Starting /dee2/code/volunteer_pipeline.sh SRR7169056 current disk space = 3058000207872 free memory = 1232434936 SRR7169056 SRAfilesize ad0c5f2069b75047ca006f55c22073bf SRR7169056.sra SRR7169056.sra file validated SRR7169056 is paired end SRR7169056 is conventional basespace SRR7169056 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169056_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8115 34.0 33.0 34.0 33.0 34.0 2 33.36375 34.0 33.0 34.0 33.0 34.0 3 33.34925 34.0 33.0 34.0 33.0 34.0 4 33.445 34.0 34.0 34.0 33.0 34.0 5 33.482 34.0 34.0 34.0 33.0 34.0 6 37.17325 38.0 37.0 38.0 36.0 38.0 7 37.4285 38.0 38.0 38.0 37.0 38.0 8 37.557 38.0 38.0 38.0 38.0 38.0 9 37.486 38.0 38.0 38.0 37.0 38.0 10-14 37.2307 38.0 38.0 38.0 36.8 38.0 15-19 37.283 38.0 38.0 38.0 37.0 38.0 20-24 37.47545 38.0 38.0 38.0 37.2 38.0 25-29 37.34155 38.0 38.0 38.0 37.2 38.0 30-34 37.39165 38.0 38.0 38.0 37.2 38.0 35-39 37.384299999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.274 38.0 38.0 38.0 36.8 38.0 45-49 37.125299999999996 38.0 38.0 38.0 36.0 38.0 50-54 37.0 38.0 38.0 38.0 35.8 38.0 55-59 36.61625 38.0 38.0 38.0 34.2 38.0 60-64 36.8609 38.0 38.0 38.0 35.2 38.0 65-69 36.7068 38.0 38.0 38.0 34.4 38.0 70-74 36.600849999999994 38.0 38.0 38.0 34.4 38.0 75-79 36.612 38.0 38.0 38.0 34.2 38.0 80-84 36.6051 38.0 38.0 38.0 34.2 38.0 85-89 36.40145 38.0 37.6 38.0 33.8 38.0 90-94 36.1293 38.0 37.2 38.0 32.6 38.0 95-99 36.3006 38.0 37.4 38.0 33.8 38.0 100-104 35.80625 38.0 36.8 38.0 31.4 38.0 105-109 35.1709 38.0 36.0 38.0 27.6 38.0 110-114 35.60165 38.0 36.6 38.0 30.2 38.0 115-119 35.67675 38.0 36.6 38.0 31.0 38.0 120-124 35.3993 38.0 36.0 38.0 29.4 38.0 125-129 34.829699999999995 38.0 35.2 38.0 26.8 38.0 130-134 35.15185 38.0 35.8 38.0 29.2 38.0 135-139 34.6506 38.0 35.0 38.0 27.2 38.0 140-144 33.866749999999996 38.0 34.4 38.0 22.8 38.0 145-149 33.38435 38.0 34.0 38.0 20.0 38.0 150-151 29.791 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 1.0 20 4.0 21 6.0 22 9.0 23 10.0 24 14.0 25 13.0 26 16.0 27 29.0 28 37.0 29 47.0 30 59.0 31 69.0 32 94.0 33 125.0 34 180.0 35 305.0 36 743.0 37 2230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.849210392256744 14.034640855832908 9.57717778909832 34.53897096281202 2 23.525 15.2 31.924999999999997 29.349999999999998 3 20.075000000000003 19.375 26.0 34.55 4 23.200000000000003 25.324999999999996 22.975 28.499999999999996 5 23.724999999999998 31.424999999999997 23.275000000000002 21.575 6 21.475 33.5 23.95 21.075 7 16.425 28.299999999999997 38.2 17.075000000000003 8 17.325 27.075 30.8 24.8 9 15.975 25.35 33.875 24.8 10-14 19.595000000000002 29.845 27.015 23.544999999999998 15-19 19.13 29.330000000000002 27.810000000000002 23.73 20-24 20.605 28.725 27.33 23.34 25-29 20.22 28.849999999999998 27.415 23.515 30-34 19.98 28.735 27.584999999999997 23.7 35-39 19.939999999999998 28.970000000000002 27.295 23.794999999999998 40-44 20.05 29.03 27.115000000000002 23.805 45-49 20.535 28.15 27.72 23.595 50-54 19.335 28.84 27.665 24.16 55-59 20.215 28.615000000000002 26.845000000000002 24.325 60-64 20.82 28.815 26.985 23.380000000000003 65-69 20.015 29.145 27.265 23.575 70-74 20.038005700855127 28.87433114967245 27.589138370755613 23.49852477871681 75-79 20.07100355017751 28.39641982099105 27.51137556877844 24.021201060053002 80-84 20.255000000000003 27.685 27.894999999999996 24.165 85-89 20.365 28.105000000000004 27.275 24.255 90-94 20.23 28.475 27.634999999999998 23.66 95-99 20.405 28.470000000000002 27.625 23.5 100-104 20.365 28.544999999999998 27.46 23.630000000000003 105-109 20.745 27.96 27.224999999999998 24.07 110-114 20.10701070107011 28.192819281928195 27.672767276727672 24.027402740274027 115-119 20.37101855092755 28.181409070453523 26.66133306665333 24.7862393119656 120-124 20.225 28.255000000000003 27.3 24.22 125-129 20.743111466720006 27.969195379306893 27.119067860179026 24.16862529379407 130-134 20.369999999999997 28.125 27.584999999999997 23.919999999999998 135-139 20.24 27.534999999999997 27.894999999999996 24.33 140-144 20.65 27.305 27.625 24.42 145-149 20.65 28.04 27.055 24.255 150-151 20.1375 28.3625 26.687499999999996 24.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 2.5 26 5.0 27 7.0 28 7.0 29 11.0 30 15.5 31 21.5 32 31.0 33 42.0 34 46.5 35 59.5 36 90.5 37 107.5 38 126.5 39 153.0 40 178.5 41 209.5 42 230.0 43 253.0 44 263.5 45 275.5 46 275.5 47 266.5 48 261.0 49 234.0 50 190.0 51 142.5 52 121.0 53 103.0 54 72.0 55 47.5 56 32.0 57 24.5 58 25.5 59 19.0 60 11.5 61 11.5 62 9.5 63 4.5 64 2.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.005 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.8375 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.1124999999999998 0.0 0.0 0.0 0.0 136-137 1.2999999999999998 0.0 0.0 0.0 0.0 138-139 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169056 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169056_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71225 33.0 33.0 34.0 32.0 34.0 2 32.95125 34.0 33.0 34.0 32.0 34.0 3 32.86625 34.0 33.0 34.0 32.0 34.0 4 32.81625 34.0 33.0 34.0 32.0 34.0 5 32.8845 34.0 33.0 34.0 32.0 34.0 6 37.057 38.0 38.0 38.0 37.0 38.0 7 37.03225 38.0 38.0 38.0 37.0 38.0 8 37.01175 38.0 38.0 38.0 37.0 38.0 9 36.71075 38.0 38.0 38.0 35.0 38.0 10-14 36.82635 38.0 38.0 38.0 36.0 38.0 15-19 36.84855 38.0 38.0 38.0 36.0 38.0 20-24 36.818549999999995 38.0 38.0 38.0 35.8 38.0 25-29 36.9406 38.0 38.0 38.0 36.0 38.0 30-34 37.00745 38.0 38.0 38.0 36.8 38.0 35-39 36.6258 38.0 38.0 38.0 35.2 38.0 40-44 36.6041 38.0 38.0 38.0 35.0 38.0 45-49 36.828050000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.85475 38.0 38.0 38.0 36.0 38.0 55-59 36.7348 38.0 38.0 38.0 35.6 38.0 60-64 36.74765 38.0 38.0 38.0 35.6 38.0 65-69 36.704249999999995 38.0 38.0 38.0 35.2 38.0 70-74 36.3076 38.0 38.0 38.0 33.8 38.0 75-79 36.49835 38.0 38.0 38.0 34.2 38.0 80-84 36.40125 38.0 38.0 38.0 34.2 38.0 85-89 36.1548 38.0 38.0 38.0 33.4 38.0 90-94 36.14385 38.0 38.0 38.0 33.4 38.0 95-99 36.14805 38.0 38.0 38.0 33.8 38.0 100-104 36.16295 38.0 38.0 38.0 33.8 38.0 105-109 35.84645 38.0 37.6 38.0 32.2 38.0 110-114 35.5579 38.0 37.0 38.0 30.6 38.0 115-119 35.28485 38.0 36.8 38.0 29.2 38.0 120-124 35.428450000000005 38.0 37.0 38.0 30.6 38.0 125-129 35.25655 38.0 36.2 38.0 30.4 38.0 130-134 34.641949999999994 38.0 35.8 38.0 26.2 38.0 135-139 34.174549999999996 38.0 35.0 38.0 23.4 38.0 140-144 34.3153 38.0 35.0 38.0 25.2 38.0 145-149 33.80585000000001 38.0 35.0 38.0 20.8 38.0 150-151 30.174999999999997 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 1.0 5 0.0 6 2.0 7 1.0 8 1.0 9 2.0 10 1.0 11 0.0 12 5.0 13 2.0 14 1.0 15 2.0 16 6.0 17 6.0 18 3.0 19 11.0 20 9.0 21 7.0 22 20.0 23 13.0 24 22.0 25 13.0 26 29.0 27 37.0 28 21.0 29 40.0 30 48.0 31 71.0 32 81.0 33 103.0 34 141.0 35 225.0 36 509.0 37 2556.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.89552988448016 21.948769462581616 14.816675037669514 25.339025615268707 2 27.900000000000002 25.650000000000002 27.474999999999998 18.975 3 20.325 28.975 31.65 19.05 4 23.599999999999998 33.025 24.15 19.225 5 25.624999999999996 34.675 21.625 18.075 6 20.674999999999997 37.125 24.375 17.825 7 21.375 21.6 37.8 19.225 8 22.675 25.174999999999997 26.450000000000003 25.7 9 21.3 26.125 30.175 22.400000000000002 10-14 23.741187059352967 28.87644382219111 26.091304565228263 21.291064553227663 15-19 23.8973897389739 27.94279427942794 26.752675267526755 21.407140714071407 20-24 22.997299729972998 28.007800780078007 27.867786778677868 21.127112711271128 25-29 23.49704911473442 28.538561568470538 26.773031909572868 21.191357407222167 30-34 23.121936580974292 28.503551065319595 27.243172951885562 21.131339401820544 35-39 23.41351202680402 28.049207381107166 27.429114367155073 21.10816622493374 40-44 23.17542894302436 27.377319793907258 28.17767995598019 21.26957130708819 45-49 23.74593648412103 27.776944236059016 27.321830457614404 21.155288822205552 50-54 23.477043112933877 28.293488046413923 27.233169950985296 20.9962988896669 55-59 23.715 27.529999999999998 27.92 20.835 60-64 23.174634926985398 28.09561912382477 27.980596119223843 20.749149829965994 65-69 24.28607151787947 27.0717679419855 28.00200050012503 20.640160040010002 70-74 23.72237223722372 28.542854285428543 27.437743774377438 20.2970297029703 75-79 23.629725945189037 27.58551710342068 28.21564312862572 20.569113822764553 80-84 24.1546618647459 27.951180472188874 27.55102040816326 20.34313725490196 85-89 24.131206560328017 27.58137906895345 27.281364068203413 21.006050302515124 90-94 23.73974794958992 27.730546109221844 27.510502100420087 21.019203840768153 95-99 24.083429200220078 27.389586355224328 27.889761416495773 20.63722302805982 100-104 23.991199559978 27.751387569378466 27.641382069103454 20.616030801540077 105-109 23.373180613214625 27.53463712299305 28.15485419896964 20.937328064822687 110-114 23.507052115634693 28.523557067120137 27.853356006802038 20.116034810443136 115-119 23.7221166349905 27.768330499149744 27.568270481144342 20.941282384715414 120-124 24.298644796719508 27.78916837525629 27.524128619292892 20.388058208731312 125-129 24.111027756939237 28.017004251062765 27.28182045511378 20.59014753688422 130-134 24.0642514011209 27.652121697357884 27.15672538030424 21.126901521216972 135-139 24.324729891956785 27.62104841936775 27.756102440976388 20.298119247699077 140-144 24.179671868747498 27.751100440176067 27.200880352140857 20.868347338935575 145-149 24.569741845107064 27.70662397438463 27.54652791675005 20.177106263758255 150-151 24.659076692105593 26.41060928312273 27.899411985487298 21.030902039284374 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 2.0 24 1.5 25 1.0 26 2.0 27 2.5 28 3.0 29 2.5 30 5.5 31 9.5 32 14.0 33 27.5 34 34.5 35 37.0 36 57.0 37 94.5 38 127.5 39 160.0 40 205.0 41 231.5 42 259.0 43 286.0 44 293.5 45 304.5 46 290.0 47 272.0 48 249.0 49 199.5 50 166.0 51 143.0 52 131.0 53 103.5 54 72.0 55 57.5 56 38.0 57 30.5 58 25.5 59 17.0 60 11.0 61 6.0 62 4.0 63 4.0 64 4.5 65 3.5 66 2.5 67 1.5 68 0.0 69 0.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.01 20-24 0.01 25-29 0.03 30-34 0.03 35-39 0.015 40-44 0.045 45-49 0.025 50-54 0.03 55-59 0.0 60-64 0.02 65-69 0.025 70-74 0.01 75-79 0.02 80-84 0.04 85-89 0.005 90-94 0.02 95-99 0.034999999999999996 100-104 0.005 105-109 0.034999999999999996 110-114 0.03 115-119 0.03 120-124 0.015 125-129 0.025 130-134 0.08 135-139 0.04 140-144 0.04 145-149 0.06 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862151 spots for SRR7169056.sra Written 862151 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra Read 862133 spots for SRR7169056.sra Written 862133 spots for SRR7169056.sra SRR ids: ['SRR7169056.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xhqryr3x SRR7169056.sra spots: 17242678 blocks: [[1, 862133], [862134, 1724266], [1724267, 2586399], [2586400, 3448532], [3448533, 4310665], [4310666, 5172798], [5172799, 6034931], [6034932, 6897064], [6897065, 7759197], [7759198, 8621330], [8621331, 9483463], [9483464, 10345596], [10345597, 11207729], [11207730, 12069862], [12069863, 12931995], [12931996, 13794128], [13794129, 14656261], [14656262, 15518394], [15518395, 16380527], [16380528, 17242678]] SRR7169056 file size 5821277 SRR7169056 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169056 SRR7169056_1.fastq SRR7169056_2.fastq Input file: SRR7169056_1.fastq Paired file: SRR7169056_2.fastq trimmed: SRR7169056-trimmed-pair1.fastq, SRR7169056-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:36:38 2025 >> started Mon Feb 10 17:36:58 2025 >> done (19.835s) 17242678 read pairs processed; of these: 16017 ( 0.09%) short read pairs filtered out after trimming by size control 9847 ( 0.06%) empty read pairs filtered out after trimming by size control 17216814 (99.85%) read pairs available; of these: 7880583 (45.77%) trimmed read pairs available after processing 9336231 (54.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 8 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 5 0.00% 27 8 0.00% 28 5 0.00% 29 5 0.00% 30 13 0.00% 31 4 0.00% 32 7 0.00% 33 9 0.00% 34 10 0.00% 35 6 0.00% 36 6 0.00% 37 19 0.00% 38 11 0.00% 39 7 0.00% 40 7 0.00% 41 13 0.00% 42 17 0.00% 43 13 0.00% 44 17 0.00% 45 21 0.00% 46 21 0.00% 47 24 0.00% 48 22 0.00% 49 33 0.00% 50 19 0.00% 51 28 0.00% 52 21 0.00% 53 28 0.00% 54 31 0.00% 55 44 0.00% 56 40 0.00% 57 48 0.00% 58 58 0.00% 59 67 0.00% 60 81 0.00% 61 92 0.00% 62 94 0.00% 63 116 0.00% 64 154 0.00% 65 139 0.00% 66 227 0.00% 67 214 0.00% 68 148 0.00% 69 205 0.00% 70 233 0.00% 71 258 0.00% 72 298 0.00% 73 305 0.00% 74 349 0.00% 75 318 0.00% 76 352 0.00% 77 491 0.00% 78 476 0.00% 79 543 0.00% 80 610 0.00% 81 712 0.00% 82 843 0.00% 83 1032 0.01% 84 1795 0.01% 85 2221 0.01% 86 2378 0.01% 87 2462 0.01% 88 2532 0.01% 89 2450 0.01% 90 2666 0.02% 91 2792 0.02% 92 2930 0.02% 93 2993 0.02% 94 3228 0.02% 95 3327 0.02% 96 3709 0.02% 97 3887 0.02% 98 4002 0.02% 99 4414 0.03% 100 4587 0.03% 101 4912 0.03% 102 5155 0.03% 103 5687 0.03% 104 6016 0.03% 105 6411 0.04% 106 6775 0.04% 107 7437 0.04% 108 7605 0.04% 109 8220 0.05% 110 8696 0.05% 111 9255 0.05% 112 9766 0.06% 113 10625 0.06% 114 11335 0.07% 115 11904 0.07% 116 12783 0.07% 117 13639 0.08% 118 14498 0.08% 119 15279 0.09% 120 16285 0.09% 121 16934 0.10% 122 18020 0.10% 123 19465 0.11% 124 20685 0.12% 125 22347 0.13% 126 24098 0.14% 127 26101 0.15% 128 27900 0.16% 129 29706 0.17% 130 31988 0.19% 131 34523 0.20% 132 37137 0.22% 133 40882 0.24% 134 44614 0.26% 135 48689 0.28% 136 53231 0.31% 137 58650 0.34% 138 65455 0.38% 139 72493 0.42% 140 80396 0.47% 141 91448 0.53% 142 106968 0.62% 143 119829 0.70% 144 144868 0.84% 145 181421 1.05% 146 234752 1.36% 147 317872 1.85% 148 484204 2.81% 149 964185 5.60% 150 4208055 24.44% 151 9336231 54.23% 17216814 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=31 prefix-density=0.21 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=50.47 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=10.7 sequence=CACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=18.63 fanout-score-rank=6 prefix-density=0.48 prefix-fanout=7.8 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=39 fanout-score=45.89 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=10.7 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169056 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:37:42 Started mapping on | Feb 10 17:37:42 Finished on | Feb 10 17:39:26 Mapping speed, Million of reads per hour | 595.97 Number of input reads | 17216814 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16171003 Uniquely mapped reads % | 93.93% Average mapped length | 296.81 Number of splices: Total | 15390131 Number of splices: Annotated (sjdb) | 15145182 Number of splices: GT/AG | 15176597 Number of splices: GC/AG | 171302 Number of splices: AT/AC | 11766 Number of splices: Non-canonical | 30466 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284424 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 39917 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 779198 779198 779198 N_multimapping 284424 284424 284424 N_noFeature 287300 15966371 370044 N_ambiguous 192010 1012 69414 UnstrandedReadsAssigned:15691693 PositiveStrandReadsAssigned:203620 NegativeStrandReadsAssigned:15731545 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169056 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169056-trimmed-pair1.fastq SRR7169056-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,216,814 reads, 15,626,263 reads pseudoaligned [quant] estimated average fragment length: 275.816 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR7169056.ke.tsv 34699 SRR7169056.se.tsv 87100 total ==> SRR7169056.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.18 362 12.0711 Potri.005G024800.1.v4.1 1035 760.184 35 2.67628 Potri.004G059700.1.v4.1 961 686.212 1 0.0847079 Potri.007G009000.2.v4.1 1416 1141.18 0 0 Potri.003G141000.2.v4.1 2943 2668.18 261.032 5.6867 Potri.016G087400.1.v4.1 270 59.9407 1408.52 1365.91 Potri.015G069301.1.v4.1 564 294.567 0 0 Potri.010G195200.1.v4.1 1773 1498.18 22 0.853571 Potri.012G127500.1.v4.1 977 702.184 3814 315.727 ==> SRR7169056.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1643 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169056 completed mapping pipeline successfully