Starting /dee2/code/volunteer_pipeline.sh SRR7169053 current disk space = 3058043555840 free memory = 1475447900 SRR7169053 SRAfilesize d3d7fd1b36449f033ca9f05da2b99a3f SRR7169053.sra SRR7169053.sra file validated SRR7169053 is paired end SRR7169053 is conventional basespace SRR7169053 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169053_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.00775 34.0 33.0 34.0 32.0 34.0 2 33.195 34.0 33.0 34.0 32.0 34.0 3 33.27125 34.0 33.0 34.0 32.0 34.0 4 33.42175 34.0 33.0 34.0 33.0 34.0 5 33.3245 34.0 33.0 34.0 33.0 34.0 6 37.05925 38.0 37.0 38.0 36.0 38.0 7 35.704 38.0 37.0 38.0 29.0 38.0 8 36.18725 38.0 37.0 38.0 31.0 38.0 9 37.122 38.0 38.0 38.0 36.0 38.0 10-14 37.307550000000006 38.0 38.0 38.0 36.8 38.0 15-19 37.049150000000004 38.0 38.0 38.0 36.0 38.0 20-24 37.3617 38.0 38.0 38.0 37.0 38.0 25-29 37.234700000000004 38.0 38.0 38.0 36.8 38.0 30-34 37.232800000000005 38.0 38.0 38.0 36.4 38.0 35-39 37.248900000000006 38.0 38.0 38.0 36.8 38.0 40-44 36.65245 38.0 37.6 38.0 34.2 38.0 45-49 36.60145 38.0 37.8 38.0 33.8 38.0 50-54 36.272499999999994 38.0 37.4 38.0 33.0 38.0 55-59 36.108450000000005 38.0 37.0 38.0 32.6 38.0 60-64 36.314550000000004 38.0 37.6 38.0 33.0 38.0 65-69 36.240449999999996 38.0 37.0 38.0 33.4 38.0 70-74 36.06419999999999 38.0 37.0 38.0 32.6 38.0 75-79 36.25105 38.0 37.0 38.0 33.2 38.0 80-84 36.082350000000005 38.0 37.0 38.0 33.0 38.0 85-89 35.781349999999996 38.0 36.6 38.0 30.6 38.0 90-94 35.57515 38.0 36.2 38.0 29.4 38.0 95-99 35.53724999999999 38.0 36.0 38.0 30.2 38.0 100-104 34.92495 38.0 35.4 38.0 27.4 38.0 105-109 34.447500000000005 38.0 34.4 38.0 23.6 38.0 110-114 34.475699999999996 38.0 34.4 38.0 25.6 38.0 115-119 34.5081 38.0 34.4 38.0 25.8 38.0 120-124 33.95190000000001 38.0 34.0 38.0 21.6 38.0 125-129 33.5168 38.0 34.0 38.0 19.0 38.0 130-134 33.33345 38.0 33.2 38.0 20.2 38.0 135-139 32.867999999999995 37.6 32.4 38.0 18.6 38.0 140-144 31.543899999999997 36.0 30.4 38.0 13.4 38.0 145-149 29.8918 35.6 28.6 38.0 8.6 38.0 150-151 25.169375000000002 33.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 3.0 16 0.0 17 3.0 18 4.0 19 9.0 20 5.0 21 7.0 22 13.0 23 13.0 24 19.0 25 25.0 26 36.0 27 39.0 28 49.0 29 77.0 30 76.0 31 100.0 32 159.0 33 186.0 34 316.0 35 534.0 36 1077.0 37 1245.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.11358283171945 13.373462444386286 9.421617377649829 31.09133734624444 2 23.025000000000002 15.525 33.225 28.225 3 19.075 21.3 27.175 32.45 4 23.075000000000003 30.125 22.35 24.45 5 20.775 35.175 24.0 20.05 6 19.425 35.025 26.1 19.45 7 14.75 26.825 40.275 18.15 8 18.475 26.575 29.775000000000002 25.174999999999997 9 18.275 25.1 32.65 23.974999999999998 10-14 19.715 30.18 26.290000000000003 23.815 15-19 20.06 29.075 27.41 23.455000000000002 20-24 20.101005050252514 29.156457822891145 27.31136556827841 23.43117155857793 25-29 19.939999999999998 29.255 27.205000000000002 23.599999999999998 30-34 19.90099504975249 29.50647532376619 27.2063603180159 23.386169308465423 35-39 19.790989549477477 28.926446322316117 27.521376068803438 23.761188059402972 40-44 19.891989198919894 28.902890289028903 27.42774277427743 23.77737773777378 45-49 20.28 28.544999999999998 27.150000000000002 24.025 50-54 19.985 28.935 26.950000000000003 24.13 55-59 20.095 29.310000000000002 26.950000000000003 23.645 60-64 20.580000000000002 28.765 26.465 24.19 65-69 20.630000000000003 28.645 26.740000000000002 23.985 70-74 20.14 28.71 27.29 23.86 75-79 20.25 28.325 27.295 24.13 80-84 20.13 28.665000000000003 27.150000000000002 24.055 85-89 21.08 28.015 27.834999999999997 23.07 90-94 20.427042704270427 28.862886288628864 27.257725772577256 23.452345234523452 95-99 20.21 27.905 27.665 24.22 100-104 20.335 28.24 27.805000000000003 23.62 105-109 20.665 27.85 27.485 24.0 110-114 20.3 28.634999999999998 27.68 23.385 115-119 20.685000000000002 27.79 27.88 23.645 120-124 20.21 28.26 27.750000000000004 23.78 125-129 20.845 28.46 26.924999999999997 23.77 130-134 20.9 28.59 26.674999999999997 23.835 135-139 21.01710171017102 28.452845284528454 26.852685268526855 23.67736773677368 140-144 20.724999999999998 27.875 27.66 23.74 145-149 20.431021551077556 28.47642382119106 27.226361318065905 23.866193309665483 150-151 20.6625 27.537499999999998 27.675 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 1.5 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 1.5 26 1.0 27 4.5 28 8.0 29 11.5 30 16.5 31 23.0 32 32.0 33 51.5 34 59.5 35 63.5 36 88.5 37 114.0 38 139.5 39 162.0 40 183.5 41 204.5 42 238.0 43 257.5 44 258.5 45 268.0 46 276.5 47 256.0 48 223.5 49 195.5 50 170.0 51 150.0 52 121.5 53 99.5 54 79.0 55 59.0 56 40.5 57 32.0 58 28.5 59 18.5 60 10.5 61 8.5 62 9.0 63 8.0 64 5.0 65 2.5 66 1.5 67 1.0 68 1.5 69 3.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.32499999999999996 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.6625 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.9 0.0 0.0 0.0 0.0 134-135 0.9874999999999999 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138-139 1.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATTT 20 0.005940113 28.995 65-69 >>END_MODULE SRR7169053 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169053_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91825 33.0 33.0 34.0 32.0 34.0 2 33.03875 34.0 33.0 34.0 32.0 34.0 3 32.993 34.0 33.0 34.0 32.0 34.0 4 32.92 34.0 33.0 34.0 32.0 34.0 5 32.9525 34.0 33.0 34.0 32.0 34.0 6 37.06675 38.0 38.0 38.0 37.0 38.0 7 37.07025 38.0 38.0 38.0 37.0 38.0 8 36.45825 38.0 38.0 38.0 34.0 38.0 9 37.01325 38.0 38.0 38.0 37.0 38.0 10-14 36.95700000000001 38.0 38.0 38.0 36.2 38.0 15-19 37.024649999999994 38.0 38.0 38.0 36.8 38.0 20-24 36.951499999999996 38.0 38.0 38.0 36.2 38.0 25-29 36.9777 38.0 38.0 38.0 36.2 38.0 30-34 36.97625 38.0 38.0 38.0 36.4 38.0 35-39 36.714150000000004 38.0 38.0 38.0 35.8 38.0 40-44 36.7775 38.0 38.0 38.0 35.8 38.0 45-49 36.9424 38.0 38.0 38.0 36.0 38.0 50-54 36.87995 38.0 38.0 38.0 36.0 38.0 55-59 36.811150000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.686749999999996 38.0 38.0 38.0 35.4 38.0 65-69 36.6497 38.0 38.0 38.0 35.2 38.0 70-74 36.50625 38.0 38.0 38.0 34.6 38.0 75-79 36.436749999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.35615 38.0 38.0 38.0 34.2 38.0 85-89 36.00805 38.0 38.0 38.0 32.6 38.0 90-94 36.0469 38.0 38.0 38.0 32.8 38.0 95-99 36.1809 38.0 37.8 38.0 33.8 38.0 100-104 36.09995 38.0 38.0 38.0 33.4 38.0 105-109 35.714099999999995 38.0 37.2 38.0 31.4 38.0 110-114 35.44885 38.0 37.0 38.0 29.8 38.0 115-119 35.197500000000005 38.0 36.6 38.0 28.2 38.0 120-124 35.2743 38.0 36.4 38.0 29.8 38.0 125-129 34.68685000000001 38.0 35.4 38.0 25.8 38.0 130-134 34.250449999999994 38.0 35.0 38.0 23.0 38.0 135-139 33.8268 38.0 34.8 38.0 22.2 38.0 140-144 33.635000000000005 38.0 34.0 38.0 21.8 38.0 145-149 32.6475 38.0 33.2 38.0 13.2 38.0 150-151 28.46625 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 2.0 11 5.0 12 4.0 13 3.0 14 1.0 15 2.0 16 7.0 17 6.0 18 6.0 19 5.0 20 4.0 21 9.0 22 14.0 23 15.0 24 22.0 25 25.0 26 27.0 27 29.0 28 42.0 29 40.0 30 48.0 31 69.0 32 79.0 33 119.0 34 165.0 35 268.0 36 564.0 37 2405.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.0 22.400000000000002 11.0 24.6 2 28.050000000000004 26.525 28.499999999999996 16.925 3 21.325 28.725 30.525000000000002 19.425 4 22.275 34.725 23.599999999999998 19.400000000000002 5 23.775 37.1 22.475 16.650000000000002 6 22.05 36.55 23.200000000000003 18.2 7 20.45 22.55 37.574999999999996 19.425 8 24.4 25.05 25.6 24.95 9 22.175 25.6 28.9 23.325000000000003 10-14 23.72 29.025000000000002 26.405 20.849999999999998 15-19 23.56 28.015 27.26 21.165 20-24 23.66 28.515 27.025 20.8 25-29 23.810000000000002 27.74 27.33 21.12 30-34 23.66 27.310000000000002 27.91 21.12 35-39 22.97 28.18 28.000000000000004 20.849999999999998 40-44 23.674999999999997 27.965 27.605 20.755000000000003 45-49 23.275000000000002 27.925 27.775 21.025 50-54 23.46 28.060000000000002 27.445000000000004 21.035 55-59 24.16 27.685 27.33 20.825 60-64 22.985 27.650000000000002 27.834999999999997 21.529999999999998 65-69 23.595 27.48 27.875 21.05 70-74 23.825 27.6 27.48 21.095 75-79 23.385 28.044999999999998 28.000000000000004 20.57 80-84 23.695 27.92 27.334999999999997 21.05 85-89 23.96 27.155 27.93 20.955 90-94 23.94 27.134999999999998 27.85 21.075 95-99 23.955000000000002 27.595 27.93 20.52 100-104 23.52 27.650000000000002 27.87 20.96 105-109 23.76 27.38 27.92 20.94 110-114 23.52 28.000000000000004 27.295 21.185000000000002 115-119 23.815 27.439999999999998 28.165000000000003 20.580000000000002 120-124 23.275000000000002 27.54 28.08 21.105 125-129 23.39 27.555000000000003 28.13 20.925 130-134 24.45 27.21 27.68 20.66 135-139 23.79 27.175 28.125 20.91 140-144 23.595 27.779999999999998 27.755000000000003 20.87 145-149 23.98 28.050000000000004 27.29 20.68 150-151 24.075 27.35 28.299999999999997 20.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 3.0 24 3.5 25 2.5 26 1.5 27 1.5 28 5.0 29 6.5 30 9.0 31 12.0 32 13.5 33 23.5 34 45.5 35 68.0 36 73.5 37 92.0 38 117.0 39 138.5 40 179.5 41 205.5 42 240.5 43 282.5 44 309.0 45 292.0 46 279.5 47 272.0 48 248.0 49 220.0 50 180.0 51 154.5 52 121.5 53 99.0 54 80.0 55 57.5 56 42.0 57 34.0 58 24.5 59 13.5 60 11.0 61 10.5 62 6.0 63 4.5 64 4.0 65 4.0 66 2.5 67 1.5 68 2.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.38749999999999996 0.0 0.0 0.0 0.0 124-125 0.44999999999999996 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 0.9625 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACATG 10 0.006830828 145.0 5 AAGGGTG 15 1.1411342E-4 145.0 5 CAAGGGT 10 0.006830828 145.0 4 GATGGAG 20 0.00593511 29.0 15-19 >>END_MODULE Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra Read 1007040 spots for SRR7169053.sra Written 1007040 spots for SRR7169053.sra Read 1007033 spots for SRR7169053.sra Written 1007033 spots for SRR7169053.sra SRR ids: ['SRR7169053.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5cufsaap SRR7169053.sra spots: 20140667 blocks: [[1, 1007033], [1007034, 2014066], [2014067, 3021099], [3021100, 4028132], [4028133, 5035165], [5035166, 6042198], [6042199, 7049231], [7049232, 8056264], [8056265, 9063297], [9063298, 10070330], [10070331, 11077363], [11077364, 12084396], [12084397, 13091429], [13091430, 14098462], [14098463, 15105495], [15105496, 16112528], [16112529, 17119561], [17119562, 18126594], [18126595, 19133627], [19133628, 20140667]] SRR7169053 file size 6803310 SRR7169053 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169053 SRR7169053_1.fastq SRR7169053_2.fastq Input file: SRR7169053_1.fastq Paired file: SRR7169053_2.fastq trimmed: SRR7169053-trimmed-pair1.fastq, SRR7169053-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:32:14 2025 >> started Mon Feb 10 17:32:37 2025 >> done (22.043s) 20140667 read pairs processed; of these: 23179 ( 0.12%) short read pairs filtered out after trimming by size control 13953 ( 0.07%) empty read pairs filtered out after trimming by size control 20103535 (99.82%) read pairs available; of these: 9922961 (49.36%) trimmed read pairs available after processing 10180574 (50.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 6 0.00% 21 2 0.00% 22 5 0.00% 23 9 0.00% 24 19 0.00% 25 9 0.00% 26 11 0.00% 27 9 0.00% 28 8 0.00% 29 7 0.00% 30 9 0.00% 31 10 0.00% 32 5 0.00% 33 4 0.00% 34 11 0.00% 35 7 0.00% 36 13 0.00% 37 10 0.00% 38 15 0.00% 39 12 0.00% 40 16 0.00% 41 14 0.00% 42 17 0.00% 43 13 0.00% 44 21 0.00% 45 35 0.00% 46 26 0.00% 47 26 0.00% 48 23 0.00% 49 29 0.00% 50 50 0.00% 51 34 0.00% 52 40 0.00% 53 32 0.00% 54 43 0.00% 55 57 0.00% 56 53 0.00% 57 63 0.00% 58 84 0.00% 59 94 0.00% 60 80 0.00% 61 71 0.00% 62 103 0.00% 63 126 0.00% 64 133 0.00% 65 158 0.00% 66 181 0.00% 67 196 0.00% 68 208 0.00% 69 243 0.00% 70 254 0.00% 71 305 0.00% 72 299 0.00% 73 328 0.00% 74 390 0.00% 75 420 0.00% 76 486 0.00% 77 496 0.00% 78 573 0.00% 79 631 0.00% 80 728 0.00% 81 912 0.00% 82 1017 0.01% 83 1226 0.01% 84 2189 0.01% 85 2836 0.01% 86 2859 0.01% 87 3088 0.02% 88 3313 0.02% 89 3254 0.02% 90 3369 0.02% 91 3463 0.02% 92 3813 0.02% 93 3952 0.02% 94 4216 0.02% 95 4547 0.02% 96 4680 0.02% 97 4937 0.02% 98 5279 0.03% 99 5427 0.03% 100 5811 0.03% 101 6324 0.03% 102 6808 0.03% 103 7106 0.04% 104 7717 0.04% 105 8412 0.04% 106 8952 0.04% 107 9468 0.05% 108 10012 0.05% 109 10603 0.05% 110 11100 0.06% 111 11930 0.06% 112 12862 0.06% 113 13650 0.07% 114 14363 0.07% 115 15418 0.08% 116 16269 0.08% 117 17045 0.08% 118 18210 0.09% 119 19152 0.10% 120 20238 0.10% 121 21480 0.11% 122 23108 0.11% 123 24689 0.12% 124 27058 0.13% 125 28547 0.14% 126 30629 0.15% 127 32369 0.16% 128 34709 0.17% 129 37226 0.19% 130 40045 0.20% 131 42854 0.21% 132 46500 0.23% 133 50803 0.25% 134 54917 0.27% 135 60227 0.30% 136 65876 0.33% 137 72386 0.36% 138 79208 0.39% 139 89026 0.44% 140 98148 0.49% 141 112013 0.56% 142 131241 0.65% 143 151148 0.75% 144 183269 0.91% 145 227086 1.13% 146 292977 1.46% 147 406933 2.02% 148 629017 3.13% 149 1226627 6.10% 150 5279647 26.26% 151 10180574 50.64% 20103535 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=41 prefix-density=0.18 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=6 fanout-score=87.47 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=18.9 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=8 fanout-score=58.72 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=14.7 sequence=TGTTGGTGGTGG SRR7169053 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:33:30 Started mapping on | Feb 10 17:33:30 Finished on | Feb 10 17:35:16 Mapping speed, Million of reads per hour | 682.76 Number of input reads | 20103535 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18854738 Uniquely mapped reads % | 93.79% Average mapped length | 296.44 Number of splices: Total | 18133911 Number of splices: Annotated (sjdb) | 17842002 Number of splices: GT/AG | 17878552 Number of splices: GC/AG | 205316 Number of splices: AT/AC | 14537 Number of splices: Non-canonical | 35506 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342880 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 99412 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.94% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 929993 929993 929993 N_multimapping 342880 342880 342880 N_noFeature 436579 18645337 525812 N_ambiguous 195258 987 74500 UnstrandedReadsAssigned:18222901 PositiveStrandReadsAssigned:208414 NegativeStrandReadsAssigned:18254426 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169053 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169053-trimmed-pair1.fastq SRR7169053-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,103,535 reads, 18,144,932 reads pseudoaligned [quant] estimated average fragment length: 274.599 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52401 SRR7169053.ke.tsv 34699 SRR7169053.se.tsv 87100 total ==> SRR7169053.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.4 466 13.8958 Potri.005G024800.1.v4.1 1035 761.401 54 3.68913 Potri.004G059700.1.v4.1 961 687.44 3 0.227002 Potri.007G009000.2.v4.1 1416 1142.4 0 0 Potri.003G141000.2.v4.1 2943 2669.4 360 7.01508 Potri.016G087400.1.v4.1 270 61.334 1764 1496.03 Potri.015G069301.1.v4.1 564 298.105 0 0 Potri.010G195200.1.v4.1 1773 1499.4 29 1.00606 Potri.012G127500.1.v4.1 977 703.414 4603 340.388 ==> SRR7169053.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1672 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169053 completed mapping pipeline successfully