Starting /dee2/code/volunteer_pipeline.sh SRR7169061 current disk space = 3057942904832 free memory = 1442982628 SRR7169061 SRAfilesize 9dee1cd0a31aef0ee9c9be66b8d930b4 SRR7169061.sra SRR7169061.sra file validated SRR7169061 is paired end SRR7169061 is conventional basespace SRR7169061 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169061_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78325 34.0 33.0 34.0 32.0 34.0 2 33.3095 34.0 33.0 34.0 33.0 34.0 3 33.241 34.0 33.0 34.0 33.0 34.0 4 33.36925 34.0 33.0 34.0 33.0 34.0 5 33.4335 34.0 33.0 34.0 33.0 34.0 6 36.92075 38.0 37.0 38.0 35.0 38.0 7 37.2595 38.0 38.0 38.0 36.0 38.0 8 37.364 38.0 38.0 38.0 37.0 38.0 9 37.433 38.0 38.0 38.0 37.0 38.0 10-14 37.3574 38.0 38.0 38.0 37.0 38.0 15-19 37.314049999999995 38.0 38.0 38.0 36.8 38.0 20-24 37.12445 38.0 38.0 38.0 36.0 38.0 25-29 37.156549999999996 38.0 38.0 38.0 36.2 38.0 30-34 37.19175 38.0 38.0 38.0 36.6 38.0 35-39 36.97085 38.0 38.0 38.0 35.8 38.0 40-44 36.882450000000006 38.0 38.0 38.0 35.0 38.0 45-49 36.67185 38.0 38.0 38.0 34.2 38.0 50-54 36.540549999999996 38.0 37.8 38.0 34.0 38.0 55-59 36.47835 38.0 37.8 38.0 34.0 38.0 60-64 36.5537 38.0 38.0 38.0 34.0 38.0 65-69 36.3728 38.0 37.4 38.0 33.8 38.0 70-74 36.147 38.0 37.0 38.0 33.0 38.0 75-79 36.106199999999994 38.0 37.0 38.0 33.0 38.0 80-84 35.6151 38.0 36.6 38.0 30.0 38.0 85-89 35.8301 38.0 37.0 38.0 31.4 38.0 90-94 35.6395 38.0 36.6 38.0 30.0 38.0 95-99 35.31875 38.0 36.0 38.0 29.0 38.0 100-104 35.05830000000001 38.0 36.0 38.0 28.0 38.0 105-109 34.447500000000005 38.0 34.8 38.0 24.6 38.0 110-114 34.36555 38.0 34.4 38.0 24.6 38.0 115-119 34.747249999999994 38.0 35.0 38.0 26.8 38.0 120-124 33.77795 38.0 34.0 38.0 21.8 38.0 125-129 33.541700000000006 38.0 34.0 38.0 20.2 38.0 130-134 33.440599999999996 38.0 34.0 38.0 18.6 38.0 135-139 32.87265 37.6 33.2 38.0 16.2 38.0 140-144 31.9466 36.4 32.0 38.0 14.0 38.0 145-149 30.85855 36.0 31.0 38.0 8.8 38.0 150-151 26.534 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 2.0 12 1.0 13 0.0 14 1.0 15 2.0 16 2.0 17 7.0 18 7.0 19 6.0 20 8.0 21 16.0 22 10.0 23 11.0 24 14.0 25 23.0 26 31.0 27 55.0 28 54.0 29 59.0 30 78.0 31 92.0 32 144.0 33 170.0 34 257.0 35 439.0 36 1000.0 37 1509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.87643020594965 12.40783117213323 9.382151029748284 36.333587592168826 2 22.900000000000002 13.3 33.825 29.975 3 19.175 17.275 26.474999999999998 37.075 4 22.45 26.1 23.7 27.750000000000004 5 23.3 29.599999999999998 25.074999999999996 22.025 6 19.45 35.975 23.175 21.4 7 14.924999999999999 27.325 40.325 17.424999999999997 8 17.224999999999998 27.55 31.424999999999997 23.799999999999997 9 17.474999999999998 24.375 33.625 24.525 10-14 19.5 30.605 27.395000000000003 22.5 15-19 20.285 28.255000000000003 28.09 23.369999999999997 20-24 19.475 29.445 27.694999999999997 23.385 25-29 19.82 29.085 27.87 23.225 30-34 19.919999999999998 28.634999999999998 27.815 23.630000000000003 35-39 20.035 28.535 27.750000000000004 23.68 40-44 20.44 28.660000000000004 27.495000000000005 23.405 45-49 20.105 29.299999999999997 27.175 23.419999999999998 50-54 20.355 28.939999999999998 27.055 23.65 55-59 20.03 28.470000000000002 27.85 23.65 60-64 20.665 28.565 27.529999999999998 23.24 65-69 20.46 28.435 27.73 23.375 70-74 19.865 28.275 28.144999999999996 23.715 75-79 20.605 28.26 27.315 23.82 80-84 20.39 29.035 26.595000000000002 23.98 85-89 20.57 28.335 27.235 23.86 90-94 20.26 28.199999999999996 27.715 23.825 95-99 20.630000000000003 28.08 27.650000000000002 23.64 100-104 20.095 28.904999999999998 27.169999999999998 23.830000000000002 105-109 20.29 28.365000000000002 27.084999999999997 24.26 110-114 20.919999999999998 28.425 27.425 23.23 115-119 20.94 28.425 26.96 23.674999999999997 120-124 20.34 28.51 27.52 23.630000000000003 125-129 20.919999999999998 27.705000000000002 27.505000000000003 23.87 130-134 21.095 27.655 27.775 23.474999999999998 135-139 21.0 27.355 28.065 23.580000000000002 140-144 20.185 28.1 27.529999999999998 24.185000000000002 145-149 20.69 28.134999999999998 27.439999999999998 23.735 150-151 20.7375 27.900000000000002 27.400000000000002 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 1.5 24 1.5 25 2.5 26 4.5 27 8.5 28 12.0 29 18.0 30 21.0 31 27.0 32 34.0 33 35.0 34 50.0 35 65.0 36 75.0 37 104.5 38 125.0 39 154.5 40 190.5 41 221.0 42 239.5 43 234.0 44 262.0 45 278.0 46 284.5 47 277.0 48 239.0 49 217.5 50 177.0 51 137.0 52 115.0 53 97.0 54 79.0 55 49.0 56 35.0 57 30.0 58 19.0 59 18.5 60 17.5 61 7.5 62 5.0 63 6.5 64 4.0 65 2.0 66 2.5 67 2.0 68 1.0 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.6499999999999999 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169061 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169061_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94475 33.0 33.0 34.0 32.0 34.0 2 32.88225 34.0 33.0 34.0 32.0 34.0 3 32.9485 34.0 33.0 34.0 32.0 34.0 4 32.814 34.0 33.0 34.0 32.0 34.0 5 32.98725 34.0 33.0 34.0 32.0 34.0 6 37.0945 38.0 38.0 38.0 37.0 38.0 7 37.13375 38.0 38.0 38.0 37.0 38.0 8 37.0625 38.0 38.0 38.0 37.0 38.0 9 36.928 38.0 38.0 38.0 36.0 38.0 10-14 36.91675 38.0 38.0 38.0 36.0 38.0 15-19 37.060199999999995 38.0 38.0 38.0 36.8 38.0 20-24 37.0315 38.0 38.0 38.0 36.4 38.0 25-29 36.94115000000001 38.0 38.0 38.0 36.0 38.0 30-34 37.0093 38.0 38.0 38.0 36.6 38.0 35-39 36.8645 38.0 38.0 38.0 36.0 38.0 40-44 36.70635 38.0 38.0 38.0 35.4 38.0 45-49 36.8934 38.0 38.0 38.0 36.0 38.0 50-54 36.8482 38.0 38.0 38.0 36.0 38.0 55-59 36.82985 38.0 38.0 38.0 35.8 38.0 60-64 36.685950000000005 38.0 38.0 38.0 35.2 38.0 65-69 36.71275 38.0 38.0 38.0 35.2 38.0 70-74 36.565549999999995 38.0 38.0 38.0 34.6 38.0 75-79 36.45095 38.0 38.0 38.0 34.2 38.0 80-84 36.2863 38.0 38.0 38.0 33.8 38.0 85-89 36.299549999999996 38.0 38.0 38.0 33.8 38.0 90-94 36.08735 38.0 37.8 38.0 32.8 38.0 95-99 36.297250000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.12295 38.0 38.0 38.0 33.6 38.0 105-109 35.945800000000006 38.0 37.8 38.0 32.6 38.0 110-114 35.60195 38.0 37.0 38.0 31.2 38.0 115-119 35.48780000000001 38.0 37.0 38.0 30.6 38.0 120-124 35.291599999999995 38.0 36.6 38.0 29.0 38.0 125-129 34.961400000000005 38.0 36.0 38.0 28.0 38.0 130-134 34.4793 38.0 35.6 38.0 24.6 38.0 135-139 34.276700000000005 38.0 35.0 38.0 23.2 38.0 140-144 34.00345 38.0 34.8 38.0 21.6 38.0 145-149 33.3116 38.0 34.6 38.0 17.0 38.0 150-151 29.789625 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 2.0 6 1.0 7 0.0 8 2.0 9 2.0 10 1.0 11 3.0 12 0.0 13 5.0 14 2.0 15 3.0 16 5.0 17 5.0 18 7.0 19 10.0 20 6.0 21 13.0 22 14.0 23 9.0 24 20.0 25 18.0 26 24.0 27 27.0 28 32.0 29 46.0 30 49.0 31 56.0 32 104.0 33 105.0 34 151.0 35 238.0 36 518.0 37 2516.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.199999999999996 23.875 14.2 25.724999999999998 2 27.625 27.825 27.200000000000003 17.349999999999998 3 20.0 28.775000000000002 30.775000000000002 20.45 4 24.45 32.85 23.875 18.825 5 24.224999999999998 35.975 22.375 17.424999999999997 6 21.45 38.175 22.2 18.175 7 21.3 22.400000000000002 37.55 18.75 8 23.200000000000003 25.174999999999997 25.624999999999996 26.0 9 21.625 25.3 29.65 23.425 10-14 22.95 29.385 25.965 21.7 15-19 23.395 27.98 27.744999999999997 20.880000000000003 20-24 22.64 28.455000000000002 27.155 21.75 25-29 22.705000000000002 28.15 28.155 20.990000000000002 30-34 23.18 27.765 28.299999999999997 20.755000000000003 35-39 23.305 28.015 27.005000000000003 21.675 40-44 23.3 28.199999999999996 27.41 21.09 45-49 23.22 27.644999999999996 27.985 21.15 50-54 22.975 27.57 27.97 21.485000000000003 55-59 23.21 27.650000000000002 27.875 21.265 60-64 23.105 28.244999999999997 27.650000000000002 21.0 65-69 23.200000000000003 28.050000000000004 27.915 20.835 70-74 23.59 28.43 27.395000000000003 20.585 75-79 23.215 27.36 27.894999999999996 21.529999999999998 80-84 23.275000000000002 27.994999999999997 27.88 20.849999999999998 85-89 23.665 27.534999999999997 28.065 20.735 90-94 23.49 27.189999999999998 28.449999999999996 20.87 95-99 23.575 27.105 28.395 20.925 100-104 24.03 28.26 27.02 20.69 105-109 23.580000000000002 27.1 27.950000000000003 21.37 110-114 23.655 28.125 27.91 20.31 115-119 24.224999999999998 27.625 27.915 20.235 120-124 23.515 27.700000000000003 28.29 20.495 125-129 24.285 26.995 28.01 20.71 130-134 24.015 27.889999999999997 27.894999999999996 20.200000000000003 135-139 23.805 27.775 27.48 20.94 140-144 23.285 27.315 28.16 21.240000000000002 145-149 23.97 27.55 27.325 21.154999999999998 150-151 23.9 28.262500000000003 26.8625 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 3.0 25 3.0 26 4.0 27 5.5 28 5.0 29 3.5 30 4.0 31 12.5 32 22.0 33 27.5 34 40.0 35 56.5 36 68.5 37 100.0 38 136.0 39 167.5 40 195.5 41 231.0 42 261.5 43 254.5 44 288.0 45 301.0 46 273.0 47 250.0 48 227.5 49 210.0 50 189.5 51 165.0 52 127.5 53 103.0 54 74.5 55 51.5 56 36.0 57 21.5 58 15.5 59 11.5 60 11.5 61 10.5 62 5.5 63 4.5 64 4.5 65 4.0 66 3.0 67 1.0 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.32499999999999996 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.6625 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138-139 1.1375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831579 spots for SRR7169061.sra Written 831579 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra Read 831574 spots for SRR7169061.sra Written 831574 spots for SRR7169061.sra SRR ids: ['SRR7169061.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bv5xj_zo SRR7169061.sra spots: 16631485 blocks: [[1, 831574], [831575, 1663148], [1663149, 2494722], [2494723, 3326296], [3326297, 4157870], [4157871, 4989444], [4989445, 5821018], [5821019, 6652592], [6652593, 7484166], [7484167, 8315740], [8315741, 9147314], [9147315, 9978888], [9978889, 10810462], [10810463, 11642036], [11642037, 12473610], [12473611, 13305184], [13305185, 14136758], [14136759, 14968332], [14968333, 15799906], [15799907, 16631485]] SRR7169061 file size 5614164 SRR7169061 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169061 SRR7169061_1.fastq SRR7169061_2.fastq Input file: SRR7169061_1.fastq Paired file: SRR7169061_2.fastq trimmed: SRR7169061-trimmed-pair1.fastq, SRR7169061-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:50:21 2025 >> started Mon Feb 10 17:50:41 2025 >> done (19.440s) 16631485 read pairs processed; of these: 13852 ( 0.08%) short read pairs filtered out after trimming by size control 14084 ( 0.08%) empty read pairs filtered out after trimming by size control 16603549 (99.83%) read pairs available; of these: 7174941 (43.21%) trimmed read pairs available after processing 9428608 (56.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 8 0.00% 24 2 0.00% 25 4 0.00% 26 2 0.00% 27 2 0.00% 28 6 0.00% 29 3 0.00% 30 8 0.00% 31 7 0.00% 32 3 0.00% 33 5 0.00% 34 4 0.00% 35 12 0.00% 36 12 0.00% 37 5 0.00% 38 9 0.00% 39 13 0.00% 40 6 0.00% 41 15 0.00% 42 6 0.00% 43 10 0.00% 44 12 0.00% 45 12 0.00% 46 14 0.00% 47 19 0.00% 48 16 0.00% 49 20 0.00% 50 25 0.00% 51 28 0.00% 52 44 0.00% 53 31 0.00% 54 23 0.00% 55 29 0.00% 56 20 0.00% 57 37 0.00% 58 34 0.00% 59 45 0.00% 60 51 0.00% 61 63 0.00% 62 77 0.00% 63 68 0.00% 64 70 0.00% 65 79 0.00% 66 91 0.00% 67 112 0.00% 68 133 0.00% 69 146 0.00% 70 171 0.00% 71 150 0.00% 72 176 0.00% 73 170 0.00% 74 205 0.00% 75 258 0.00% 76 285 0.00% 77 304 0.00% 78 331 0.00% 79 382 0.00% 80 401 0.00% 81 474 0.00% 82 591 0.00% 83 708 0.00% 84 1297 0.01% 85 1783 0.01% 86 1884 0.01% 87 2115 0.01% 88 2112 0.01% 89 2186 0.01% 90 2354 0.01% 91 2340 0.01% 92 2582 0.02% 93 2686 0.02% 94 2746 0.02% 95 2897 0.02% 96 3156 0.02% 97 3367 0.02% 98 3611 0.02% 99 3789 0.02% 100 4062 0.02% 101 4327 0.03% 102 4487 0.03% 103 4871 0.03% 104 5205 0.03% 105 5608 0.03% 106 6011 0.04% 107 6459 0.04% 108 6949 0.04% 109 7193 0.04% 110 7663 0.05% 111 8047 0.05% 112 8541 0.05% 113 9399 0.06% 114 9902 0.06% 115 10617 0.06% 116 11155 0.07% 117 11834 0.07% 118 12619 0.08% 119 13224 0.08% 120 14117 0.09% 121 14641 0.09% 122 15514 0.09% 123 16785 0.10% 124 18046 0.11% 125 19294 0.12% 126 20746 0.12% 127 22331 0.13% 128 23489 0.14% 129 25381 0.15% 130 27320 0.16% 131 29195 0.18% 132 31386 0.19% 133 34266 0.21% 134 37362 0.23% 135 40568 0.24% 136 44400 0.27% 137 48670 0.29% 138 54878 0.33% 139 60288 0.36% 140 67466 0.41% 141 75926 0.46% 142 87022 0.52% 143 102169 0.62% 144 121612 0.73% 145 150128 0.90% 146 195332 1.18% 147 271040 1.63% 148 422633 2.55% 149 833818 5.02% 150 4043981 24.36% 151 9428608 56.79% 16603549 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=39 prefix-density=0.21 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCCCGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=242.96 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=33 prefix-density=0.30 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.15 sequence-density-rank=11 fanout-score=47.64 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=13.3 sequence=TGTTGGTGGTGGTACTGGA SRR7169061 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:51:25 Started mapping on | Feb 10 17:51:25 Finished on | Feb 10 17:53:07 Mapping speed, Million of reads per hour | 586.01 Number of input reads | 16603549 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15813972 Uniquely mapped reads % | 95.24% Average mapped length | 297.40 Number of splices: Total | 15213662 Number of splices: Annotated (sjdb) | 14973421 Number of splices: GT/AG | 15000758 Number of splices: GC/AG | 170223 Number of splices: AT/AC | 12779 Number of splices: Non-canonical | 29902 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287274 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 54308 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 517799 517799 517799 N_multimapping 287274 287274 287274 N_noFeature 324727 15616188 409222 N_ambiguous 180399 916 66486 UnstrandedReadsAssigned:15308846 PositiveStrandReadsAssigned:196868 NegativeStrandReadsAssigned:15338264 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169061 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169061-trimmed-pair1.fastq SRR7169061-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,603,549 reads, 15,258,082 reads pseudoaligned [quant] estimated average fragment length: 282.727 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 975 rounds 52401 SRR7169061.ke.tsv 34699 SRR7169061.se.tsv 87100 total ==> SRR7169061.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.27 321 11.034 Potri.005G024800.1.v4.1 1035 753.273 34 2.69385 Potri.004G059700.1.v4.1 961 679.333 2 0.175709 Potri.007G009000.2.v4.1 1416 1134.27 0 0 Potri.003G141000.2.v4.1 2943 2661.27 276 6.18966 Potri.016G087400.1.v4.1 270 58.8977 1369 1387.24 Potri.015G069301.1.v4.1 564 289.85 0 0 Potri.010G195200.1.v4.1 1773 1491.27 20 0.800423 Potri.012G127500.1.v4.1 977 695.284 3509 301.209 ==> SRR7169061.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1296 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169061 completed mapping pipeline successfully