Starting /dee2/code/volunteer_pipeline.sh SRR7169059 current disk space = 3057792004096 free memory = 1155753020 SRR7169059 SRAfilesize dc23ca1c554f10af26b4eb502a3505fa SRR7169059.sra SRR7169059.sra file validated SRR7169059 is paired end SRR7169059 is conventional basespace SRR7169059 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169059_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6935 34.0 33.0 34.0 33.0 34.0 2 33.29425 34.0 33.0 34.0 33.0 34.0 3 33.29625 34.0 33.0 34.0 33.0 34.0 4 33.43775 34.0 33.0 34.0 33.0 34.0 5 33.4435 34.0 33.0 34.0 33.0 34.0 6 37.07725 38.0 37.0 38.0 36.0 38.0 7 37.35 38.0 38.0 38.0 37.0 38.0 8 37.415 38.0 38.0 38.0 37.0 38.0 9 37.49075 38.0 38.0 38.0 37.0 38.0 10-14 37.109950000000005 38.0 38.0 38.0 36.0 38.0 15-19 37.1046 38.0 38.0 38.0 36.2 38.0 20-24 37.299099999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.108200000000004 38.0 38.0 38.0 36.2 38.0 30-34 37.207 38.0 38.0 38.0 36.6 38.0 35-39 37.2063 38.0 38.0 38.0 36.4 38.0 40-44 36.999100000000006 38.0 38.0 38.0 35.8 38.0 45-49 36.807500000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.6846 38.0 38.0 38.0 34.4 38.0 55-59 36.25475 38.0 37.0 38.0 33.2 38.0 60-64 36.48745 38.0 37.8 38.0 34.0 38.0 65-69 36.312400000000004 38.0 37.2 38.0 33.0 38.0 70-74 36.1872 38.0 37.0 38.0 33.6 38.0 75-79 36.1372 38.0 37.0 38.0 32.8 38.0 80-84 36.1825 38.0 37.0 38.0 33.0 38.0 85-89 35.88029999999999 38.0 36.6 38.0 31.6 38.0 90-94 35.56595 38.0 36.6 38.0 29.8 38.0 95-99 35.6573 38.0 36.6 38.0 30.2 38.0 100-104 35.277300000000004 38.0 36.0 38.0 28.6 38.0 105-109 34.5061 38.0 35.0 38.0 24.0 38.0 110-114 34.78824999999999 38.0 35.2 38.0 26.4 38.0 115-119 34.87975 38.0 35.4 38.0 27.8 38.0 120-124 34.572500000000005 38.0 35.0 38.0 26.2 38.0 125-129 33.8435 38.0 34.0 38.0 22.6 38.0 130-134 34.046800000000005 38.0 34.2 38.0 23.2 38.0 135-139 33.492149999999995 38.0 34.0 38.0 20.2 38.0 140-144 32.5218 37.0 33.2 38.0 14.2 38.0 145-149 31.848399999999998 36.6 32.6 38.0 11.4 38.0 150-151 27.871875000000003 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 2.0 12 1.0 13 0.0 14 1.0 15 0.0 16 3.0 17 3.0 18 3.0 19 6.0 20 6.0 21 7.0 22 7.0 23 21.0 24 16.0 25 26.0 26 30.0 27 37.0 28 54.0 29 45.0 30 73.0 31 93.0 32 109.0 33 165.0 34 241.0 35 423.0 36 932.0 37 1693.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.248081841432224 12.250639386189258 8.823529411764707 35.67774936061381 2 22.45 16.2 33.825 27.525 3 18.525 20.1 27.85 33.525 4 22.025 28.175 23.9 25.900000000000002 5 22.85 32.7 24.075 20.375 6 19.900000000000002 35.05 25.324999999999996 19.725 7 16.0 27.250000000000004 39.900000000000006 16.85 8 18.35 27.0 29.75 24.9 9 18.05 23.575 34.525 23.849999999999998 10-14 20.22 29.470000000000002 27.35 22.96 15-19 20.165 29.054999999999996 27.42 23.36 20-24 20.0 29.154999999999998 27.33 23.515 25-29 20.375 28.9 27.284999999999997 23.44 30-34 19.73 29.125 27.91 23.235 35-39 19.73 28.59 27.644999999999996 24.035 40-44 19.925 29.385 27.500000000000004 23.189999999999998 45-49 20.565 28.365000000000002 27.41 23.66 50-54 20.200000000000003 28.854999999999997 27.450000000000003 23.494999999999997 55-59 20.349999999999998 28.455000000000002 27.435 23.76 60-64 19.875 29.075 27.075 23.974999999999998 65-69 20.369999999999997 28.595 27.305 23.73 70-74 20.337033703370334 28.492849284928496 27.16271627162716 24.007400740074008 75-79 20.48102405120256 28.436421821091056 27.38136906845342 23.701185059252964 80-84 20.669999999999998 28.57 27.150000000000002 23.61 85-89 20.825 28.515 27.155 23.505000000000003 90-94 20.705000000000002 27.935 27.515 23.845 95-99 20.244999999999997 27.950000000000003 28.075 23.73 100-104 19.935 28.28 27.465 24.32 105-109 20.419999999999998 28.035 27.63 23.915 110-114 20.441022051102557 28.021401070053503 27.86639331966598 23.67118355917796 115-119 20.536026801340068 28.16640832041602 27.51637581879094 23.781189059452974 120-124 20.93 28.03 27.415 23.625 125-129 20.718107716157423 27.65414812221833 27.704155623343503 23.923588538280743 130-134 21.02 27.650000000000002 27.639999999999997 23.69 135-139 20.855 28.175 27.04 23.93 140-144 20.205000000000002 28.425 27.534999999999997 23.835 145-149 20.935000000000002 27.865000000000002 27.615000000000002 23.585 150-151 20.625 28.599999999999998 26.7625 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.5 24 4.5 25 4.0 26 3.0 27 7.5 28 11.0 29 15.0 30 22.0 31 27.5 32 35.0 33 43.5 34 54.0 35 66.5 36 85.5 37 98.5 38 114.0 39 156.0 40 185.0 41 212.0 42 245.5 43 246.0 44 261.0 45 285.5 46 270.0 47 249.0 48 227.0 49 204.5 50 183.5 51 155.0 52 130.0 53 105.0 54 77.0 55 53.0 56 38.5 57 26.5 58 21.0 59 19.5 60 15.5 61 9.5 62 7.0 63 4.0 64 0.5 65 3.0 66 4.0 67 1.5 68 1.5 69 3.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.005 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.6875 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.8999999999999999 0.0 0.0 0.0 0.0 138-139 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGCA 10 0.0068343505 144.975 6 >>END_MODULE SRR7169059 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169059_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.851 33.0 33.0 34.0 32.0 34.0 2 33.0415 34.0 33.0 34.0 32.0 34.0 3 32.98425 34.0 33.0 34.0 32.0 34.0 4 32.912 34.0 33.0 34.0 32.0 34.0 5 33.052 34.0 33.0 34.0 32.0 34.0 6 37.13525 38.0 38.0 38.0 37.0 38.0 7 37.006 38.0 38.0 38.0 36.0 38.0 8 37.10675 38.0 38.0 38.0 37.0 38.0 9 36.82775 38.0 38.0 38.0 36.0 38.0 10-14 36.93470000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.9348 38.0 38.0 38.0 36.0 38.0 20-24 36.82915 38.0 38.0 38.0 36.0 38.0 25-29 36.9594 38.0 38.0 38.0 36.4 38.0 30-34 36.9243 38.0 38.0 38.0 36.4 38.0 35-39 36.5779 38.0 38.0 38.0 35.0 38.0 40-44 36.634499999999996 38.0 38.0 38.0 35.0 38.0 45-49 36.859500000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.87305 38.0 38.0 38.0 36.0 38.0 55-59 36.70715 38.0 38.0 38.0 35.2 38.0 60-64 36.7544 38.0 38.0 38.0 35.6 38.0 65-69 36.64525 38.0 38.0 38.0 34.8 38.0 70-74 36.36475 38.0 38.0 38.0 33.8 38.0 75-79 36.39615 38.0 38.0 38.0 34.0 38.0 80-84 36.42315000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.131150000000005 38.0 38.0 38.0 33.2 38.0 90-94 36.10765 38.0 37.8 38.0 33.4 38.0 95-99 36.13425 38.0 38.0 38.0 33.6 38.0 100-104 36.10475 38.0 38.0 38.0 33.6 38.0 105-109 35.71445 38.0 37.2 38.0 31.4 38.0 110-114 35.44259999999999 38.0 37.0 38.0 30.2 38.0 115-119 35.245850000000004 38.0 36.6 38.0 28.6 38.0 120-124 35.27645 38.0 36.6 38.0 29.4 38.0 125-129 35.101299999999995 38.0 36.0 38.0 28.8 38.0 130-134 34.4786 38.0 35.4 38.0 24.8 38.0 135-139 33.8797 38.0 34.8 38.0 21.0 38.0 140-144 34.0503 38.0 34.8 38.0 22.8 38.0 145-149 33.669050000000006 38.0 35.0 38.0 21.8 38.0 150-151 30.297375000000002 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 5.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 3.0 12 1.0 13 5.0 14 1.0 15 5.0 16 5.0 17 8.0 18 6.0 19 5.0 20 10.0 21 6.0 22 14.0 23 15.0 24 12.0 25 18.0 26 25.0 27 32.0 28 34.0 29 41.0 30 56.0 31 60.0 32 101.0 33 110.0 34 146.0 35 223.0 36 551.0 37 2489.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.03509651541739 22.31135622963149 12.183504637753822 25.47004261719729 2 26.400000000000002 26.474999999999998 29.9 17.224999999999998 3 18.6 28.275 33.15 19.975 4 22.650000000000002 33.0 24.075 20.275000000000002 5 25.025 35.099999999999994 22.175 17.7 6 21.175 37.05 23.275000000000002 18.5 7 20.75 23.375 36.075 19.8 8 20.925 26.224999999999998 27.35 25.5 9 20.075000000000003 25.15 30.45 24.325 10-14 23.51617580879044 28.97644882244112 26.296314815740786 21.211060553027654 15-19 23.196159807990398 27.66638331916596 27.50637531876594 21.631081554077706 20-24 22.847284728472847 28.092809280928094 27.477747774777477 21.582158215821583 25-29 23.363504525678852 27.924188628294246 27.03405510826624 21.678251737760664 30-34 22.908436265439818 28.22423363504526 27.794169125368807 21.07316097414612 35-39 22.578386758013703 28.354253137970698 27.919187878181727 21.148172225833875 40-44 23.731865932966485 28.029014507253624 27.308654327163584 20.930465232616307 45-49 23.33466693338668 27.325465093018604 28.445689137827568 20.894178835767153 50-54 23.357007102130638 27.993398019405824 27.923377013103934 20.726217865359608 55-59 23.66 27.735 27.665 20.94 60-64 23.8247649529906 27.870574114822965 27.885577115423082 20.419083816763354 65-69 23.733560034005098 27.279091863779563 27.959193879081862 21.02815422313347 70-74 23.537353735373536 27.71277127712771 27.88278827882788 20.86708670867087 75-79 23.78094523630908 27.47186796699175 28.11202800700175 20.635158789697424 80-84 23.444688937787557 27.780556111222243 28.470694138827767 20.304060812162433 85-89 23.956197809890494 27.906395319765988 27.616380819040952 20.521026051302567 90-94 23.442344234423445 27.49274927492749 28.357835783578356 20.707070707070706 95-99 23.42968593718744 28.150630126025206 27.570514102820564 20.849169833966794 100-104 23.552355235523553 27.502750275027505 28.07780778077808 20.86708670867087 105-109 23.271635817908955 27.498749374687343 28.029014507253624 21.200600300150075 110-114 23.574429771908765 27.85114045618247 27.711084433773507 20.863345338135254 115-119 24.0998199639928 27.840568113622727 27.1754350870174 20.884176835367075 120-124 23.96479295859172 27.20544108821764 27.945589117823566 20.884176835367075 125-129 24.036009002250562 27.29682420605151 27.956989247311824 20.710177544386095 130-134 23.713713713713712 27.66766766766767 27.57757757757758 21.04104104104104 135-139 24.61230615307654 27.138569284642323 27.51375687843922 20.735367683841922 140-144 23.579147488493096 27.426455873524112 28.131879127476484 20.862517510506304 145-149 24.266986890823578 27.314119883918742 27.594316021214848 20.82457720404283 150-151 23.70166437241897 28.044049555750217 27.04292328869979 21.211362783131023 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 1.0 26 1.0 27 2.5 28 5.5 29 7.5 30 8.0 31 12.0 32 18.0 33 24.0 34 34.5 35 53.5 36 81.5 37 104.5 38 132.5 39 168.5 40 194.0 41 215.5 42 239.5 43 287.0 44 293.5 45 299.0 46 312.0 47 260.5 48 216.0 49 198.5 50 183.0 51 157.5 52 126.0 53 99.0 54 70.0 55 44.5 56 32.0 57 24.5 58 19.5 59 16.0 60 13.5 61 7.0 62 6.5 63 8.0 64 5.5 65 3.5 66 1.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.005 20-24 0.01 25-29 0.015 30-34 0.015 35-39 0.015 40-44 0.05 45-49 0.02 50-54 0.03 55-59 0.0 60-64 0.02 65-69 0.015 70-74 0.01 75-79 0.025 80-84 0.02 85-89 0.005 90-94 0.01 95-99 0.02 100-104 0.01 105-109 0.05 110-114 0.04 115-119 0.02 120-124 0.02 125-129 0.025 130-134 0.1 135-139 0.05 140-144 0.06 145-149 0.06999999999999999 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.5874999999999999 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.85 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 1.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0035366106 20.714287 80-84 >>END_MODULE Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911422 spots for SRR7169059.sra Written 911422 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra Read 911406 spots for SRR7169059.sra Written 911406 spots for SRR7169059.sra SRR ids: ['SRR7169059.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b7d7dxu0 SRR7169059.sra spots: 18228136 blocks: [[1, 911406], [911407, 1822812], [1822813, 2734218], [2734219, 3645624], [3645625, 4557030], [4557031, 5468436], [5468437, 6379842], [6379843, 7291248], [7291249, 8202654], [8202655, 9114060], [9114061, 10025466], [10025467, 10936872], [10936873, 11848278], [11848279, 12759684], [12759685, 13671090], [13671091, 14582496], [14582497, 15493902], [15493903, 16405308], [16405309, 17316714], [17316715, 18228136]] SRR7169059 file size 6155216 SRR7169059 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169059 SRR7169059_1.fastq SRR7169059_2.fastq Input file: SRR7169059_1.fastq Paired file: SRR7169059_2.fastq trimmed: SRR7169059-trimmed-pair1.fastq, SRR7169059-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:05:15 2025 >> started Mon Feb 10 18:05:37 2025 >> done (21.395s) 18228136 read pairs processed; of these: 20284 ( 0.11%) short read pairs filtered out after trimming by size control 16691 ( 0.09%) empty read pairs filtered out after trimming by size control 18191161 (99.80%) read pairs available; of these: 8939757 (49.14%) trimmed read pairs available after processing 9251404 (50.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 6 0.00% 21 9 0.00% 22 2 0.00% 23 9 0.00% 24 4 0.00% 25 8 0.00% 26 10 0.00% 27 14 0.00% 28 2 0.00% 29 8 0.00% 30 10 0.00% 31 4 0.00% 32 15 0.00% 33 6 0.00% 34 6 0.00% 35 11 0.00% 36 7 0.00% 37 11 0.00% 38 13 0.00% 39 12 0.00% 40 12 0.00% 41 13 0.00% 42 28 0.00% 43 18 0.00% 44 30 0.00% 45 26 0.00% 46 29 0.00% 47 37 0.00% 48 16 0.00% 49 33 0.00% 50 30 0.00% 51 38 0.00% 52 38 0.00% 53 41 0.00% 54 38 0.00% 55 50 0.00% 56 55 0.00% 57 70 0.00% 58 82 0.00% 59 82 0.00% 60 73 0.00% 61 98 0.00% 62 112 0.00% 63 138 0.00% 64 172 0.00% 65 159 0.00% 66 255 0.00% 67 228 0.00% 68 191 0.00% 69 238 0.00% 70 260 0.00% 71 279 0.00% 72 338 0.00% 73 359 0.00% 74 331 0.00% 75 384 0.00% 76 426 0.00% 77 514 0.00% 78 554 0.00% 79 608 0.00% 80 699 0.00% 81 858 0.00% 82 888 0.00% 83 1179 0.01% 84 2134 0.01% 85 2596 0.01% 86 2600 0.01% 87 2803 0.02% 88 2804 0.02% 89 2809 0.02% 90 2892 0.02% 91 3047 0.02% 92 3260 0.02% 93 3467 0.02% 94 3754 0.02% 95 3834 0.02% 96 3941 0.02% 97 4269 0.02% 98 4690 0.03% 99 4864 0.03% 100 5200 0.03% 101 5515 0.03% 102 5785 0.03% 103 6326 0.03% 104 6746 0.04% 105 7312 0.04% 106 7708 0.04% 107 8179 0.04% 108 8590 0.05% 109 9128 0.05% 110 9807 0.05% 111 10401 0.06% 112 11055 0.06% 113 11833 0.07% 114 12454 0.07% 115 13503 0.07% 116 14369 0.08% 117 15368 0.08% 118 16378 0.09% 119 16922 0.09% 120 17907 0.10% 121 19019 0.10% 122 20367 0.11% 123 22175 0.12% 124 23505 0.13% 125 25552 0.14% 126 27165 0.15% 127 29250 0.16% 128 31404 0.17% 129 33171 0.18% 130 36378 0.20% 131 38772 0.21% 132 42069 0.23% 133 46107 0.25% 134 50585 0.28% 135 55221 0.30% 136 61108 0.34% 137 67186 0.37% 138 75054 0.41% 139 84261 0.46% 140 93380 0.51% 141 107289 0.59% 142 126722 0.70% 143 143706 0.79% 144 173723 0.95% 145 217291 1.19% 146 281424 1.55% 147 384947 2.12% 148 589482 3.24% 149 1155729 6.35% 150 4593180 25.25% 151 9251404 50.86% 18191161 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=189.68 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=16.3 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=31 prefix-density=0.26 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=45.30 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=11.9 sequence=TGTTGGTGGTGG SRR7169059 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:06:33 Started mapping on | Feb 10 18:06:33 Finished on | Feb 10 18:08:42 Mapping speed, Million of reads per hour | 507.66 Number of input reads | 18191161 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17135029 Uniquely mapped reads % | 94.19% Average mapped length | 296.49 Number of splices: Total | 15711385 Number of splices: Annotated (sjdb) | 15451201 Number of splices: GT/AG | 15493893 Number of splices: GC/AG | 173596 Number of splices: AT/AC | 12463 Number of splices: Non-canonical | 31433 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328362 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 111832 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 747737 747737 747737 N_multimapping 328362 328362 328362 N_noFeature 398075 16913850 485954 N_ambiguous 205273 1286 71169 UnstrandedReadsAssigned:16531681 PositiveStrandReadsAssigned:219893 NegativeStrandReadsAssigned:16577906 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169059 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169059-trimmed-pair1.fastq SRR7169059-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,191,161 reads, 16,518,609 reads pseudoaligned [quant] estimated average fragment length: 275.892 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7169059.ke.tsv 34699 SRR7169059.se.tsv 87100 total ==> SRR7169059.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.11 338 11.1232 Potri.005G024800.1.v4.1 1035 760.108 27 2.03764 Potri.004G059700.1.v4.1 961 686.153 2 0.167204 Potri.007G009000.2.v4.1 1416 1141.11 0 0 Potri.003G141000.2.v4.1 2943 2668.11 247 5.31045 Potri.016G087400.1.v4.1 270 59.7982 1517 1455.24 Potri.015G069301.1.v4.1 564 295.765 0 0 Potri.010G195200.1.v4.1 1773 1498.11 12 0.45949 Potri.012G127500.1.v4.1 977 702.127 4508 368.303 ==> SRR7169059.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3201 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 284 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169059 completed mapping pipeline successfully