Starting /dee2/code/volunteer_pipeline.sh SRR7169054 current disk space = 3058146471936 free memory = 1339125164 SRR7169054 SRAfilesize 412ca955dfc70df4387093ec66e401a3 SRR7169054.sra SRR7169054.sra file validated SRR7169054 is paired end SRR7169054 is conventional basespace SRR7169054 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169054_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14675 34.0 33.0 34.0 33.0 34.0 2 33.48125 34.0 34.0 34.0 33.0 34.0 3 33.577 34.0 34.0 34.0 33.0 34.0 4 33.5535 34.0 34.0 34.0 33.0 34.0 5 33.531 34.0 34.0 34.0 33.0 34.0 6 37.2285 38.0 38.0 38.0 36.0 38.0 7 37.409 38.0 38.0 38.0 37.0 38.0 8 37.5065 38.0 38.0 38.0 37.0 38.0 9 37.513 38.0 38.0 38.0 38.0 38.0 10-14 37.513549999999995 38.0 38.0 38.0 37.4 38.0 15-19 37.419349999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.40754999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.3652 38.0 38.0 38.0 37.0 38.0 30-34 37.23665 38.0 38.0 38.0 36.8 38.0 35-39 37.16325 38.0 38.0 38.0 36.4 38.0 40-44 36.82455 38.0 38.0 38.0 35.0 38.0 45-49 36.5939 38.0 38.0 38.0 34.2 38.0 50-54 36.4241 38.0 38.0 38.0 34.0 38.0 55-59 36.332049999999995 38.0 37.2 38.0 33.4 38.0 60-64 36.24365 38.0 37.0 38.0 33.4 38.0 65-69 36.1074 38.0 37.0 38.0 33.0 38.0 70-74 36.109249999999996 38.0 37.0 38.0 33.0 38.0 75-79 35.818 38.0 37.0 38.0 31.4 38.0 80-84 35.7796 38.0 37.0 38.0 31.2 38.0 85-89 35.57255 38.0 36.6 38.0 29.6 38.0 90-94 35.22245 38.0 36.0 38.0 29.0 38.0 95-99 35.1371 38.0 36.0 38.0 28.8 38.0 100-104 34.683800000000005 38.0 35.4 38.0 27.2 38.0 105-109 34.49795 38.0 35.0 38.0 25.6 38.0 110-114 34.137800000000006 38.0 34.4 38.0 23.6 38.0 115-119 33.9431 38.0 34.0 38.0 23.0 38.0 120-124 33.55935 38.0 34.0 38.0 17.8 38.0 125-129 33.07235 37.8 33.4 38.0 15.0 38.0 130-134 32.64205 37.2 33.0 38.0 15.0 38.0 135-139 32.26565000000001 37.4 32.2 38.0 14.6 38.0 140-144 31.41155 36.0 31.0 38.0 13.8 38.0 145-149 30.463749999999997 36.0 30.0 38.0 6.4 38.0 150-151 26.45375 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 4.0 13 4.0 14 4.0 15 6.0 16 6.0 17 8.0 18 11.0 19 18.0 20 6.0 21 20.0 22 17.0 23 18.0 24 31.0 25 21.0 26 25.0 27 34.0 28 48.0 29 45.0 30 49.0 31 110.0 32 105.0 33 163.0 34 275.0 35 491.0 36 1138.0 37 1340.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.25537838521893 14.527967603138444 9.99746899519109 34.21918501645153 2 24.275 14.549999999999999 30.55 30.625000000000004 3 19.55 16.8 26.75 36.9 4 22.275 22.875 24.275 30.575000000000003 5 21.55 29.75 24.55 24.15 6 21.475 31.924999999999997 25.650000000000002 20.95 7 15.85 31.55 36.175000000000004 16.425 8 17.7 29.825000000000003 30.5 21.975 9 16.8 27.6 33.225 22.375 10-14 18.725 31.275 27.97 22.03 15-19 19.185 29.465000000000003 27.37 23.98 20-24 19.265 29.970000000000002 27.279999999999998 23.485 25-29 19.2 29.73 27.529999999999998 23.54 30-34 18.92 30.104999999999997 27.55 23.425 35-39 19.715 29.585 26.82 23.880000000000003 40-44 19.305 30.525000000000002 27.015 23.155 45-49 19.6 29.53 27.1 23.77 50-54 19.42 30.23 26.915 23.435 55-59 19.575 29.45 26.755000000000003 24.22 60-64 19.56 29.580000000000002 27.634999999999998 23.225 65-69 19.955000000000002 29.520000000000003 27.055 23.47 70-74 19.96 28.835 27.24 23.965 75-79 20.369999999999997 29.09 26.845000000000002 23.695 80-84 19.564999999999998 30.130000000000003 26.405 23.9 85-89 19.725 29.275000000000002 26.755000000000003 24.245 90-94 19.705000000000002 28.89 27.200000000000003 24.205 95-99 20.205000000000002 28.655 27.560000000000002 23.580000000000002 100-104 20.29123298638911 29.183346677341877 26.421136909527622 24.104283426741393 105-109 20.225 28.970000000000002 27.395000000000003 23.41 110-114 19.76266773482876 28.93550971359904 27.36330863208492 23.93851391948728 115-119 20.265 29.13 26.515 24.09 120-124 20.749524667267085 28.905233663564495 27.138997298108674 23.206244371059743 125-129 20.49204920492049 28.007800780078007 28.012801280128013 23.487348734873486 130-134 20.685000000000002 28.075 27.665 23.575 135-139 20.31 27.965 27.115000000000002 24.610000000000003 140-144 20.674999999999997 27.689999999999998 27.48 24.154999999999998 145-149 20.955 27.794999999999998 27.16 24.09 150-151 20.3625 28.825 26.924999999999997 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 1.5 12 1.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.5 20 1.0 21 0.5 22 1.0 23 3.0 24 3.5 25 4.5 26 7.0 27 10.0 28 18.0 29 23.0 30 25.5 31 37.5 32 44.5 33 54.5 34 66.5 35 82.0 36 112.0 37 133.0 38 138.0 39 152.0 40 172.0 41 191.5 42 216.5 43 234.5 44 256.5 45 268.5 46 254.0 47 238.0 48 223.0 49 190.5 50 158.0 51 139.0 52 124.5 53 109.0 54 78.0 55 59.5 56 51.5 57 31.5 58 19.5 59 13.5 60 12.0 61 10.0 62 7.5 63 6.0 64 3.0 65 1.5 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 0.0 110-114 0.13999999999999999 115-119 0.0 120-124 0.06999999999999999 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.1875 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.65 0.0 0.0 0.0 0.0 132-133 0.7875000000000001 0.0 0.0 0.0 0.0 134-135 0.925 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138-139 1.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169054 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169054_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.953 33.0 33.0 34.0 32.0 34.0 2 33.07125 34.0 33.0 34.0 33.0 34.0 3 33.12025 34.0 33.0 34.0 33.0 34.0 4 33.08425 34.0 33.0 34.0 33.0 34.0 5 33.111 34.0 33.0 34.0 33.0 34.0 6 37.247 38.0 38.0 38.0 37.0 38.0 7 37.2605 38.0 38.0 38.0 37.0 38.0 8 37.1905 38.0 38.0 38.0 37.0 38.0 9 37.234 38.0 38.0 38.0 37.0 38.0 10-14 37.24525 38.0 38.0 38.0 37.8 38.0 15-19 37.20615 38.0 38.0 38.0 37.4 38.0 20-24 37.2196 38.0 38.0 38.0 37.2 38.0 25-29 37.202600000000004 38.0 38.0 38.0 37.2 38.0 30-34 37.1962 38.0 38.0 38.0 37.6 38.0 35-39 37.141549999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.147000000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.1237 38.0 38.0 38.0 37.0 38.0 50-54 36.937400000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.883750000000006 38.0 38.0 38.0 37.0 38.0 60-64 36.84580000000001 38.0 38.0 38.0 36.8 38.0 65-69 36.724450000000004 38.0 38.0 38.0 36.6 38.0 70-74 36.61775 38.0 38.0 38.0 36.2 38.0 75-79 36.55995 38.0 38.0 38.0 35.8 38.0 80-84 36.6065 38.0 38.0 38.0 35.8 38.0 85-89 36.559450000000005 38.0 38.0 38.0 35.8 38.0 90-94 36.46704999999999 38.0 38.0 38.0 35.4 38.0 95-99 36.39569999999999 38.0 38.0 38.0 34.8 38.0 100-104 36.2675 38.0 38.0 38.0 34.0 38.0 105-109 36.11685 38.0 38.0 38.0 34.0 38.0 110-114 35.9918 38.0 38.0 38.0 33.8 38.0 115-119 35.83565 38.0 38.0 38.0 33.4 38.0 120-124 35.7187 38.0 38.0 38.0 33.2 38.0 125-129 35.42465 38.0 37.6 38.0 31.4 38.0 130-134 35.1808 38.0 36.8 38.0 30.4 38.0 135-139 34.76075 38.0 36.0 38.0 28.2 38.0 140-144 34.2932 38.0 36.0 38.0 25.2 38.0 145-149 33.8151 38.0 35.2 38.0 21.2 38.0 150-151 30.47525 36.5 29.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 1.0 5 2.0 6 3.0 7 1.0 8 0.0 9 4.0 10 1.0 11 1.0 12 9.0 13 10.0 14 5.0 15 2.0 16 2.0 17 5.0 18 6.0 19 6.0 20 6.0 21 5.0 22 9.0 23 9.0 24 19.0 25 22.0 26 20.0 27 23.0 28 27.0 29 44.0 30 34.0 31 35.0 32 40.0 33 72.0 34 96.0 35 155.0 36 392.0 37 2922.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.87907676869042 22.05218263923733 16.081284495735073 24.98745609633718 2 28.453453453453452 28.27827827827828 25.625625625625624 17.64264264264264 3 20.895895895895897 29.354354354354356 30.28028028028028 19.46946946946947 4 23.35 33.725 23.35 19.575 5 24.831207801950487 34.858714678669664 22.58064516129032 17.72943235808952 6 23.3 34.925 23.425 18.35 7 19.125 22.7 38.025 20.150000000000002 8 23.849999999999998 25.0 27.175 23.974999999999998 9 21.8 26.775 27.925 23.5 10-14 23.51 29.189999999999998 26.064999999999998 21.235 15-19 24.085 28.21 26.88 20.825 20-24 23.565 28.32 26.99 21.125 25-29 23.785 28.275 27.125 20.815 30-34 23.494999999999997 28.735 27.105 20.665 35-39 23.805 27.925 27.439999999999998 20.830000000000002 40-44 23.645 28.185 27.55 20.62 45-49 23.625 27.689999999999998 27.625 21.060000000000002 50-54 24.135684938370577 28.189197314360154 27.412566389417776 20.26255135785149 55-59 24.044154540893125 27.67185148018063 27.932764676367285 20.351229302558956 60-64 23.115552654045096 27.735650077838596 27.941545723898958 21.207251544217346 65-69 24.051142655793818 28.178797946239808 27.14688412362831 20.623175274338067 70-74 24.821194721466707 27.14818172660421 27.14314495819482 20.88747859373426 75-79 24.127335919004683 27.547473933410565 27.623029265098474 20.70216088248627 80-84 24.449018525026357 27.667051558813192 27.350770621015112 20.53315929514534 85-89 24.460612142498743 27.691921726041148 27.12493728048169 20.722528850978424 90-94 23.61766181635725 27.64676367285499 28.008028098344205 20.727546412443555 95-99 24.05920722528851 27.732062217762167 27.70697441043653 20.501756146512797 100-104 24.385348720521826 27.31058705469142 27.686904164576013 20.617160060210736 105-109 23.69292523833417 27.37581535373808 27.837431008529855 21.093828399397893 110-114 23.64274962368289 27.53637732062218 27.932764676367285 20.888108379327647 115-119 24.089312594079278 27.68188660311089 28.033115905669842 20.19568489713999 120-124 24.064224786753638 27.902659307576517 27.67185148018063 20.36126442548921 125-129 24.3803311590567 27.58153537380833 27.952834922227797 20.085298544907175 130-134 24.140699483165236 28.11480756686236 27.53775904460836 20.20673390536404 135-139 24.22641509433962 27.23018867924528 27.984905660377358 20.558490566037733 140-144 23.5726883345931 27.583774250440918 27.94658604182414 20.89695137314185 145-149 24.64375947448206 27.286508337544213 27.86255684689237 20.207175341081353 150-151 24.63951429294207 26.92891474829244 28.01669618011637 20.41487477864913 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 2.5 21 4.0 22 2.0 23 1.5 24 2.5 25 3.5 26 3.0 27 3.0 28 4.0 29 7.5 30 9.5 31 11.0 32 16.0 33 22.5 34 32.0 35 51.5 36 71.0 37 83.5 38 114.5 39 153.5 40 189.5 41 216.5 42 251.5 43 287.5 44 300.5 45 282.5 46 272.0 47 281.5 48 253.5 49 206.0 50 179.0 51 152.0 52 124.5 53 112.5 54 81.5 55 55.5 56 43.5 57 31.0 58 22.5 59 16.5 60 12.5 61 7.0 62 4.0 63 3.0 64 3.5 65 3.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.1 3 0.1 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.21 55-59 0.35000000000000003 60-64 0.43499999999999994 65-69 0.67 70-74 0.73 75-79 0.735 80-84 0.40499999999999997 85-89 0.35000000000000003 90-94 0.35000000000000003 95-99 0.35000000000000003 100-104 0.35000000000000003 105-109 0.35000000000000003 110-114 0.35000000000000003 115-119 0.35000000000000003 120-124 0.35000000000000003 125-129 0.35000000000000003 130-134 0.35500000000000004 135-139 0.625 140-144 0.775 145-149 1.05 150-151 1.175 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.21250000000000002 0.0 0.0 0.0 0.0 122-123 0.225 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.5 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.8125 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138-139 1.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCTCT 10 0.006830828 145.0 3 TCTGGAC 10 0.006830828 145.0 145 GTCTCTA 10 0.006830828 145.0 4 AGTGATA 10 0.006830828 145.0 3 GTGATAG 10 0.006830828 145.0 4 >>END_MODULE Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra Read 564614 spots for SRR7169054.sra Written 564614 spots for SRR7169054.sra Read 564597 spots for SRR7169054.sra Written 564597 spots for SRR7169054.sra SRR ids: ['SRR7169054.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k3878b3t SRR7169054.sra spots: 11291957 blocks: [[1, 564597], [564598, 1129194], [1129195, 1693791], [1693792, 2258388], [2258389, 2822985], [2822986, 3387582], [3387583, 3952179], [3952180, 4516776], [4516777, 5081373], [5081374, 5645970], [5645971, 6210567], [6210568, 6775164], [6775165, 7339761], [7339762, 7904358], [7904359, 8468955], [8468956, 9033552], [9033553, 9598149], [9598150, 10162746], [10162747, 10727343], [10727344, 11291957]] SRR7169054 file size 3804773 SRR7169054 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169054 SRR7169054_1.fastq SRR7169054_2.fastq Input file: SRR7169054_1.fastq Paired file: SRR7169054_2.fastq trimmed: SRR7169054-trimmed-pair1.fastq, SRR7169054-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:17:54 2025 >> started Mon Feb 10 17:18:08 2025 >> done (13.865s) 11291957 read pairs processed; of these: 18612 ( 0.16%) short read pairs filtered out after trimming by size control 13823 ( 0.12%) empty read pairs filtered out after trimming by size control 11259522 (99.71%) read pairs available; of these: 5849036 (51.95%) trimmed read pairs available after processing 5410486 (48.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 4 0.00% 21 6 0.00% 22 4 0.00% 23 5 0.00% 24 13 0.00% 25 3 0.00% 26 7 0.00% 27 8 0.00% 28 6 0.00% 29 5 0.00% 30 17 0.00% 31 11 0.00% 32 11 0.00% 33 6 0.00% 34 13 0.00% 35 10 0.00% 36 12 0.00% 37 13 0.00% 38 16 0.00% 39 23 0.00% 40 19 0.00% 41 9 0.00% 42 15 0.00% 43 28 0.00% 44 29 0.00% 45 22 0.00% 46 22 0.00% 47 29 0.00% 48 30 0.00% 49 20 0.00% 50 35 0.00% 51 40 0.00% 52 41 0.00% 53 49 0.00% 54 31 0.00% 55 47 0.00% 56 64 0.00% 57 87 0.00% 58 65 0.00% 59 87 0.00% 60 90 0.00% 61 100 0.00% 62 106 0.00% 63 110 0.00% 64 145 0.00% 65 136 0.00% 66 166 0.00% 67 188 0.00% 68 228 0.00% 69 218 0.00% 70 278 0.00% 71 294 0.00% 72 335 0.00% 73 383 0.00% 74 424 0.00% 75 568 0.01% 76 483 0.00% 77 350 0.00% 78 527 0.00% 79 789 0.01% 80 1083 0.01% 81 545 0.00% 82 711 0.01% 83 838 0.01% 84 1591 0.01% 85 2098 0.02% 86 2292 0.02% 87 2292 0.02% 88 2251 0.02% 89 2275 0.02% 90 2381 0.02% 91 2593 0.02% 92 2708 0.02% 93 2951 0.03% 94 3050 0.03% 95 3313 0.03% 96 3563 0.03% 97 4044 0.04% 98 4828 0.04% 99 6126 0.05% 100 6978 0.06% 101 4736 0.04% 102 4769 0.04% 103 5000 0.04% 104 5193 0.05% 105 5691 0.05% 106 6202 0.06% 107 6350 0.06% 108 6909 0.06% 109 7116 0.06% 110 7527 0.07% 111 8071 0.07% 112 8681 0.08% 113 9189 0.08% 114 9491 0.08% 115 10071 0.09% 116 10623 0.09% 117 11369 0.10% 118 11852 0.11% 119 12329 0.11% 120 13511 0.12% 121 13841 0.12% 122 14674 0.13% 123 15624 0.14% 124 16956 0.15% 125 17813 0.16% 126 19129 0.17% 127 20350 0.18% 128 21653 0.19% 129 23245 0.21% 130 25169 0.22% 131 26820 0.24% 132 28565 0.25% 133 31347 0.28% 134 33719 0.30% 135 36925 0.33% 136 40297 0.36% 137 44670 0.40% 138 49621 0.44% 139 56474 0.50% 140 62599 0.56% 141 70752 0.63% 142 81567 0.72% 143 95573 0.85% 144 116951 1.04% 145 147213 1.31% 146 188909 1.68% 147 262894 2.33% 148 413610 3.67% 149 768701 6.83% 150 2873297 25.52% 151 5410486 48.05% 11259522 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=196.80 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=17.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=39 prefix-density=0.24 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=33 fanout-score=21.20 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=5.4 sequence=GCTGCCAAGAGCATCGTAGCAAATGGTCTTGCTCGTAGGTGCATTGTGCAAGT SRR7169054 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:18:59 Started mapping on | Feb 10 17:18:59 Finished on | Feb 10 17:20:33 Mapping speed, Million of reads per hour | 431.22 Number of input reads | 11259522 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10556760 Uniquely mapped reads % | 93.76% Average mapped length | 295.71 Number of splices: Total | 8810116 Number of splices: Annotated (sjdb) | 8653397 Number of splices: GT/AG | 8683863 Number of splices: GC/AG | 96680 Number of splices: AT/AC | 7737 Number of splices: Non-canonical | 21836 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 192684 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 15640 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.35% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527951 527951 527951 N_multimapping 192684 192684 192684 N_noFeature 225069 10401138 276534 N_ambiguous 151624 707 47054 UnstrandedReadsAssigned:10180067 PositiveStrandReadsAssigned:154915 NegativeStrandReadsAssigned:10233172 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169054 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169054-trimmed-pair1.fastq SRR7169054-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,259,522 reads, 10,203,845 reads pseudoaligned [quant] estimated average fragment length: 261.145 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,016 rounds 52401 SRR7169054.ke.tsv 34699 SRR7169054.se.tsv 87100 total ==> SRR7169054.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.85 197 8.96512 Potri.005G024800.1.v4.1 1035 774.855 26 2.68427 Potri.004G059700.1.v4.1 961 700.865 3 0.34242 Potri.007G009000.2.v4.1 1416 1155.85 0 0 Potri.003G141000.2.v4.1 2943 2682.85 124 3.69741 Potri.016G087400.1.v4.1 270 60.0712 1135 1511.48 Potri.015G069301.1.v4.1 564 306.935 0 0 Potri.010G195200.1.v4.1 1773 1512.85 9 0.475903 Potri.012G127500.1.v4.1 977 716.865 3929 438.447 ==> SRR7169054.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1221 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169054 completed mapping pipeline successfully