Starting /dee2/code/volunteer_pipeline.sh SRR7169060 current disk space = 3057927868416 free memory = 1344630228 SRR7169060 SRAfilesize 70753674f2bda1e66a2dd3fb6aff7644 SRR7169060.sra SRR7169060.sra file validated SRR7169060 is paired end SRR7169060 is conventional basespace SRR7169060 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169060_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67625 34.0 33.0 34.0 32.0 34.0 2 33.29 34.0 33.0 34.0 32.0 34.0 3 33.31375 34.0 33.0 34.0 33.0 34.0 4 33.344 34.0 33.0 34.0 33.0 34.0 5 33.35575 34.0 33.0 34.0 33.0 34.0 6 36.7235 38.0 37.0 38.0 34.0 38.0 7 37.24525 38.0 38.0 38.0 36.0 38.0 8 37.29625 38.0 38.0 38.0 36.0 38.0 9 37.39775 38.0 38.0 38.0 37.0 38.0 10-14 37.3629 38.0 38.0 38.0 37.0 38.0 15-19 37.25505 38.0 38.0 38.0 36.6 38.0 20-24 37.2675 38.0 38.0 38.0 36.8 38.0 25-29 37.21385 38.0 38.0 38.0 36.2 38.0 30-34 37.1831 38.0 38.0 38.0 36.2 38.0 35-39 37.0273 38.0 38.0 38.0 35.8 38.0 40-44 36.666700000000006 38.0 38.0 38.0 34.6 38.0 45-49 36.51095 38.0 37.8 38.0 34.0 38.0 50-54 36.395 38.0 37.2 38.0 34.0 38.0 55-59 36.31945 38.0 37.0 38.0 33.6 38.0 60-64 36.19185 38.0 37.0 38.0 33.0 38.0 65-69 36.12825 38.0 37.0 38.0 33.0 38.0 70-74 36.013799999999996 38.0 37.0 38.0 32.2 38.0 75-79 35.884100000000004 38.0 37.0 38.0 31.2 38.0 80-84 35.74425000000001 38.0 36.4 38.0 31.0 38.0 85-89 35.5192 38.0 36.0 38.0 29.0 38.0 90-94 35.24645 38.0 36.0 38.0 29.0 38.0 95-99 35.0698 38.0 36.0 38.0 28.6 38.0 100-104 34.977850000000004 38.0 35.6 38.0 28.2 38.0 105-109 34.689049999999995 38.0 35.0 38.0 26.8 38.0 110-114 34.4448 38.0 34.8 38.0 25.8 38.0 115-119 34.1923 38.0 34.2 38.0 23.8 38.0 120-124 33.879200000000004 38.0 34.0 38.0 22.2 38.0 125-129 33.427099999999996 37.8 33.8 38.0 17.8 38.0 130-134 32.83194999999999 37.4 33.0 38.0 15.0 38.0 135-139 32.241 37.0 31.4 38.0 14.6 38.0 140-144 31.60885 36.0 31.0 38.0 14.0 38.0 145-149 30.77295 36.0 30.6 38.0 8.8 38.0 150-151 26.12525 33.5 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 0.0 10 3.0 11 1.0 12 3.0 13 3.0 14 4.0 15 4.0 16 3.0 17 8.0 18 6.0 19 6.0 20 10.0 21 9.0 22 9.0 23 17.0 24 24.0 25 38.0 26 36.0 27 43.0 28 42.0 29 51.0 30 64.0 31 82.0 32 125.0 33 214.0 34 258.0 35 515.0 36 1096.0 37 1323.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.55427841634738 12.209450830140485 10.37037037037037 34.86590038314176 2 23.849999999999998 15.0 31.2 29.95 3 19.950000000000003 19.650000000000002 27.125 33.275 4 22.6 26.3 24.575 26.525 5 24.0 31.025000000000002 22.400000000000002 22.575 6 19.650000000000002 35.875 24.7 19.775000000000002 7 14.875 26.875 40.575 17.675 8 18.5 27.6 28.325 25.575 9 17.549999999999997 25.224999999999998 32.725 24.5 10-14 19.845 30.775000000000002 27.155 22.225 15-19 20.01 29.054999999999996 27.55 23.385 20-24 19.36 28.99 28.15 23.5 25-29 20.169999999999998 29.044999999999998 27.3 23.485 30-34 20.06 28.845 27.42 23.674999999999997 35-39 19.495 29.03 27.555000000000003 23.919999999999998 40-44 19.55 28.875 27.845 23.73 45-49 20.345 29.080000000000002 27.115000000000002 23.46 50-54 19.865 29.044999999999998 27.715 23.375 55-59 19.975 28.665000000000003 27.26 24.099999999999998 60-64 20.635 28.384999999999998 26.945000000000004 24.035 65-69 20.169999999999998 28.854999999999997 27.075 23.9 70-74 20.025000000000002 27.965 27.48 24.529999999999998 75-79 20.305 28.315 26.91 24.47 80-84 20.155 28.15 27.72 23.974999999999998 85-89 20.395 27.63 27.565 24.41 90-94 20.345 28.29 27.060000000000002 24.305 95-99 20.57 28.355000000000004 26.875 24.2 100-104 20.685000000000002 28.7 26.895000000000003 23.72 105-109 20.57 28.02 26.840000000000003 24.57 110-114 19.73 27.689999999999998 27.834999999999997 24.745 115-119 20.28 28.439999999999998 26.995 24.285 120-124 20.05 28.050000000000004 27.77 24.13 125-129 20.9 27.339999999999996 27.689999999999998 24.07 130-134 21.175 27.944999999999997 27.495000000000005 23.385 135-139 20.875 27.41 27.47 24.245 140-144 20.715 28.235 27.235 23.815 145-149 20.48 27.894999999999996 27.845 23.78 150-151 21.0 27.6625 26.950000000000003 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 1.5 22 0.5 23 2.5 24 2.5 25 2.0 26 3.5 27 10.0 28 12.5 29 9.5 30 19.0 31 25.0 32 33.0 33 48.5 34 66.5 35 71.0 36 80.5 37 102.5 38 122.0 39 150.0 40 182.5 41 215.5 42 232.0 43 234.5 44 252.5 45 263.0 46 264.5 47 249.0 48 230.0 49 215.5 50 176.0 51 150.0 52 126.5 53 103.5 54 79.0 55 57.5 56 50.5 57 42.0 58 27.5 59 17.0 60 12.5 61 12.0 62 10.0 63 5.5 64 4.0 65 3.0 66 3.0 67 4.5 68 3.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.175 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.525 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138-139 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGACAT 10 0.006832588 144.9875 6 AAAAAAA 95 5.164755E-4 12.209475 125-129 >>END_MODULE SRR7169060 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169060_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5795 33.0 33.0 34.0 32.0 34.0 2 32.797 33.0 33.0 34.0 32.0 34.0 3 32.7625 33.0 33.0 34.0 32.0 34.0 4 32.69375 34.0 33.0 34.0 32.0 34.0 5 32.71175 34.0 33.0 34.0 32.0 34.0 6 36.87575 38.0 38.0 38.0 36.0 38.0 7 36.889 38.0 38.0 38.0 36.0 38.0 8 36.8565 38.0 38.0 38.0 36.0 38.0 9 36.9205 38.0 38.0 38.0 36.0 38.0 10-14 36.857200000000006 38.0 38.0 38.0 36.2 38.0 15-19 36.817400000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.77395 38.0 38.0 38.0 36.0 38.0 25-29 36.7832 38.0 38.0 38.0 36.0 38.0 30-34 36.74485 38.0 38.0 38.0 36.0 38.0 35-39 36.67035 38.0 38.0 38.0 36.0 38.0 40-44 36.61319999999999 38.0 38.0 38.0 35.6 38.0 45-49 36.64125 38.0 38.0 38.0 35.8 38.0 50-54 36.586850000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.5434 38.0 38.0 38.0 35.6 38.0 60-64 36.48694999999999 38.0 38.0 38.0 35.0 38.0 65-69 36.47585 38.0 38.0 38.0 35.0 38.0 70-74 36.41945 38.0 38.0 38.0 35.0 38.0 75-79 36.27095 38.0 38.0 38.0 34.2 38.0 80-84 36.2267 38.0 38.0 38.0 34.0 38.0 85-89 36.272499999999994 38.0 38.0 38.0 34.2 38.0 90-94 36.19085 38.0 38.0 38.0 34.0 38.0 95-99 36.02025 38.0 38.0 38.0 33.8 38.0 100-104 35.88815 38.0 38.0 38.0 33.0 38.0 105-109 35.764950000000006 38.0 38.0 38.0 32.6 38.0 110-114 35.67665 38.0 37.8 38.0 31.8 38.0 115-119 35.46375 38.0 37.2 38.0 31.4 38.0 120-124 35.331700000000005 38.0 37.0 38.0 30.6 38.0 125-129 35.003150000000005 38.0 36.2 38.0 28.0 38.0 130-134 34.7347 38.0 36.0 38.0 27.4 38.0 135-139 34.52355000000001 38.0 36.0 38.0 26.0 38.0 140-144 34.06555 38.0 35.2 38.0 22.8 38.0 145-149 33.372150000000005 38.0 35.0 38.0 18.0 38.0 150-151 29.4895 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 7.0 4 7.0 5 4.0 6 4.0 7 3.0 8 4.0 9 3.0 10 3.0 11 0.0 12 1.0 13 2.0 14 3.0 15 3.0 16 2.0 17 3.0 18 5.0 19 7.0 20 16.0 21 8.0 22 15.0 23 8.0 24 16.0 25 20.0 26 29.0 27 30.0 28 25.0 29 37.0 30 49.0 31 54.0 32 67.0 33 90.0 34 132.0 35 217.0 36 460.0 37 2651.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.125 23.799999999999997 14.7 24.375 2 28.275 27.450000000000003 27.200000000000003 17.075000000000003 3 23.25 28.225 29.975 18.55 4 25.0 32.725 23.075000000000003 19.2 5 25.05 34.150000000000006 22.175 18.625 6 22.6 35.65 23.225 18.525 7 21.9 23.0 36.1 19.0 8 22.95 25.924999999999997 26.55 24.575 9 22.25 25.35 29.4 23.0 10-14 23.400000000000002 28.634999999999998 25.64 22.325 15-19 23.485 28.425 26.484999999999996 21.605 20-24 23.73 28.025 27.029999999999998 21.215 25-29 23.18 28.62 26.85 21.349999999999998 30-34 23.5 28.665000000000003 26.435 21.4 35-39 23.425 27.939999999999998 27.155 21.48 40-44 23.565 28.115000000000002 27.265 21.055 45-49 23.625 28.535 27.045 20.794999999999998 50-54 23.715 27.985 27.27 21.029999999999998 55-59 23.96 27.889999999999997 26.895000000000003 21.255 60-64 24.22 28.16 27.215 20.405 65-69 24.215 28.125 26.779999999999998 20.880000000000003 70-74 23.45 28.33 27.405 20.815 75-79 23.559135481288774 27.826696017610566 27.441464878927356 21.1727036221733 80-84 24.015 27.595 27.42 20.97 85-89 24.099999999999998 27.965 27.105 20.830000000000002 90-94 23.724999999999998 27.805000000000003 27.625 20.845 95-99 24.125 27.655 27.1 21.12 100-104 23.96 27.889999999999997 27.55 20.599999999999998 105-109 24.154999999999998 27.744999999999997 27.439999999999998 20.66 110-114 24.585 27.395000000000003 27.29 20.73 115-119 24.725 27.125 27.455000000000002 20.695 120-124 23.724999999999998 27.975 27.345000000000002 20.955 125-129 23.825 27.98 27.515 20.68 130-134 24.415 27.529999999999998 27.200000000000003 20.855 135-139 24.26 27.04 27.79 20.91 140-144 24.29 28.035 27.235 20.44 145-149 24.74304336926548 27.320130358485834 27.756329907244925 20.180496365003762 150-151 24.817334341143866 27.2108843537415 27.75258251448728 20.219198790627363 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 2.0 27 3.0 28 3.0 29 4.5 30 5.5 31 8.0 32 17.0 33 24.5 34 28.5 35 46.0 36 60.5 37 77.5 38 114.0 39 150.0 40 176.5 41 204.5 42 260.0 43 299.0 44 301.0 45 288.0 46 271.0 47 274.5 48 268.0 49 224.5 50 175.0 51 154.0 52 136.5 53 107.0 54 88.0 55 68.5 56 42.5 57 31.0 58 23.5 59 16.5 60 13.5 61 7.0 62 6.0 63 5.0 64 2.0 65 1.5 66 1.5 67 2.0 68 2.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.06 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.27499999999999997 150-151 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.7875 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.375 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.575 0.0 0.0 0.0 0.0 138-139 1.7374999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788464 spots for SRR7169060.sra Written 788464 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra Read 788453 spots for SRR7169060.sra Written 788453 spots for SRR7169060.sra SRR ids: ['SRR7169060.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fovsm6o3 SRR7169060.sra spots: 15769071 blocks: [[1, 788453], [788454, 1576906], [1576907, 2365359], [2365360, 3153812], [3153813, 3942265], [3942266, 4730718], [4730719, 5519171], [5519172, 6307624], [6307625, 7096077], [7096078, 7884530], [7884531, 8672983], [8672984, 9461436], [9461437, 10249889], [10249890, 11038342], [11038343, 11826795], [11826796, 12615248], [12615249, 13403701], [13403702, 14192154], [14192155, 14980607], [14980608, 15769071]] SRR7169060 file size 5321920 SRR7169060 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169060 SRR7169060_1.fastq SRR7169060_2.fastq Input file: SRR7169060_1.fastq Paired file: SRR7169060_2.fastq trimmed: SRR7169060-trimmed-pair1.fastq, SRR7169060-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:50:02 2025 >> started Mon Feb 10 17:50:21 2025 >> done (19.129s) 15769071 read pairs processed; of these: 25809 ( 0.16%) short read pairs filtered out after trimming by size control 16819 ( 0.11%) empty read pairs filtered out after trimming by size control 15726443 (99.73%) read pairs available; of these: 7475642 (47.54%) trimmed read pairs available after processing 8250801 (52.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 5 0.00% 21 7 0.00% 22 6 0.00% 23 8 0.00% 24 10 0.00% 25 10 0.00% 26 5 0.00% 27 12 0.00% 28 13 0.00% 29 4 0.00% 30 18 0.00% 31 10 0.00% 32 11 0.00% 33 18 0.00% 34 17 0.00% 35 12 0.00% 36 12 0.00% 37 21 0.00% 38 15 0.00% 39 14 0.00% 40 24 0.00% 41 14 0.00% 42 20 0.00% 43 10 0.00% 44 26 0.00% 45 36 0.00% 46 27 0.00% 47 32 0.00% 48 34 0.00% 49 27 0.00% 50 50 0.00% 51 54 0.00% 52 51 0.00% 53 66 0.00% 54 51 0.00% 55 58 0.00% 56 73 0.00% 57 82 0.00% 58 75 0.00% 59 91 0.00% 60 105 0.00% 61 107 0.00% 62 120 0.00% 63 130 0.00% 64 135 0.00% 65 142 0.00% 66 171 0.00% 67 177 0.00% 68 190 0.00% 69 249 0.00% 70 273 0.00% 71 321 0.00% 72 346 0.00% 73 361 0.00% 74 420 0.00% 75 419 0.00% 76 477 0.00% 77 545 0.00% 78 587 0.00% 79 659 0.00% 80 729 0.00% 81 919 0.01% 82 978 0.01% 83 1248 0.01% 84 2260 0.01% 85 2924 0.02% 86 2967 0.02% 87 3031 0.02% 88 3172 0.02% 89 3085 0.02% 90 3305 0.02% 91 3322 0.02% 92 3534 0.02% 93 3744 0.02% 94 4032 0.03% 95 4293 0.03% 96 4552 0.03% 97 4861 0.03% 98 5123 0.03% 99 5347 0.03% 100 5844 0.04% 101 6102 0.04% 102 6465 0.04% 103 6686 0.04% 104 7082 0.05% 105 7564 0.05% 106 8178 0.05% 107 8501 0.05% 108 9102 0.06% 109 9519 0.06% 110 10089 0.06% 111 10764 0.07% 112 11534 0.07% 113 12204 0.08% 114 12926 0.08% 115 13791 0.09% 116 14655 0.09% 117 15537 0.10% 118 16265 0.10% 119 17279 0.11% 120 18163 0.12% 121 19202 0.12% 122 20138 0.13% 123 21735 0.14% 124 23404 0.15% 125 24903 0.16% 126 26676 0.17% 127 28430 0.18% 128 30008 0.19% 129 32156 0.20% 130 34232 0.22% 131 36973 0.24% 132 40286 0.26% 133 43519 0.28% 134 46365 0.29% 135 50540 0.32% 136 55791 0.35% 137 60598 0.39% 138 68601 0.44% 139 75691 0.48% 140 83810 0.53% 141 93410 0.59% 142 109004 0.69% 143 119538 0.76% 144 141058 0.90% 145 172540 1.10% 146 218562 1.39% 147 303047 1.93% 148 465507 2.96% 149 926784 5.89% 150 3804380 24.19% 151 8250801 52.46% 15726443 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=223.68 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCAGGACCACCATTGCAAGTAGCAAAGGTTGGCAAACCACATGTCATGGCCTCAACAACAGTCAAT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.58 fanout-score-rank=20 prefix-density=0.32 prefix-fanout=4.5 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=44 fanout-score=122.58 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.0 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169060 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:51:15 Started mapping on | Feb 10 17:51:15 Finished on | Feb 10 17:53:09 Mapping speed, Million of reads per hour | 496.62 Number of input reads | 15726443 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14598311 Uniquely mapped reads % | 92.83% Average mapped length | 296.03 Number of splices: Total | 13813762 Number of splices: Annotated (sjdb) | 13587850 Number of splices: GT/AG | 13608446 Number of splices: GC/AG | 164677 Number of splices: AT/AC | 11354 Number of splices: Non-canonical | 29285 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282735 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 29807 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.14% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 870881 870881 870881 N_multimapping 282735 282735 282735 N_noFeature 270406 14421506 343992 N_ambiguous 163203 884 59397 UnstrandedReadsAssigned:14164702 PositiveStrandReadsAssigned:175921 NegativeStrandReadsAssigned:14194922 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169060 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169060-trimmed-pair1.fastq SRR7169060-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,726,443 reads, 14,109,748 reads pseudoaligned [quant] estimated average fragment length: 267.416 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7169060.ke.tsv 34699 SRR7169060.se.tsv 87100 total ==> SRR7169060.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.58 246 8.04771 Potri.005G024800.1.v4.1 1035 768.584 52 3.87686 Potri.004G059700.1.v4.1 961 694.596 1 0.0824966 Potri.007G009000.2.v4.1 1416 1149.58 0 0 Potri.003G141000.2.v4.1 2943 2676.58 229.033 4.90326 Potri.016G087400.1.v4.1 270 62.2561 1659.54 1527.48 Potri.015G069301.1.v4.1 564 302.117 0 0 Potri.010G195200.1.v4.1 1773 1506.58 13 0.494445 Potri.012G127500.1.v4.1 977 710.584 6334 510.776 ==> SRR7169060.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 982 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169060 completed mapping pipeline successfully