Starting /dee2/code/volunteer_pipeline.sh SRR7169058 current disk space = 3057663635456 free memory = 1504552352 SRR7169058 SRAfilesize ff965ef4b6cb2ce358d001ff0ca758d3 SRR7169058.sra SRR7169058.sra file validated SRR7169058 is paired end SRR7169058 is conventional basespace SRR7169058 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169058_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0485 34.0 33.0 34.0 32.0 34.0 2 33.26675 34.0 33.0 34.0 32.0 34.0 3 33.3675 34.0 33.0 34.0 32.0 34.0 4 33.48325 34.0 34.0 34.0 33.0 34.0 5 33.39825 34.0 33.0 34.0 33.0 34.0 6 37.24775 38.0 37.0 38.0 36.0 38.0 7 35.79875 38.0 37.0 38.0 31.0 38.0 8 36.4775 38.0 37.0 38.0 34.0 38.0 9 37.33625 38.0 38.0 38.0 36.0 38.0 10-14 37.440749999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.1625 38.0 38.0 38.0 36.2 38.0 20-24 37.43835 38.0 38.0 38.0 37.0 38.0 25-29 37.3404 38.0 38.0 38.0 37.0 38.0 30-34 37.3193 38.0 38.0 38.0 37.0 38.0 35-39 37.3919 38.0 38.0 38.0 37.0 38.0 40-44 36.81345 38.0 37.8 38.0 35.0 38.0 45-49 36.83015 38.0 38.0 38.0 34.8 38.0 50-54 36.49040000000001 38.0 37.6 38.0 33.8 38.0 55-59 36.43599999999999 38.0 37.6 38.0 33.4 38.0 60-64 36.591899999999995 38.0 37.8 38.0 33.8 38.0 65-69 36.4413 38.0 37.4 38.0 33.8 38.0 70-74 36.187349999999995 38.0 37.0 38.0 33.2 38.0 75-79 36.366949999999996 38.0 37.2 38.0 34.0 38.0 80-84 36.26865 38.0 37.0 38.0 33.4 38.0 85-89 35.99135 38.0 37.0 38.0 32.4 38.0 90-94 35.8215 38.0 36.8 38.0 31.2 38.0 95-99 35.74825 38.0 36.6 38.0 31.0 38.0 100-104 35.1509 38.0 35.8 38.0 28.2 38.0 105-109 34.61065000000001 38.0 34.8 38.0 25.6 38.0 110-114 34.686 38.0 34.8 38.0 26.4 38.0 115-119 34.79325 38.0 35.0 38.0 27.6 38.0 120-124 34.279199999999996 38.0 34.2 38.0 24.0 38.0 125-129 33.720949999999995 38.0 34.0 38.0 21.8 38.0 130-134 33.6295 38.0 33.6 38.0 22.2 38.0 135-139 33.1656 37.6 32.6 38.0 19.4 38.0 140-144 31.990000000000002 36.2 31.4 38.0 13.8 38.0 145-149 30.5973 36.0 30.4 38.0 8.6 38.0 150-151 25.725125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 1.0 13 0.0 14 3.0 15 1.0 16 3.0 17 2.0 18 4.0 19 5.0 20 10.0 21 5.0 22 7.0 23 6.0 24 14.0 25 16.0 26 31.0 27 43.0 28 41.0 29 58.0 30 72.0 31 94.0 32 122.0 33 188.0 34 300.0 35 487.0 36 1112.0 37 1373.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.298796441653586 11.669283097854526 11.459968602825747 37.57195185766614 2 23.325000000000003 13.950000000000001 32.2 30.525000000000002 3 21.0 17.7 24.425 36.875 4 22.025 23.875 24.125 29.975 5 23.549999999999997 29.975 23.724999999999998 22.75 6 21.25 33.0 23.95 21.8 7 15.0 27.575 39.725 17.7 8 18.175 27.875 29.625 24.325 9 17.224999999999998 24.15 34.275 24.349999999999998 10-14 19.665 29.315 27.47 23.549999999999997 15-19 19.64 28.985 26.939999999999998 24.435000000000002 20-24 19.86595978793638 28.50855256576973 27.448234470341106 24.17725317595279 25-29 19.785 29.15 27.474999999999998 23.59 30-34 19.640892267680304 28.698609582874862 27.263178953686108 24.397319195758726 35-39 19.536837893262643 28.925123793327668 27.73970889811434 23.798329415295353 40-44 19.716830098058836 28.5671402841705 27.256353812287372 24.45967580548329 45-49 20.26 28.32 26.83 24.59 50-54 20.502050205020502 28.20782078207821 27.457745774577457 23.832383238323832 55-59 19.63 28.244999999999997 27.525 24.6 60-64 19.926992699269928 27.952795279527955 27.88278827882788 24.237423742374236 65-69 19.78 28.945 27.455000000000002 23.82 70-74 20.044008801760352 28.710742148429684 26.54530906181236 24.6999399879976 75-79 20.665 28.325 27.05 23.96 80-84 20.044999999999998 28.13 27.034999999999997 24.79 85-89 20.043006450967646 28.249237385607838 27.189078361754266 24.51867780167025 90-94 20.41214425048767 27.794728154854198 27.274546091131896 24.518581503526235 95-99 20.19 27.82 27.73 24.26 100-104 20.645 27.735 27.589999999999996 24.03 105-109 20.25 28.415000000000003 27.37 23.965 110-114 20.94 27.87 27.71 23.48 115-119 20.125 28.110000000000003 27.63 24.135 120-124 20.95 27.595 27.73 23.724999999999998 125-129 20.775 27.169999999999998 27.395000000000003 24.66 130-134 20.785 27.810000000000002 27.79 23.615 135-139 20.85855806274078 27.46785410516836 27.662980937609444 24.010606894481413 140-144 20.707070707070706 27.872787278727873 27.147714771477148 24.272427242724273 145-149 20.715357678839418 27.78389194597299 26.97848924462231 24.522261130565283 150-151 20.625 27.5125 27.325 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 1.0 22 2.0 23 3.5 24 3.5 25 2.5 26 2.5 27 7.5 28 9.5 29 10.5 30 16.0 31 20.5 32 29.5 33 33.0 34 40.5 35 57.0 36 75.5 37 98.0 38 123.5 39 141.5 40 170.5 41 201.5 42 222.5 43 263.5 44 266.5 45 257.5 46 262.5 47 257.5 48 249.0 49 223.5 50 197.0 51 163.5 52 125.0 53 114.0 54 99.0 55 64.5 56 43.0 57 33.0 58 23.0 59 17.0 60 14.5 61 8.5 62 8.5 63 7.5 64 3.5 65 4.0 66 3.5 67 2.5 68 3.0 69 2.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.0 30-34 0.03 35-39 0.034999999999999996 40-44 0.06 45-49 0.0 50-54 0.01 55-59 0.0 60-64 0.01 65-69 0.0 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.015 90-94 0.034999999999999996 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.065 140-144 0.01 145-149 0.05 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0125 0.0 0.0 0.0 0.0 104-105 0.07500000000000001 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.3125 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.4125 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.65 0.0 0.0 0.0 0.0 134-135 0.725 0.0 0.0 0.0 0.0 136-137 0.8125 0.0 0.0 0.0 0.0 138-139 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169058 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169058_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07625 33.0 33.0 34.0 32.0 34.0 2 33.20025 34.0 33.0 34.0 33.0 34.0 3 33.14175 34.0 33.0 34.0 33.0 34.0 4 33.1185 34.0 33.0 34.0 33.0 34.0 5 33.11575 34.0 33.0 34.0 33.0 34.0 6 37.29875 38.0 38.0 38.0 37.0 38.0 7 37.298 38.0 38.0 38.0 37.0 38.0 8 36.718 38.0 38.0 38.0 35.0 38.0 9 37.183 38.0 38.0 38.0 37.0 38.0 10-14 37.199299999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.2208 38.0 38.0 38.0 37.0 38.0 20-24 37.1836 38.0 38.0 38.0 37.0 38.0 25-29 37.240849999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.2474 38.0 38.0 38.0 37.0 38.0 35-39 37.0262 38.0 38.0 38.0 36.4 38.0 40-44 37.0289 38.0 38.0 38.0 36.4 38.0 45-49 37.1633 38.0 38.0 38.0 36.8 38.0 50-54 37.1514 38.0 38.0 38.0 36.8 38.0 55-59 37.033649999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.9521 38.0 38.0 38.0 36.0 38.0 65-69 36.9005 38.0 38.0 38.0 35.8 38.0 70-74 36.814499999999995 38.0 38.0 38.0 35.6 38.0 75-79 36.651599999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.56345 38.0 38.0 38.0 34.6 38.0 85-89 36.282050000000005 38.0 38.0 38.0 33.8 38.0 90-94 36.39790000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.4184 38.0 38.0 38.0 34.0 38.0 100-104 36.3327 38.0 38.0 38.0 34.0 38.0 105-109 36.1325 38.0 37.8 38.0 33.2 38.0 110-114 35.7744 38.0 37.0 38.0 31.6 38.0 115-119 35.52325 38.0 36.8 38.0 30.0 38.0 120-124 35.609 38.0 37.0 38.0 31.4 38.0 125-129 35.06855 38.0 35.6 38.0 28.2 38.0 130-134 34.6711 38.0 35.0 38.0 26.0 38.0 135-139 34.329299999999996 38.0 35.0 38.0 24.2 38.0 140-144 34.15745 38.0 34.2 38.0 24.4 38.0 145-149 33.11285 38.0 33.4 38.0 16.6 38.0 150-151 29.205624999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 2.0 13 3.0 14 3.0 15 3.0 16 2.0 17 1.0 18 3.0 19 7.0 20 2.0 21 7.0 22 7.0 23 10.0 24 12.0 25 20.0 26 15.0 27 28.0 28 39.0 29 50.0 30 39.0 31 59.0 32 98.0 33 120.0 34 148.0 35 236.0 36 582.0 37 2495.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.23330832708177 21.980495123780948 17.5293823455864 27.25681420355089 2 27.231807951987996 26.481620405101275 29.332333083270818 16.954238559639908 3 21.775 27.725 30.425 20.075000000000003 4 24.25 33.4 22.475 19.875 5 24.775 35.65 21.725 17.849999999999998 6 21.05 37.525 22.900000000000002 18.525 7 20.200000000000003 22.650000000000002 36.449999999999996 20.7 8 23.0 25.35 27.35 24.3 9 23.025000000000002 24.95 29.2 22.825 10-14 23.515 29.225 25.89 21.37 15-19 23.71 28.26 26.865 21.165 20-24 23.095 28.565 26.85 21.490000000000002 25-29 23.04 28.970000000000002 26.86 21.13 30-34 23.84 28.199999999999996 26.955000000000002 21.005 35-39 23.075000000000003 28.51 27.134999999999998 21.279999999999998 40-44 23.145 28.225 27.215 21.415 45-49 23.47 28.749999999999996 26.76 21.02 50-54 23.845 27.675 27.200000000000003 21.279999999999998 55-59 23.36 28.325 27.334999999999997 20.979999999999997 60-64 23.685000000000002 28.34 27.145000000000003 20.830000000000002 65-69 24.13 27.744999999999997 27.400000000000002 20.724999999999998 70-74 23.875 27.595 27.389999999999997 21.14 75-79 23.7 27.965 27.445000000000004 20.89 80-84 23.845 28.410000000000004 27.065 20.68 85-89 24.14 27.950000000000003 27.395000000000003 20.515 90-94 23.630000000000003 27.810000000000002 27.775 20.785 95-99 23.56 27.275 28.32 20.845 100-104 23.806190309515475 27.531376568828442 27.616380819040952 21.04605230261513 105-109 23.685000000000002 28.375 26.75 21.19 110-114 24.23 27.525 27.105 21.14 115-119 24.154999999999998 27.58 27.205000000000002 21.060000000000002 120-124 24.905 27.82 26.555 20.72 125-129 24.081020255063766 27.901975493873472 26.906726681670417 21.11027756939235 130-134 24.45 28.16 27.245 20.145 135-139 23.455000000000002 27.694999999999997 27.73 21.12 140-144 23.625 27.400000000000002 27.400000000000002 21.575 145-149 24.245 28.025 27.224999999999998 20.505000000000003 150-151 24.975 27.875 26.2125 20.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.5 26 3.5 27 2.5 28 4.0 29 3.5 30 8.0 31 14.0 32 17.5 33 21.5 34 26.0 35 40.0 36 63.5 37 88.0 38 117.5 39 158.5 40 200.5 41 240.0 42 248.0 43 267.5 44 302.0 45 308.0 46 298.0 47 278.0 48 255.5 49 215.0 50 178.0 51 140.5 52 114.5 53 106.5 54 79.0 55 54.0 56 37.5 57 25.5 58 21.0 59 10.5 60 9.5 61 11.0 62 5.5 63 5.0 64 3.5 65 1.0 66 2.0 67 2.5 68 2.5 69 2.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.025 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0125 0.0 0.0 0.0 0.0 104-105 0.07500000000000001 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.3375 0.0 0.0 0.0 0.0 126-127 0.3875 0.0 0.0 0.0 0.0 128-129 0.4125 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.65 0.0 0.0 0.0 0.0 134-135 0.7375 0.0 0.0 0.0 0.0 136-137 0.8374999999999999 0.0 0.0 0.0 0.0 138-139 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991313 spots for SRR7169058.sra Written 991313 spots for SRR7169058.sra Read 991322 spots for SRR7169058.sra Written 991322 spots for SRR7169058.sra SRR ids: ['SRR7169058.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5hm81yid SRR7169058.sra spots: 19826269 blocks: [[1, 991313], [991314, 1982626], [1982627, 2973939], [2973940, 3965252], [3965253, 4956565], [4956566, 5947878], [5947879, 6939191], [6939192, 7930504], [7930505, 8921817], [8921818, 9913130], [9913131, 10904443], [10904444, 11895756], [11895757, 12887069], [12887070, 13878382], [13878383, 14869695], [14869696, 15861008], [15861009, 16852321], [16852322, 17843634], [17843635, 18834947], [18834948, 19826269]] SRR7169058 file size 6696771 SRR7169058 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169058 SRR7169058_1.fastq SRR7169058_2.fastq Input file: SRR7169058_1.fastq Paired file: SRR7169058_2.fastq trimmed: SRR7169058-trimmed-pair1.fastq, SRR7169058-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:12:23 2025 >> started Mon Feb 10 18:12:43 2025 >> done (20.330s) 19826269 read pairs processed; of these: 15436 ( 0.08%) short read pairs filtered out after trimming by size control 12114 ( 0.06%) empty read pairs filtered out after trimming by size control 19798719 (99.86%) read pairs available; of these: 9388004 (47.42%) trimmed read pairs available after processing 10410715 (52.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 6 0.00% 23 4 0.00% 24 4 0.00% 25 4 0.00% 26 6 0.00% 27 4 0.00% 28 4 0.00% 29 7 0.00% 30 5 0.00% 31 8 0.00% 32 4 0.00% 33 4 0.00% 34 4 0.00% 35 8 0.00% 36 6 0.00% 37 8 0.00% 38 7 0.00% 39 5 0.00% 40 11 0.00% 41 12 0.00% 42 11 0.00% 43 9 0.00% 44 15 0.00% 45 28 0.00% 46 18 0.00% 47 26 0.00% 48 22 0.00% 49 24 0.00% 50 35 0.00% 51 22 0.00% 52 26 0.00% 53 33 0.00% 54 33 0.00% 55 36 0.00% 56 36 0.00% 57 50 0.00% 58 58 0.00% 59 50 0.00% 60 63 0.00% 61 68 0.00% 62 82 0.00% 63 72 0.00% 64 100 0.00% 65 105 0.00% 66 106 0.00% 67 110 0.00% 68 154 0.00% 69 166 0.00% 70 189 0.00% 71 194 0.00% 72 190 0.00% 73 230 0.00% 74 222 0.00% 75 247 0.00% 76 317 0.00% 77 314 0.00% 78 391 0.00% 79 403 0.00% 80 486 0.00% 81 575 0.00% 82 636 0.00% 83 737 0.00% 84 1434 0.01% 85 1909 0.01% 86 1976 0.01% 87 2325 0.01% 88 2457 0.01% 89 2443 0.01% 90 2409 0.01% 91 2673 0.01% 92 2792 0.01% 93 2869 0.01% 94 2939 0.01% 95 3070 0.02% 96 3331 0.02% 97 3653 0.02% 98 3815 0.02% 99 3994 0.02% 100 4265 0.02% 101 4519 0.02% 102 4849 0.02% 103 5177 0.03% 104 5655 0.03% 105 5749 0.03% 106 6471 0.03% 107 6701 0.03% 108 7327 0.04% 109 7884 0.04% 110 8343 0.04% 111 8746 0.04% 112 9503 0.05% 113 10144 0.05% 114 10439 0.05% 115 11613 0.06% 116 12064 0.06% 117 12924 0.07% 118 13752 0.07% 119 14383 0.07% 120 15344 0.08% 121 16344 0.08% 122 17490 0.09% 123 18664 0.09% 124 19941 0.10% 125 21838 0.11% 126 23843 0.12% 127 25347 0.13% 128 27057 0.14% 129 29620 0.15% 130 31877 0.16% 131 34571 0.17% 132 37338 0.19% 133 40284 0.20% 134 44511 0.22% 135 48498 0.24% 136 53581 0.27% 137 59820 0.30% 138 66133 0.33% 139 74496 0.38% 140 84253 0.43% 141 96225 0.49% 142 112752 0.57% 143 130329 0.66% 144 161065 0.81% 145 202478 1.02% 146 261755 1.32% 147 373020 1.88% 148 588610 2.97% 149 1172590 5.92% 150 5276914 26.65% 151 10410715 52.58% 19798719 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=36 prefix-density=0.20 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=217.13 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=26.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=43 prefix-density=0.30 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=280.28 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=28.4 sequence=AAGAAGAAGAAG SRR7169058 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:13:27 Started mapping on | Feb 10 18:13:27 Finished on | Feb 10 18:15:18 Mapping speed, Million of reads per hour | 642.12 Number of input reads | 19798719 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18635620 Uniquely mapped reads % | 94.13% Average mapped length | 297.36 Number of splices: Total | 18425549 Number of splices: Annotated (sjdb) | 18136700 Number of splices: GT/AG | 18161708 Number of splices: GC/AG | 213743 Number of splices: AT/AC | 14308 Number of splices: Non-canonical | 35790 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393138 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 20389 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 787659 787659 787659 N_multimapping 393138 393138 393138 N_noFeature 325825 18450046 402886 N_ambiguous 181585 938 72524 UnstrandedReadsAssigned:18128210 PositiveStrandReadsAssigned:184636 NegativeStrandReadsAssigned:18160210 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169058 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169058-trimmed-pair1.fastq SRR7169058-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,798,719 reads, 17,980,879 reads pseudoaligned [quant] estimated average fragment length: 284.953 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52401 SRR7169058.ke.tsv 34699 SRR7169058.se.tsv 87100 total ==> SRR7169058.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.05 311 8.24617 Potri.005G024800.1.v4.1 1035 751.047 46 2.81607 Potri.004G059700.1.v4.1 961 677.087 2 0.135812 Potri.007G009000.2.v4.1 1416 1132.05 0 0 Potri.003G141000.2.v4.1 2943 2659.05 319 5.51591 Potri.016G087400.1.v4.1 270 56.6607 2087 1693.53 Potri.015G069301.1.v4.1 564 286.58 0 0 Potri.010G195200.1.v4.1 1773 1489.05 8 0.247021 Potri.012G127500.1.v4.1 977 693.058 8319 551.892 ==> SRR7169058.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1154 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169058 completed mapping pipeline successfully