Starting /dee2/code/volunteer_pipeline.sh SRR7169062 current disk space = 3057631653888 free memory = 1347251580 SRR7169062 SRAfilesize 38e8dbdb4be36dc383be20a2f94a5e40 SRR7169062.sra SRR7169062.sra file validated SRR7169062 is paired end SRR7169062 is conventional basespace SRR7169062 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169062_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16175 34.0 33.0 34.0 33.0 34.0 2 33.47675 34.0 34.0 34.0 33.0 34.0 3 33.569 34.0 34.0 34.0 33.0 34.0 4 33.5755 34.0 34.0 34.0 33.0 34.0 5 33.553 34.0 34.0 34.0 33.0 34.0 6 37.238 38.0 38.0 38.0 36.0 38.0 7 37.427 38.0 38.0 38.0 37.0 38.0 8 37.468 38.0 38.0 38.0 37.0 38.0 9 37.5375 38.0 38.0 38.0 38.0 38.0 10-14 37.53455000000001 38.0 38.0 38.0 37.6 38.0 15-19 37.43575 38.0 38.0 38.0 37.0 38.0 20-24 37.4443 38.0 38.0 38.0 37.0 38.0 25-29 37.369749999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.3184 38.0 38.0 38.0 36.8 38.0 35-39 37.20595 38.0 38.0 38.0 36.4 38.0 40-44 36.78635 38.0 38.0 38.0 35.2 38.0 45-49 36.61495000000001 38.0 38.0 38.0 34.4 38.0 50-54 36.481700000000004 38.0 38.0 38.0 34.0 38.0 55-59 36.362849999999995 38.0 37.4 38.0 33.6 38.0 60-64 36.357899999999994 38.0 37.4 38.0 34.0 38.0 65-69 36.15065 38.0 37.0 38.0 33.2 38.0 70-74 36.03445 38.0 37.0 38.0 32.6 38.0 75-79 35.78975 38.0 37.0 38.0 31.4 38.0 80-84 35.7137 38.0 37.0 38.0 30.8 38.0 85-89 35.5938 38.0 36.8 38.0 30.6 38.0 90-94 35.2487 38.0 36.0 38.0 29.0 38.0 95-99 35.26105 38.0 36.0 38.0 29.0 38.0 100-104 34.837599999999995 38.0 35.6 38.0 27.6 38.0 105-109 34.5903 38.0 35.0 38.0 26.2 38.0 110-114 34.16435 38.0 34.4 38.0 23.6 38.0 115-119 34.0507 38.0 34.2 38.0 23.0 38.0 120-124 33.728750000000005 38.0 34.0 38.0 20.6 38.0 125-129 33.3358 37.8 33.8 38.0 19.8 38.0 130-134 32.5881 37.0 33.0 38.0 15.0 38.0 135-139 32.26845 37.4 32.2 38.0 14.4 38.0 140-144 31.643449999999994 36.2 31.0 38.0 14.0 38.0 145-149 30.695 36.0 31.0 38.0 8.6 38.0 150-151 26.655375 34.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 4.0 12 3.0 13 4.0 14 6.0 15 1.0 16 5.0 17 9.0 18 11.0 19 15.0 20 5.0 21 15.0 22 13.0 23 25.0 24 23.0 25 24.0 26 22.0 27 30.0 28 33.0 29 54.0 30 71.0 31 84.0 32 125.0 33 164.0 34 272.0 35 501.0 36 1054.0 37 1423.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.21244309559939 14.087000505816894 11.001517450682853 34.69903894790086 2 24.875 14.45 31.55 29.125 3 21.4 17.724999999999998 26.875 34.0 4 22.7 24.325 25.15 27.825 5 22.975 28.825 25.5 22.7 6 20.5 33.175 26.05 20.275000000000002 7 15.25 28.925 39.324999999999996 16.5 8 17.5 27.375 31.900000000000002 23.225 9 17.549999999999997 26.1 33.300000000000004 23.05 10-14 19.015 30.615 28.050000000000004 22.32 15-19 19.66 29.215000000000003 28.065 23.06 20-24 19.775000000000002 28.99 27.845 23.39 25-29 18.93 29.48 27.675 23.915 30-34 19.759999999999998 29.145 27.755000000000003 23.34 35-39 19.53 28.9 27.18 24.39 40-44 19.939999999999998 29.59 26.919999999999998 23.549999999999997 45-49 19.994999999999997 29.205 27.275 23.525 50-54 20.07 29.049999999999997 27.13 23.75 55-59 20.4 28.854999999999997 27.265 23.48 60-64 19.91 28.84 27.779999999999998 23.47 65-69 19.495 29.335 27.310000000000002 23.86 70-74 20.169999999999998 28.99 26.779999999999998 24.060000000000002 75-79 19.675 29.165000000000003 27.334999999999997 23.825 80-84 19.689999999999998 29.354999999999997 27.415 23.54 85-89 20.32 29.275000000000002 26.779999999999998 23.625 90-94 20.04 28.694999999999997 27.42 23.845 95-99 19.935 28.76 27.485 23.82 100-104 20.102086773757694 28.62433068107892 27.208126907871694 24.065455637291695 105-109 20.48 27.98 27.400000000000002 24.14 110-114 20.468656118565992 28.03424794712598 27.122972161025437 24.374123773282598 115-119 20.125 28.660000000000004 27.200000000000003 24.015 120-124 20.665499124343256 28.486364773580185 26.95021265949462 23.897923442581938 125-129 21.086054302715134 27.816390819540977 27.501375068753436 23.59617980899045 130-134 20.150000000000002 27.810000000000002 27.689999999999998 24.349999999999998 135-139 20.505000000000003 27.575 27.994999999999997 23.925 140-144 20.46 28.615000000000002 26.66 24.265 145-149 21.11 27.905 27.060000000000002 23.925 150-151 20.474999999999998 27.762500000000003 27.3625 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 2.0 21 3.0 22 3.0 23 3.5 24 4.5 25 7.0 26 9.0 27 12.0 28 15.0 29 21.0 30 32.0 31 36.5 32 47.0 33 62.0 34 70.0 35 79.5 36 110.0 37 121.5 38 133.0 39 158.5 40 180.0 41 192.0 42 209.5 43 240.0 44 250.5 45 243.5 46 224.0 47 210.0 48 204.5 49 197.0 50 170.5 51 142.5 52 126.0 53 108.0 54 81.5 55 63.0 56 47.5 57 39.0 58 36.5 59 26.0 60 17.0 61 15.5 62 11.0 63 4.0 64 2.5 65 2.5 66 4.0 67 5.0 68 2.5 69 1.0 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.0 110-114 0.13999999999999999 115-119 0.0 120-124 0.075 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2687846696924 98.425 2 0.7060010085728694 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02521432173474534 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATTTTATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 9 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.2374999999999998 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCTTT 10 0.006867937 144.7375 1 TAAGTCA 10 0.006867937 144.7375 5 GTAAGTC 10 0.006867937 144.7375 4 >>END_MODULE SRR7169062 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169062_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8385 33.0 33.0 34.0 32.0 34.0 2 32.96275 34.0 33.0 34.0 32.0 34.0 3 32.99975 34.0 33.0 34.0 33.0 34.0 4 32.98225 34.0 33.0 34.0 32.0 34.0 5 32.9775 34.0 33.0 34.0 33.0 34.0 6 37.09925 38.0 38.0 38.0 37.0 38.0 7 37.1175 38.0 38.0 38.0 37.0 38.0 8 37.09575 38.0 38.0 38.0 37.0 38.0 9 37.15075 38.0 38.0 38.0 37.0 38.0 10-14 37.069399999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.0474 38.0 38.0 38.0 37.0 38.0 20-24 36.999649999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.00875 38.0 38.0 38.0 37.0 38.0 30-34 37.049299999999995 38.0 38.0 38.0 37.0 38.0 35-39 36.98735 38.0 38.0 38.0 37.0 38.0 40-44 36.921049999999994 38.0 38.0 38.0 37.0 38.0 45-49 36.907349999999994 38.0 38.0 38.0 37.0 38.0 50-54 36.74645 38.0 38.0 38.0 36.8 38.0 55-59 36.67215 38.0 38.0 38.0 36.4 38.0 60-64 36.65745 38.0 38.0 38.0 36.4 38.0 65-69 36.533950000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.4188 38.0 38.0 38.0 36.0 38.0 75-79 36.35015 38.0 38.0 38.0 35.6 38.0 80-84 36.407349999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.348400000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.242000000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.122400000000006 38.0 38.0 38.0 34.4 38.0 100-104 35.94835 38.0 38.0 38.0 34.0 38.0 105-109 35.839749999999995 38.0 38.0 38.0 33.8 38.0 110-114 35.665549999999996 38.0 38.0 38.0 33.2 38.0 115-119 35.492000000000004 38.0 38.0 38.0 32.2 38.0 120-124 35.3091 38.0 37.8 38.0 31.4 38.0 125-129 35.102850000000004 38.0 37.4 38.0 29.8 38.0 130-134 34.80055 38.0 36.4 38.0 28.0 38.0 135-139 34.5513 38.0 36.0 38.0 27.0 38.0 140-144 34.046800000000005 38.0 35.8 38.0 23.0 38.0 145-149 33.610099999999996 38.0 35.4 38.0 18.4 38.0 150-151 30.386874999999996 36.5 29.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 10.0 4 3.0 5 3.0 6 1.0 7 0.0 8 3.0 9 4.0 10 5.0 11 0.0 12 13.0 13 9.0 14 1.0 15 1.0 16 7.0 17 12.0 18 10.0 19 9.0 20 9.0 21 10.0 22 8.0 23 10.0 24 15.0 25 9.0 26 21.0 27 17.0 28 27.0 29 33.0 30 26.0 31 41.0 32 63.0 33 70.0 34 93.0 35 160.0 36 383.0 37 2897.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.571285140562246 22.866465863453815 14.984939759036145 25.577309236947794 2 28.23911955977989 29.014507253626814 24.7623811905953 17.983991995998 3 21.76088044022011 29.839919959979987 28.189094547273637 20.210105052526263 4 24.275 32.824999999999996 24.575 18.325 5 25.3 35.125 22.650000000000002 16.925 6 22.8 37.85 22.375 16.975 7 20.65 22.675 38.224999999999994 18.45 8 23.925 25.05 27.275 23.75 9 22.2 25.7 29.599999999999998 22.5 10-14 23.96 28.585 25.39 22.065 15-19 23.849999999999998 27.834999999999997 26.815 21.5 20-24 23.595 28.305000000000003 26.295 21.805 25-29 23.93 28.549999999999997 26.119999999999997 21.4 30-34 23.41 28.555000000000003 26.939999999999998 21.095 35-39 23.985 27.775 27.275 20.965 40-44 23.544999999999998 27.765 27.025 21.665 45-49 23.57 28.27 26.605 21.555 50-54 23.950085195950688 27.24265811366142 27.54836123083091 21.25889545955698 55-59 24.26599749058971 27.593475533249684 27.55332496863237 20.58720200752823 60-64 23.885094415427883 28.153877059059862 27.059059863398954 20.901968662113298 65-69 25.012586849259893 27.29835867485651 27.167455442553617 20.521599033329977 70-74 23.73683945393179 27.97843937333132 27.74167548234346 20.54304569039343 75-79 23.870220162224797 28.19789410045846 27.46234067207416 20.46954506524258 80-84 23.76983329985941 28.554930708977704 27.470375577425187 20.2048604137377 85-89 24.095357590966124 26.966122961104137 27.693851944792975 21.244667503136764 90-94 24.41154328732748 27.176913425345045 27.68381430363864 20.727728983688834 95-99 23.9297365119197 27.55332496863237 28.10539523212045 20.411543287327476 100-104 24.623569564344507 27.43926922304758 27.559726962457336 20.37743425015057 105-109 24.15056461731493 28.060225846925974 26.73525721455458 21.053952321204516 110-114 24.501882057716436 27.618569636135508 26.91091593475533 20.968632371392722 115-119 24.250941028858218 27.056461731493098 27.633626097867005 21.058971141781683 120-124 23.73400250941029 27.718946047678795 27.723964868255962 20.823086574654955 125-129 23.879548306148056 28.01505646173149 27.457967377666247 20.647427854454204 130-134 23.75407779171895 28.180677540777914 27.608531994981178 20.456712672521956 135-139 23.39354903638102 28.5060131837166 27.635485331857296 20.464952448045086 140-144 24.702740830310358 27.9322853688029 27.146311970979443 20.218661829907294 145-149 24.55724304959887 27.862152479943486 27.519047378777937 20.061557091679703 150-151 24.860900354071827 28.03490136570562 26.643904906423877 20.460293373798685 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.5 21 1.5 22 2.5 23 4.5 24 2.5 25 2.0 26 4.5 27 7.0 28 6.5 29 5.0 30 9.5 31 15.0 32 20.5 33 31.0 34 38.5 35 46.0 36 62.0 37 90.5 38 115.0 39 131.5 40 161.5 41 204.0 42 239.0 43 262.0 44 278.5 45 285.5 46 279.0 47 265.0 48 247.5 49 214.5 50 187.5 51 168.0 52 145.5 53 116.5 54 87.0 55 69.5 56 53.5 57 40.5 58 29.5 59 19.0 60 12.5 61 9.0 62 6.5 63 4.5 64 3.0 65 2.5 66 3.0 67 2.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.05 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.22999999999999998 55-59 0.375 60-64 0.44 65-69 0.69 70-74 0.745 75-79 0.755 80-84 0.42 85-89 0.375 90-94 0.375 95-99 0.375 100-104 0.38 105-109 0.375 110-114 0.375 115-119 0.375 120-124 0.375 125-129 0.375 130-134 0.375 135-139 0.635 140-144 0.76 145-149 0.905 150-151 1.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26767676767678 98.275 2 0.6060606060606061 1.2 3 0.07575757575757576 0.22499999999999998 4 0.0 0.0 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.025252525252525252 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.7 0.0 0.0 0.0 0.0 138-139 1.9249999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGCC 10 0.006749731 145.55696 1 CCAAACT 10 0.0070117936 143.7375 6 >>END_MODULE Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605448 spots for SRR7169062.sra Written 605448 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra Read 605436 spots for SRR7169062.sra Written 605436 spots for SRR7169062.sra SRR ids: ['SRR7169062.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_85rfrags SRR7169062.sra spots: 12108732 blocks: [[1, 605436], [605437, 1210872], [1210873, 1816308], [1816309, 2421744], [2421745, 3027180], [3027181, 3632616], [3632617, 4238052], [4238053, 4843488], [4843489, 5448924], [5448925, 6054360], [6054361, 6659796], [6659797, 7265232], [7265233, 7870668], [7870669, 8476104], [8476105, 9081540], [9081541, 9686976], [9686977, 10292412], [10292413, 10897848], [10897849, 11503284], [11503285, 12108732]] SRR7169062 file size 4081551 SRR7169062 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169062 SRR7169062_1.fastq SRR7169062_2.fastq Input file: SRR7169062_1.fastq Paired file: SRR7169062_2.fastq trimmed: SRR7169062-trimmed-pair1.fastq, SRR7169062-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:20:45 2025 >> started Mon Feb 10 18:20:59 2025 >> done (14.447s) 12108732 read pairs processed; of these: 27731 ( 0.23%) short read pairs filtered out after trimming by size control 45018 ( 0.37%) empty read pairs filtered out after trimming by size control 12035983 (99.40%) read pairs available; of these: 6371936 (52.94%) trimmed read pairs available after processing 5664047 (47.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 5 0.00% 21 6 0.00% 22 4 0.00% 23 9 0.00% 24 10 0.00% 25 6 0.00% 26 6 0.00% 27 12 0.00% 28 10 0.00% 29 6 0.00% 30 12 0.00% 31 12 0.00% 32 10 0.00% 33 12 0.00% 34 15 0.00% 35 15 0.00% 36 16 0.00% 37 15 0.00% 38 15 0.00% 39 21 0.00% 40 12 0.00% 41 29 0.00% 42 31 0.00% 43 27 0.00% 44 39 0.00% 45 48 0.00% 46 41 0.00% 47 59 0.00% 48 48 0.00% 49 75 0.00% 50 70 0.00% 51 68 0.00% 52 89 0.00% 53 79 0.00% 54 82 0.00% 55 84 0.00% 56 80 0.00% 57 103 0.00% 58 105 0.00% 59 110 0.00% 60 123 0.00% 61 125 0.00% 62 164 0.00% 63 154 0.00% 64 202 0.00% 65 229 0.00% 66 295 0.00% 67 274 0.00% 68 319 0.00% 69 428 0.00% 70 455 0.00% 71 413 0.00% 72 453 0.00% 73 484 0.00% 74 600 0.00% 75 692 0.01% 76 588 0.00% 77 549 0.00% 78 677 0.01% 79 982 0.01% 80 1384 0.01% 81 855 0.01% 82 920 0.01% 83 1226 0.01% 84 2308 0.02% 85 3136 0.03% 86 3252 0.03% 87 3342 0.03% 88 3278 0.03% 89 3270 0.03% 90 3379 0.03% 91 3410 0.03% 92 3635 0.03% 93 3885 0.03% 94 4107 0.03% 95 4408 0.04% 96 4631 0.04% 97 5251 0.04% 98 6025 0.05% 99 7476 0.06% 100 8435 0.07% 101 6035 0.05% 102 6135 0.05% 103 6649 0.06% 104 7151 0.06% 105 7598 0.06% 106 8319 0.07% 107 8937 0.07% 108 9179 0.08% 109 9648 0.08% 110 10016 0.08% 111 10603 0.09% 112 11217 0.09% 113 11739 0.10% 114 12429 0.10% 115 13146 0.11% 116 13819 0.11% 117 14652 0.12% 118 15322 0.13% 119 16162 0.13% 120 16718 0.14% 121 17657 0.15% 122 18263 0.15% 123 19752 0.16% 124 21354 0.18% 125 22414 0.19% 126 23817 0.20% 127 25152 0.21% 128 26535 0.22% 129 28721 0.24% 130 30086 0.25% 131 32410 0.27% 132 34383 0.29% 133 37263 0.31% 134 40101 0.33% 135 43861 0.36% 136 47372 0.39% 137 52247 0.43% 138 57547 0.48% 139 65077 0.54% 140 71235 0.59% 141 79844 0.66% 142 91697 0.76% 143 106143 0.88% 144 128957 1.07% 145 160956 1.34% 146 203123 1.69% 147 281976 2.34% 148 441514 3.67% 149 816582 6.78% 150 3043095 25.28% 151 5664047 47.06% 12035983 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=8.74 fanout-score-rank=19 prefix-density=0.26 prefix-fanout=4.8 sequence=TTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=323.97 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=21.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=6.08 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=3.7 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.05 sequence-density-rank=36 fanout-score=37.14 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=9.0 sequence=GAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169062 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:21:54 Started mapping on | Feb 10 18:21:54 Finished on | Feb 10 18:24:58 Mapping speed, Million of reads per hour | 235.49 Number of input reads | 12035983 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10726737 Uniquely mapped reads % | 89.12% Average mapped length | 295.01 Number of splices: Total | 9094045 Number of splices: Annotated (sjdb) | 8931449 Number of splices: GT/AG | 8958495 Number of splices: GC/AG | 103565 Number of splices: AT/AC | 7461 Number of splices: Non-canonical | 24524 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226530 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 20265 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.78% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1104975 1104975 1104975 N_multimapping 226530 226530 226530 N_noFeature 261703 10588230 315033 N_ambiguous 129618 825 43900 UnstrandedReadsAssigned:10335416 PositiveStrandReadsAssigned:137682 NegativeStrandReadsAssigned:10367804 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169062 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169062-trimmed-pair1.fastq SRR7169062-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,035,983 reads, 10,351,143 reads pseudoaligned [quant] estimated average fragment length: 255.402 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR7169062.ke.tsv 34699 SRR7169062.se.tsv 87100 total ==> SRR7169062.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.6 219 9.64131 Potri.005G024800.1.v4.1 1035 780.598 23 2.28766 Potri.004G059700.1.v4.1 961 706.604 0 0 Potri.007G009000.2.v4.1 1416 1161.6 0 0 Potri.003G141000.2.v4.1 2943 2688.6 84 2.42574 Potri.016G087400.1.v4.1 270 64.75 943.5 1131.34 Potri.015G069301.1.v4.1 564 312.573 0 0 Potri.010G195200.1.v4.1 1773 1518.6 16 0.818029 Potri.012G127500.1.v4.1 977 722.604 5519 592.996 ==> SRR7169062.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 989 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 250 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169062 completed mapping pipeline successfully