Starting /dee2/code/volunteer_pipeline.sh SRR7169055 current disk space = 3058135351296 free memory = 1373910984 SRR7169055 SRAfilesize c8c02cac84a294c61ad03fbb79a886c4 SRR7169055.sra SRR7169055.sra file validated SRR7169055 is paired end SRR7169055 is conventional basespace SRR7169055 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169055_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.051 34.0 33.0 34.0 33.0 34.0 2 33.4585 34.0 34.0 34.0 33.0 34.0 3 33.53775 34.0 34.0 34.0 33.0 34.0 4 33.51425 34.0 34.0 34.0 33.0 34.0 5 33.56925 34.0 34.0 34.0 33.0 34.0 6 37.247 38.0 38.0 38.0 36.0 38.0 7 37.486 38.0 38.0 38.0 37.0 38.0 8 37.52975 38.0 38.0 38.0 37.0 38.0 9 37.54275 38.0 38.0 38.0 38.0 38.0 10-14 37.551050000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.47715 38.0 38.0 38.0 37.2 38.0 20-24 37.4902 38.0 38.0 38.0 37.0 38.0 25-29 37.41885 38.0 38.0 38.0 37.0 38.0 30-34 37.37135 38.0 38.0 38.0 37.0 38.0 35-39 37.22915 38.0 38.0 38.0 36.4 38.0 40-44 36.87615 38.0 38.0 38.0 35.4 38.0 45-49 36.64635 38.0 38.0 38.0 34.2 38.0 50-54 36.59785000000001 38.0 38.0 38.0 34.0 38.0 55-59 36.35495 38.0 37.6 38.0 33.8 38.0 60-64 36.39444999999999 38.0 37.2 38.0 34.0 38.0 65-69 36.22635 38.0 37.2 38.0 33.0 38.0 70-74 36.1761 38.0 37.0 38.0 33.0 38.0 75-79 35.9923 38.0 37.0 38.0 32.2 38.0 80-84 35.8993 38.0 37.0 38.0 31.4 38.0 85-89 35.72735 38.0 37.0 38.0 31.0 38.0 90-94 35.44160000000001 38.0 36.0 38.0 29.0 38.0 95-99 35.50615 38.0 36.2 38.0 29.4 38.0 100-104 35.0249 38.0 35.6 38.0 28.0 38.0 105-109 34.92225 38.0 35.8 38.0 28.2 38.0 110-114 34.43385000000001 38.0 34.6 38.0 25.2 38.0 115-119 34.305949999999996 38.0 34.8 38.0 25.0 38.0 120-124 33.91195 38.0 34.0 38.0 22.8 38.0 125-129 33.434250000000006 38.0 33.8 38.0 19.0 38.0 130-134 32.96035 38.0 33.2 38.0 15.0 38.0 135-139 32.56935 37.6 33.0 38.0 14.6 38.0 140-144 31.831149999999997 36.2 31.8 38.0 14.0 38.0 145-149 30.80815 36.0 31.0 38.0 8.6 38.0 150-151 27.0255 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 2.0 12 0.0 13 0.0 14 3.0 15 4.0 16 10.0 17 4.0 18 9.0 19 9.0 20 12.0 21 14.0 22 21.0 23 16.0 24 26.0 25 27.0 26 24.0 27 22.0 28 34.0 29 52.0 30 70.0 31 79.0 32 118.0 33 139.0 34 267.0 35 466.0 36 1088.0 37 1481.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.00507614213198 15.355329949238577 10.101522842639595 32.53807106598985 2 24.099999999999998 13.350000000000001 32.125 30.425 3 19.775000000000002 19.6 27.05 33.575 4 22.7 26.55 22.8 27.950000000000003 5 22.275 31.825 23.275000000000002 22.625 6 20.724999999999998 35.4 23.400000000000002 20.474999999999998 7 15.174999999999999 29.049999999999997 39.2 16.575 8 17.2 28.375 31.075000000000003 23.35 9 17.05 25.8 33.775 23.375 10-14 19.75 30.270000000000003 27.85 22.13 15-19 19.475 29.525000000000002 27.915 23.085 20-24 20.085 29.475 27.075 23.365 25-29 19.814999999999998 29.770000000000003 27.32 23.095 30-34 19.675 29.86 26.669999999999998 23.794999999999998 35-39 20.24 29.535 26.340000000000003 23.885 40-44 19.855 29.9 26.47 23.775 45-49 19.8 29.439999999999998 27.54 23.22 50-54 20.205000000000002 29.244999999999997 26.795 23.755000000000003 55-59 20.435 29.32 26.495 23.75 60-64 20.215 29.03 26.939999999999998 23.815 65-69 19.525000000000002 29.2 27.395000000000003 23.880000000000003 70-74 20.375 29.42 26.33 23.875 75-79 20.1 28.595 27.43 23.875 80-84 20.560000000000002 29.020000000000003 26.435 23.985 85-89 20.535 28.575 27.084999999999997 23.805 90-94 20.87 28.810000000000002 26.875 23.445 95-99 20.53 28.799999999999997 26.875 23.794999999999998 100-104 20.413268624605994 29.609246009906435 26.69735327963176 23.280132085855808 105-109 20.495 28.884999999999998 26.91 23.71 110-114 20.5627597256296 28.253141741350824 26.75612076303009 24.427977769989486 115-119 20.7 28.994999999999997 26.5 23.805 120-124 21.086869495596478 28.52281825460368 26.56124899919936 23.82906325060048 125-129 20.974999999999998 27.865000000000002 27.425 23.735 130-134 21.12 28.185 26.8 23.895 135-139 20.65 28.849999999999998 26.565 23.935000000000002 140-144 21.29 28.15 26.86 23.7 145-149 20.785 28.860000000000003 26.650000000000002 23.705000000000002 150-151 21.0625 28.5875 26.575 23.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.5 21 2.5 22 3.0 23 3.5 24 3.5 25 3.0 26 5.5 27 7.0 28 11.0 29 15.5 30 18.0 31 34.0 32 51.5 33 53.0 34 59.5 35 81.0 36 106.0 37 129.0 38 138.5 39 155.0 40 177.0 41 186.5 42 201.5 43 222.5 44 242.5 45 257.0 46 270.0 47 252.0 48 212.0 49 191.0 50 171.0 51 148.0 52 131.0 53 110.0 54 92.5 55 71.5 56 46.5 57 32.0 58 23.5 59 20.0 60 13.0 61 6.0 62 7.0 63 6.0 64 4.5 65 5.5 66 2.5 67 2.0 68 3.0 69 3.0 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.0 110-114 0.135 115-119 0.0 120-124 0.08 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6300403225806451 1.25 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.42500000000000004 0.0 0.0 0.0 0.0 124-125 0.5875 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138-139 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTGTC 10 0.006830828 145.0 5 >>END_MODULE SRR7169055 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169055_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93075 33.0 33.0 34.0 32.0 34.0 2 33.10225 34.0 33.0 34.0 32.0 34.0 3 33.11675 34.0 33.0 34.0 33.0 34.0 4 33.02325 34.0 33.0 34.0 33.0 34.0 5 33.111 34.0 33.0 34.0 33.0 34.0 6 37.19475 38.0 38.0 38.0 37.0 38.0 7 37.26125 38.0 38.0 38.0 37.0 38.0 8 37.2875 38.0 38.0 38.0 38.0 38.0 9 37.233 38.0 38.0 38.0 38.0 38.0 10-14 37.1847 38.0 38.0 38.0 37.0 38.0 15-19 37.1842 38.0 38.0 38.0 37.8 38.0 20-24 37.20195 38.0 38.0 38.0 37.8 38.0 25-29 37.142849999999996 38.0 38.0 38.0 37.4 38.0 30-34 37.15315 38.0 38.0 38.0 37.6 38.0 35-39 37.09 38.0 38.0 38.0 37.0 38.0 40-44 37.0572 38.0 38.0 38.0 37.0 38.0 45-49 37.0818 38.0 38.0 38.0 37.0 38.0 50-54 36.927499999999995 38.0 38.0 38.0 37.0 38.0 55-59 36.8332 38.0 38.0 38.0 37.0 38.0 60-64 36.845600000000005 38.0 38.0 38.0 36.8 38.0 65-69 36.72985 38.0 38.0 38.0 36.4 38.0 70-74 36.64684999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.59165 38.0 38.0 38.0 36.0 38.0 80-84 36.622 38.0 38.0 38.0 36.0 38.0 85-89 36.58655 38.0 38.0 38.0 35.8 38.0 90-94 36.4568 38.0 38.0 38.0 35.0 38.0 95-99 36.4472 38.0 38.0 38.0 35.0 38.0 100-104 36.21095 38.0 38.0 38.0 34.4 38.0 105-109 36.114549999999994 38.0 38.0 38.0 34.0 38.0 110-114 35.96795 38.0 38.0 38.0 33.8 38.0 115-119 35.81865 38.0 38.0 38.0 33.4 38.0 120-124 35.61365 38.0 38.0 38.0 32.8 38.0 125-129 35.39135 38.0 37.6 38.0 31.2 38.0 130-134 35.28685 38.0 37.2 38.0 31.4 38.0 135-139 34.79115 38.0 36.0 38.0 28.2 38.0 140-144 34.3418 38.0 36.0 38.0 24.8 38.0 145-149 33.735 38.0 35.2 38.0 20.4 38.0 150-151 30.335749999999997 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 6.0 4 3.0 5 2.0 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 7.0 13 12.0 14 4.0 15 4.0 16 5.0 17 5.0 18 8.0 19 8.0 20 4.0 21 9.0 22 7.0 23 6.0 24 14.0 25 14.0 26 22.0 27 20.0 28 21.0 29 43.0 30 27.0 31 51.0 32 53.0 33 73.0 34 114.0 35 162.0 36 327.0 37 2954.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.95582329317269 23.167670682730922 14.231927710843372 23.64457831325301 2 29.675 24.975 27.05 18.3 3 22.50562640660165 28.732183045761438 29.532383095773945 19.229807451862964 4 24.474999999999998 33.6 23.325000000000003 18.6 5 25.525 35.675000000000004 20.599999999999998 18.2 6 20.549999999999997 37.4 23.05 19.0 7 21.099999999999998 20.95 37.7 20.25 8 22.900000000000002 25.75 27.875 23.474999999999998 9 21.224999999999998 26.400000000000002 28.4 23.974999999999998 10-14 23.845 28.189999999999998 26.229999999999997 21.735 15-19 24.27 28.125 26.665 20.94 20-24 23.7 28.050000000000004 26.955000000000002 21.295 25-29 24.555 27.73 26.979999999999997 20.735 30-34 23.48 27.985 27.455000000000002 21.08 35-39 23.65 28.235 26.735 21.38 40-44 24.345 27.62 26.905 21.13 45-49 24.23 27.295 27.325 21.15 50-54 23.534422286802283 27.116945585730036 27.72321875939473 21.625413368072955 55-59 23.95786305492852 27.2886882367695 27.66491096062202 21.08853774767996 60-64 23.577806762315642 27.871977525835256 27.5609511387579 20.9892645730912 65-69 23.84495500477603 27.33899753657433 27.580312704238096 21.235734754411542 70-74 23.95330112721417 27.59158615136876 27.284621578099838 21.17049114331723 75-79 23.427277302466027 27.528938097634626 27.84599899345747 21.197785606441872 80-84 24.119594662385875 27.264974415571388 27.385371726698104 21.230059195344637 85-89 23.787552033702795 27.192938462310046 27.664376347860976 21.355133156126186 90-94 23.78730875344871 26.601454727865566 28.31703034863306 21.29420617005267 95-99 24.41813804173355 27.337479935794544 27.618378812199033 20.626003210272874 100-104 24.15834629471677 27.615272690783204 27.289147559078824 20.937233455421204 105-109 23.49636318033609 27.544519688989215 27.75018811136193 21.208929019312766 110-114 23.928965586435236 27.591050466539578 27.982341727701414 20.49764221932377 115-119 24.237407184427052 27.13224964880594 27.513546056592414 21.11679711017459 120-124 23.564833400240868 27.709755118426333 27.724809313528702 21.000602167804093 125-129 23.664275322329807 26.96533386845934 28.410174083178646 20.960216726032208 130-134 24.253824931025832 27.715073990469026 27.183345874090797 20.847755204414348 135-139 24.102924917077093 27.22384159211981 27.57563574228566 21.097597748517437 140-144 23.94543441055069 27.232457465015603 27.5848182824927 21.237289841941003 145-149 24.87617507328414 26.811887192964722 27.767108056201355 20.544829677549785 150-151 25.104549486757065 27.106830566468126 27.525028513496387 20.263591433278417 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 1.0 23 2.0 24 2.0 25 3.0 26 4.0 27 4.5 28 5.0 29 3.5 30 6.5 31 10.5 32 17.0 33 25.0 34 26.0 35 36.0 36 56.5 37 78.5 38 109.5 39 146.5 40 189.5 41 216.0 42 234.0 43 271.5 44 290.0 45 287.0 46 292.5 47 285.0 48 241.0 49 203.5 50 185.5 51 161.0 52 129.0 53 111.0 54 93.5 55 62.5 56 50.5 57 42.5 58 30.0 59 22.5 60 13.0 61 11.0 62 10.5 63 7.0 64 5.0 65 4.0 66 3.5 67 1.5 68 0.5 69 1.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.21 55-59 0.325 60-64 0.33 65-69 0.545 70-74 0.64 75-79 0.65 80-84 0.33 85-89 0.305 90-94 0.325 95-99 0.32 100-104 0.345 105-109 0.325 110-114 0.33 115-119 0.33999999999999997 120-124 0.36 125-129 0.335 130-134 0.325 135-139 0.51 140-144 0.67 145-149 1.0699999999999998 150-151 1.3625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.42500000000000004 0.0 0.0 0.0 0.0 124-125 0.5875 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9 0.0 0.0 0.0 0.0 134-135 1.0125 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138-139 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGGAG 10 0.006830828 145.0 1 >>END_MODULE Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653304 spots for SRR7169055.sra Written 653304 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra Read 653302 spots for SRR7169055.sra Written 653302 spots for SRR7169055.sra SRR ids: ['SRR7169055.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iuo5uj3_ SRR7169055.sra spots: 13066042 blocks: [[1, 653302], [653303, 1306604], [1306605, 1959906], [1959907, 2613208], [2613209, 3266510], [3266511, 3919812], [3919813, 4573114], [4573115, 5226416], [5226417, 5879718], [5879719, 6533020], [6533021, 7186322], [7186323, 7839624], [7839625, 8492926], [8492927, 9146228], [9146229, 9799530], [9799531, 10452832], [10452833, 11106134], [11106135, 11759436], [11759437, 12412738], [12412739, 13066042]] SRR7169055 file size 4405952 SRR7169055 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169055 SRR7169055_1.fastq SRR7169055_2.fastq Input file: SRR7169055_1.fastq Paired file: SRR7169055_2.fastq trimmed: SRR7169055-trimmed-pair1.fastq, SRR7169055-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:18:31 2025 >> started Mon Feb 10 17:18:46 2025 >> done (15.231s) 13066042 read pairs processed; of these: 23227 ( 0.18%) short read pairs filtered out after trimming by size control 18938 ( 0.14%) empty read pairs filtered out after trimming by size control 13023877 (99.68%) read pairs available; of these: 6689475 (51.36%) trimmed read pairs available after processing 6334402 (48.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 4 0.00% 21 6 0.00% 22 1 0.00% 23 7 0.00% 24 3 0.00% 25 8 0.00% 26 9 0.00% 27 14 0.00% 28 6 0.00% 29 6 0.00% 30 16 0.00% 31 9 0.00% 32 8 0.00% 33 7 0.00% 34 16 0.00% 35 15 0.00% 36 18 0.00% 37 17 0.00% 38 17 0.00% 39 19 0.00% 40 28 0.00% 41 16 0.00% 42 29 0.00% 43 26 0.00% 44 22 0.00% 45 23 0.00% 46 29 0.00% 47 39 0.00% 48 48 0.00% 49 44 0.00% 50 50 0.00% 51 57 0.00% 52 65 0.00% 53 41 0.00% 54 53 0.00% 55 85 0.00% 56 73 0.00% 57 94 0.00% 58 97 0.00% 59 105 0.00% 60 99 0.00% 61 129 0.00% 62 126 0.00% 63 131 0.00% 64 158 0.00% 65 187 0.00% 66 189 0.00% 67 223 0.00% 68 248 0.00% 69 288 0.00% 70 377 0.00% 71 402 0.00% 72 416 0.00% 73 464 0.00% 74 585 0.00% 75 725 0.01% 76 615 0.00% 77 485 0.00% 78 683 0.01% 79 1001 0.01% 80 1461 0.01% 81 816 0.01% 82 898 0.01% 83 1116 0.01% 84 2185 0.02% 85 2850 0.02% 86 3056 0.02% 87 3146 0.02% 88 3084 0.02% 89 2876 0.02% 90 3112 0.02% 91 3338 0.03% 92 3448 0.03% 93 3657 0.03% 94 3938 0.03% 95 4220 0.03% 96 4507 0.03% 97 5064 0.04% 98 6164 0.05% 99 7617 0.06% 100 8611 0.07% 101 5994 0.05% 102 5985 0.05% 103 6516 0.05% 104 6933 0.05% 105 7505 0.06% 106 7949 0.06% 107 8536 0.07% 108 8918 0.07% 109 9090 0.07% 110 9651 0.07% 111 10183 0.08% 112 10626 0.08% 113 11077 0.09% 114 11817 0.09% 115 12544 0.10% 116 13105 0.10% 117 13925 0.11% 118 14323 0.11% 119 15293 0.12% 120 16040 0.12% 121 17142 0.13% 122 17963 0.14% 123 18982 0.15% 124 20173 0.15% 125 21936 0.17% 126 23234 0.18% 127 24482 0.19% 128 26245 0.20% 129 27747 0.21% 130 29799 0.23% 131 31685 0.24% 132 33902 0.26% 133 36645 0.28% 134 39196 0.30% 135 43397 0.33% 136 47366 0.36% 137 51400 0.39% 138 57345 0.44% 139 64901 0.50% 140 71473 0.55% 141 79936 0.61% 142 91679 0.70% 143 107222 0.82% 144 131044 1.01% 145 163298 1.25% 146 207694 1.59% 147 290300 2.23% 148 456249 3.50% 149 861398 6.61% 150 3305701 25.38% 151 6334402 48.64% 13023877 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.71 fanout-score-rank=21 prefix-density=0.23 prefix-fanout=4.2 sequence=GTTGCATCCTGGTATTGCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=262.33 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=19.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.94 fanout-score-rank=17 prefix-density=0.40 prefix-fanout=3.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.10 sequence-density-rank=32 fanout-score=41.16 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=9.5 sequence=TTCTTCATTGCCCTCCAACCCTAGCTCAGTCACCAGCTGCAGCCCCAGCACCACCCGGTCCAACCAATGTCACCAAAGTCCTAGAAAAAGGTGGTCAGTTCAGCGTTTTTATCAGGCTTTTGAAAGCCACTCAAGAGGATGTCACATTGAATGGCCAG SRR7169055 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:19:35 Started mapping on | Feb 10 17:19:36 Finished on | Feb 10 17:21:56 Mapping speed, Million of reads per hour | 334.90 Number of input reads | 13023877 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11621243 Uniquely mapped reads % | 89.23% Average mapped length | 295.38 Number of splices: Total | 9694794 Number of splices: Annotated (sjdb) | 9521264 Number of splices: GT/AG | 9554527 Number of splices: GC/AG | 107442 Number of splices: AT/AC | 8616 Number of splices: Non-canonical | 24209 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 232177 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 17226 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.81% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1192625 1192625 1192625 N_multimapping 232177 232177 232177 N_noFeature 255084 11465645 305695 N_ambiguous 150719 741 45222 UnstrandedReadsAssigned:11215440 PositiveStrandReadsAssigned:154857 NegativeStrandReadsAssigned:11270326 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169055 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169055-trimmed-pair1.fastq SRR7169055-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,023,877 reads, 11,273,959 reads pseudoaligned [quant] estimated average fragment length: 260.29 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR7169055.ke.tsv 34699 SRR7169055.se.tsv 87100 total ==> SRR7169055.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.71 225 9.02103 Potri.005G024800.1.v4.1 1035 775.71 24 2.18162 Potri.004G059700.1.v4.1 961 701.732 3 0.301452 Potri.007G009000.2.v4.1 1416 1156.71 0 0 Potri.003G141000.2.v4.1 2943 2683.71 141.09 3.70705 Potri.016G087400.1.v4.1 270 61.8285 1122.93 1280.65 Potri.015G069301.1.v4.1 564 307.5 0 0 Potri.010G195200.1.v4.1 1773 1513.71 11 0.51241 Potri.012G127500.1.v4.1 977 717.721 3285 322.736 ==> SRR7169055.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1396 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 362 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7169055 completed mapping pipeline successfully