699 SRR7169052.se.tsv 87100 total ==> SRR7169052.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.33 226.47 7.45564 Potri.005G024800.1.v4.1 1035 765.328 45 3.38424 Potri.004G059700.1.v4.1 961 691.346 1 0.0832532 Potri.007G009000.2.v4.1 1416 1146.33 0 0 Potri.003G141000.2.v4.1 2943 2673.33 194 4.17682 Potri.016G087400.1.v4.1 270 60.854 1293.49 1223.4 Potri.015G069301.1.v4.1 564 298.945 0 0 Potri.010G195200.1.v4.1 1773 1503.33 5 0.191431 Potri.012G127500.1.v4.1 977 707.334 4096 333.297 ==> SRR7169052.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1280 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 317 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169052 completed mapping pipeline successfully