Starting /dee2/code/volunteer_pipeline.sh SRR7169057 current disk space = 3058012561408 free memory = 1215311564 SRR7169057 SRAfilesize afcca878992f0543d589dc566fa6c78d SRR7169057.sra SRR7169057.sra file validated SRR7169057 is paired end SRR7169057 is conventional basespace SRR7169057 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169057_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0475 34.0 33.0 34.0 33.0 34.0 2 33.34125 34.0 34.0 34.0 33.0 34.0 3 33.36 34.0 34.0 34.0 33.0 34.0 4 33.42125 34.0 34.0 34.0 33.0 34.0 5 33.39725 34.0 34.0 34.0 33.0 34.0 6 36.83225 38.0 37.0 38.0 35.0 38.0 7 37.19275 38.0 38.0 38.0 36.0 38.0 8 37.26325 38.0 38.0 38.0 37.0 38.0 9 37.34325 38.0 38.0 38.0 37.0 38.0 10-14 37.3486 38.0 38.0 38.0 37.0 38.0 15-19 37.3281 38.0 38.0 38.0 37.0 38.0 20-24 37.310900000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.213350000000005 38.0 38.0 38.0 36.4 38.0 30-34 37.19495 38.0 38.0 38.0 36.0 38.0 35-39 37.02910000000001 38.0 38.0 38.0 35.8 38.0 40-44 36.59 38.0 38.0 38.0 34.2 38.0 45-49 36.3923 38.0 37.6 38.0 33.8 38.0 50-54 36.35555 38.0 37.0 38.0 33.6 38.0 55-59 36.24225 38.0 37.0 38.0 33.0 38.0 60-64 36.1036 38.0 37.0 38.0 33.0 38.0 65-69 36.026149999999994 38.0 37.0 38.0 32.2 38.0 70-74 35.86215 38.0 36.8 38.0 31.0 38.0 75-79 35.77610000000001 38.0 36.6 38.0 31.0 38.0 80-84 35.654399999999995 38.0 36.4 38.0 29.8 38.0 85-89 35.2958 38.0 36.0 38.0 29.0 38.0 90-94 35.146300000000004 38.0 36.0 38.0 28.2 38.0 95-99 35.12885 38.0 35.8 38.0 28.4 38.0 100-104 34.838649999999994 38.0 35.2 38.0 27.0 38.0 105-109 34.661500000000004 38.0 35.2 38.0 26.4 38.0 110-114 34.138999999999996 38.0 34.0 38.0 23.6 38.0 115-119 33.898 38.0 34.0 38.0 23.0 38.0 120-124 33.359500000000004 37.8 34.0 38.0 15.0 38.0 125-129 33.02445 37.8 33.2 38.0 15.0 38.0 130-134 32.56235 37.2 32.6 38.0 15.0 38.0 135-139 31.77015 36.6 31.0 38.0 14.2 38.0 140-144 31.26955 36.0 31.0 38.0 13.8 38.0 145-149 30.299500000000002 36.0 29.8 38.0 6.4 38.0 150-151 25.980874999999997 33.5 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 2.0 15 1.0 16 1.0 17 7.0 18 11.0 19 6.0 20 14.0 21 21.0 22 19.0 23 27.0 24 31.0 25 26.0 26 51.0 27 40.0 28 54.0 29 68.0 30 61.0 31 110.0 32 132.0 33 188.0 34 261.0 35 510.0 36 1036.0 37 1319.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.427307206068264 14.892541087231354 9.709228824273072 32.9709228824273 2 22.400000000000002 16.425 32.775 28.4 3 19.825 21.7 27.85 30.625000000000004 4 21.175 27.975 24.4 26.450000000000003 5 21.975 33.800000000000004 23.075000000000003 21.15 6 20.724999999999998 33.650000000000006 25.525 20.1 7 15.725 25.575 40.2 18.5 8 19.2 26.05 29.775000000000002 24.975 9 17.349999999999998 24.925 34.2 23.525 10-14 20.29 29.409999999999997 27.075 23.225 15-19 19.86 28.405 27.77 23.965 20-24 20.07 28.110000000000003 28.08 23.74 25-29 19.53 29.07 27.47 23.93 30-34 19.715 28.645 27.855 23.785 35-39 20.025000000000002 28.54 27.74 23.695 40-44 19.915 28.355000000000004 27.400000000000002 24.33 45-49 19.66 28.165000000000003 27.810000000000002 24.365000000000002 50-54 20.24 27.755000000000003 27.639999999999997 24.365000000000002 55-59 20.18 28.42 27.134999999999998 24.265 60-64 20.165 28.58 27.41 23.845 65-69 20.13 27.91 27.665 24.295 70-74 20.23 28.63 27.73 23.41 75-79 20.555 28.050000000000004 27.805000000000003 23.59 80-84 20.73 28.215 27.71 23.345 85-89 20.645 28.235 27.77 23.35 90-94 20.845 27.715 27.61 23.830000000000002 95-99 20.580000000000002 27.16 27.779999999999998 24.48 100-104 20.925 28.389999999999997 27.045 23.64 105-109 20.66 27.534999999999997 27.675 24.13 110-114 20.8 28.1 27.544999999999998 23.555 115-119 20.845 27.455000000000002 27.63 24.07 120-124 20.48 27.310000000000002 28.005000000000003 24.205 125-129 21.015 27.389999999999997 27.839999999999996 23.755000000000003 130-134 21.195 27.235 27.255000000000003 24.315 135-139 21.099999999999998 27.555000000000003 27.6 23.745 140-144 20.66 27.689999999999998 27.755000000000003 23.895 145-149 20.57 27.88 27.18 24.37 150-151 21.212500000000002 28.4 26.950000000000003 23.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 3.5 25 5.0 26 5.5 27 6.5 28 10.5 29 13.5 30 19.0 31 27.5 32 31.5 33 39.0 34 48.0 35 68.0 36 90.0 37 104.0 38 119.5 39 141.0 40 176.0 41 196.0 42 229.0 43 270.5 44 274.0 45 256.0 46 249.5 47 262.5 48 259.5 49 218.5 50 178.0 51 152.5 52 124.0 53 102.5 54 77.0 55 57.0 56 41.5 57 31.0 58 29.0 59 19.0 60 10.0 61 8.0 62 9.5 63 8.0 64 4.0 65 3.5 66 5.0 67 3.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3625 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.7875000000000001 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.2374999999999998 0.0 0.0 0.0 0.0 138-139 1.3624999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169057 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169057_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.607 33.0 33.0 34.0 32.0 34.0 2 32.6345 34.0 33.0 34.0 32.0 34.0 3 32.6515 34.0 33.0 34.0 32.0 34.0 4 32.5835 34.0 33.0 34.0 32.0 34.0 5 32.572 34.0 33.0 34.0 32.0 34.0 6 36.6335 38.0 38.0 38.0 36.0 38.0 7 36.63025 38.0 38.0 38.0 36.0 38.0 8 36.59575 38.0 38.0 38.0 36.0 38.0 9 36.6665 38.0 38.0 38.0 36.0 38.0 10-14 36.638850000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.59949999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.543850000000006 38.0 38.0 38.0 36.0 38.0 25-29 36.49885 38.0 38.0 38.0 36.0 38.0 30-34 36.5038 38.0 38.0 38.0 36.0 38.0 35-39 36.404849999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.3437 38.0 38.0 38.0 35.4 38.0 45-49 36.256150000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.3327 38.0 38.0 38.0 35.4 38.0 55-59 36.2076 38.0 38.0 38.0 34.8 38.0 60-64 36.1726 38.0 38.0 38.0 34.8 38.0 65-69 36.0404 38.0 38.0 38.0 34.2 38.0 70-74 35.96025 38.0 38.0 38.0 34.0 38.0 75-79 35.8635 38.0 38.0 38.0 33.8 38.0 80-84 35.9695 38.0 38.0 38.0 34.0 38.0 85-89 35.8694 38.0 38.0 38.0 33.6 38.0 90-94 35.8114 38.0 38.0 38.0 33.6 38.0 95-99 35.57445 38.0 38.0 38.0 32.0 38.0 100-104 35.424949999999995 38.0 38.0 38.0 31.2 38.0 105-109 35.374900000000004 38.0 38.0 38.0 31.8 38.0 110-114 35.2216 38.0 37.4 38.0 30.2 38.0 115-119 35.0627 38.0 37.0 38.0 28.6 38.0 120-124 34.81735 38.0 36.6 38.0 27.4 38.0 125-129 34.64640000000001 38.0 36.2 38.0 27.2 38.0 130-134 34.2847 38.0 35.8 38.0 24.2 38.0 135-139 34.02245 38.0 35.2 38.0 22.2 38.0 140-144 33.740050000000004 38.0 35.0 38.0 20.2 38.0 145-149 32.918600000000005 38.0 35.0 38.0 11.4 38.0 150-151 29.28125 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 16.0 4 12.0 5 5.0 6 8.0 7 8.0 8 5.0 9 4.0 10 1.0 11 2.0 12 4.0 13 3.0 14 5.0 15 8.0 16 1.0 17 7.0 18 8.0 19 7.0 20 7.0 21 10.0 22 10.0 23 17.0 24 12.0 25 12.0 26 22.0 27 34.0 28 30.0 29 42.0 30 43.0 31 56.0 32 79.0 33 97.0 34 112.0 35 174.0 36 451.0 37 2661.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.475 23.1 13.875000000000002 23.549999999999997 2 28.65 27.900000000000002 26.625 16.825000000000003 3 20.8 30.775000000000002 29.925 18.5 4 23.175 34.275 23.549999999999997 19.0 5 25.7 35.275 21.95 17.075000000000003 6 21.85 36.475 23.025000000000002 18.65 7 20.3 22.7 37.75 19.25 8 23.200000000000003 26.0 25.674999999999997 25.124999999999996 9 20.849999999999998 26.875 27.975 24.3 10-14 23.43 29.78 25.455 21.335 15-19 23.01 28.38 27.575 21.035 20-24 23.3 27.87 27.605 21.224999999999998 25-29 23.5 28.249999999999996 27.525 20.724999999999998 30-34 23.494999999999997 28.884999999999998 26.43 21.19 35-39 24.09 27.994999999999997 26.77 21.145 40-44 23.925 27.965 26.715 21.395 45-49 23.575 27.815 27.215 21.395 50-54 23.605 28.46 26.52 21.415 55-59 24.19 27.060000000000002 27.62 21.13 60-64 23.685000000000002 27.98 27.279999999999998 21.055 65-69 24.202927611790656 28.13815921395629 26.709444555845195 20.94946861840786 70-74 23.873331325905852 27.58205359831376 27.1655123958647 21.379102679915686 75-79 23.703480790450396 28.1974119771291 27.154177951650116 20.94492928077039 80-84 23.617361736173617 27.847784778477845 27.137713771377136 21.3971397139714 85-89 24.29 27.279999999999998 27.61 20.82 90-94 23.265 27.805000000000003 27.52 21.41 95-99 24.16 27.865000000000002 27.11 20.865000000000002 100-104 24.5 27.505000000000003 27.21 20.785 105-109 24.41 27.345000000000002 27.425 20.82 110-114 23.78 27.73 27.439999999999998 21.05 115-119 24.104999999999997 28.294999999999998 27.555000000000003 20.044999999999998 120-124 24.455 27.425 27.195000000000004 20.925 125-129 24.16 27.994999999999997 27.0 20.845 130-134 23.45 28.125 27.175 21.25 135-139 23.95218565569671 27.7333199959988 27.663298989696912 20.651195358607584 140-144 24.130162703379224 27.819774718397998 27.499374217772214 20.550688360450565 145-149 24.18487817131374 27.57598593318262 27.58603365988445 20.65310223561919 150-151 25.085001888930865 28.38433446669185 26.45762498425891 20.07303866011837 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.0 24 2.5 25 3.5 26 3.0 27 3.0 28 3.0 29 4.0 30 4.5 31 10.5 32 17.0 33 23.0 34 32.5 35 46.5 36 63.5 37 79.5 38 109.5 39 150.0 40 178.0 41 206.5 42 261.0 43 290.0 44 278.5 45 285.0 46 292.0 47 292.0 48 274.0 49 226.0 50 177.5 51 148.5 52 132.0 53 105.0 54 77.0 55 54.0 56 38.0 57 30.0 58 22.0 59 15.5 60 13.0 61 10.5 62 8.0 63 7.5 64 7.5 65 4.5 66 1.0 67 0.5 68 1.0 69 0.5 70 1.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.26 70-74 0.37 75-79 0.31 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.03 140-144 0.125 145-149 0.475 150-151 0.7374999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3625 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.675 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.85 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.2625000000000002 0.0 0.0 0.0 0.0 138-139 1.3875000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769449 spots for SRR7169057.sra Written 769449 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra Read 769441 spots for SRR7169057.sra Written 769441 spots for SRR7169057.sra SRR ids: ['SRR7169057.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4vt3eqnl SRR7169057.sra spots: 15388828 blocks: [[1, 769441], [769442, 1538882], [1538883, 2308323], [2308324, 3077764], [3077765, 3847205], [3847206, 4616646], [4616647, 5386087], [5386088, 6155528], [6155529, 6924969], [6924970, 7694410], [7694411, 8463851], [8463852, 9233292], [9233293, 10002733], [10002734, 10772174], [10772175, 11541615], [11541616, 12311056], [12311057, 13080497], [13080498, 13849938], [13849939, 14619379], [14619380, 15388828]] SRR7169057 file size 5193068 SRR7169057 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169057 SRR7169057_1.fastq SRR7169057_2.fastq Input file: SRR7169057_1.fastq Paired file: SRR7169057_2.fastq trimmed: SRR7169057-trimmed-pair1.fastq, SRR7169057-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:42:51 2025 >> started Mon Feb 10 17:43:19 2025 >> done (27.193s) 15388828 read pairs processed; of these: 36487 ( 0.24%) short read pairs filtered out after trimming by size control 25149 ( 0.16%) empty read pairs filtered out after trimming by size control 15327192 (99.60%) read pairs available; of these: 7656858 (49.96%) trimmed read pairs available after processing 7670334 (50.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 8 0.00% 21 8 0.00% 22 9 0.00% 23 10 0.00% 24 9 0.00% 25 6 0.00% 26 8 0.00% 27 11 0.00% 28 8 0.00% 29 9 0.00% 30 12 0.00% 31 15 0.00% 32 13 0.00% 33 17 0.00% 34 17 0.00% 35 15 0.00% 36 14 0.00% 37 20 0.00% 38 23 0.00% 39 25 0.00% 40 20 0.00% 41 21 0.00% 42 27 0.00% 43 27 0.00% 44 32 0.00% 45 30 0.00% 46 31 0.00% 47 46 0.00% 48 52 0.00% 49 51 0.00% 50 64 0.00% 51 48 0.00% 52 60 0.00% 53 58 0.00% 54 84 0.00% 55 85 0.00% 56 88 0.00% 57 98 0.00% 58 117 0.00% 59 101 0.00% 60 126 0.00% 61 139 0.00% 62 136 0.00% 63 158 0.00% 64 182 0.00% 65 184 0.00% 66 193 0.00% 67 225 0.00% 68 232 0.00% 69 275 0.00% 70 291 0.00% 71 355 0.00% 72 339 0.00% 73 414 0.00% 74 455 0.00% 75 464 0.00% 76 584 0.00% 77 630 0.00% 78 662 0.00% 79 751 0.00% 80 802 0.01% 81 984 0.01% 82 1129 0.01% 83 1330 0.01% 84 2883 0.02% 85 3597 0.02% 86 3531 0.02% 87 3717 0.02% 88 3645 0.02% 89 3610 0.02% 90 3672 0.02% 91 3889 0.03% 92 4089 0.03% 93 4168 0.03% 94 4486 0.03% 95 4780 0.03% 96 4839 0.03% 97 5201 0.03% 98 5498 0.04% 99 5745 0.04% 100 6017 0.04% 101 6416 0.04% 102 6642 0.04% 103 7331 0.05% 104 7564 0.05% 105 8076 0.05% 106 8464 0.06% 107 8938 0.06% 108 9409 0.06% 109 9977 0.07% 110 10507 0.07% 111 11390 0.07% 112 11840 0.08% 113 13015 0.08% 114 13701 0.09% 115 14276 0.09% 116 15291 0.10% 117 15969 0.10% 118 17216 0.11% 119 17891 0.12% 120 18962 0.12% 121 19888 0.13% 122 21565 0.14% 123 22894 0.15% 124 24315 0.16% 125 25949 0.17% 126 27876 0.18% 127 29334 0.19% 128 31602 0.21% 129 33465 0.22% 130 36314 0.24% 131 38984 0.25% 132 41998 0.27% 133 45240 0.30% 134 48679 0.32% 135 52806 0.34% 136 58434 0.38% 137 64243 0.42% 138 71420 0.47% 139 79654 0.52% 140 87386 0.57% 141 95923 0.63% 142 109113 0.71% 143 126515 0.83% 144 149265 0.97% 145 182786 1.19% 146 235267 1.53% 147 323871 2.11% 148 504471 3.29% 149 966814 6.31% 150 3782095 24.68% 151 7670334 50.04% 15327192 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.3 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=238.58 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=19.1 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=31 prefix-density=0.23 prefix-fanout=2.9 sequence=CTTGCCACCAAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=34 fanout-score=37.68 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=11.3 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCA SRR7169057 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:44:18 Started mapping on | Feb 10 17:44:18 Finished on | Feb 10 17:46:33 Mapping speed, Million of reads per hour | 408.73 Number of input reads | 15327192 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14019281 Uniquely mapped reads % | 91.47% Average mapped length | 295.76 Number of splices: Total | 12664631 Number of splices: Annotated (sjdb) | 12440551 Number of splices: GT/AG | 12482300 Number of splices: GC/AG | 144785 Number of splices: AT/AC | 10310 Number of splices: Non-canonical | 27236 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270688 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 24760 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.57% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1068349 1068349 1068349 N_multimapping 270688 270688 270688 N_noFeature 295593 13833128 371480 N_ambiguous 169839 1170 58698 UnstrandedReadsAssigned:13553849 PositiveStrandReadsAssigned:184983 NegativeStrandReadsAssigned:13589103 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169057 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169057-trimmed-pair1.fastq SRR7169057-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,327,192 reads, 13,548,736 reads pseudoaligned [quant] estimated average fragment length: 271.979 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7169057.ke.tsv 34699 SRR7169057.se.tsv 87100 total ==> SRR7169057.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.02 255 9.70633 Potri.005G024800.1.v4.1 1035 764.021 32 2.78521 Potri.004G059700.1.v4.1 961 690.052 0 0 Potri.007G009000.2.v4.1 1416 1145.02 0 0 Potri.003G141000.2.v4.1 2943 2672.02 236 5.87334 Potri.016G087400.1.v4.1 270 61.4616 1178 1274.54 Potri.015G069301.1.v4.1 564 298.661 0 0 Potri.010G195200.1.v4.1 1773 1502.02 44 1.948 Potri.012G127500.1.v4.1 977 706.034 5946 560.031 ==> SRR7169057.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2537 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 333 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7169057 completed mapping pipeline successfully