Starting /dee2/code/volunteer_pipeline.sh SRR7169063 current disk space = 3057613697024 free memory = 1476045752 SRR7169063 SRAfilesize c48e63ee47a39a51a65f586c62bbf071 SRR7169063.sra SRR7169063.sra file validated SRR7169063 is paired end SRR7169063 is conventional basespace SRR7169063 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169063_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.845 34.0 33.0 34.0 32.0 34.0 2 33.315 34.0 33.0 34.0 33.0 34.0 3 33.31375 34.0 33.0 34.0 33.0 34.0 4 33.415 34.0 34.0 34.0 33.0 34.0 5 33.46725 34.0 34.0 34.0 33.0 34.0 6 37.0 38.0 37.0 38.0 36.0 38.0 7 37.341 38.0 38.0 38.0 37.0 38.0 8 37.4155 38.0 38.0 38.0 37.0 38.0 9 37.4575 38.0 38.0 38.0 37.0 38.0 10-14 37.3669 38.0 38.0 38.0 37.0 38.0 15-19 37.3606 38.0 38.0 38.0 37.0 38.0 20-24 37.22715 38.0 38.0 38.0 36.6 38.0 25-29 37.21625 38.0 38.0 38.0 36.4 38.0 30-34 37.23965 38.0 38.0 38.0 36.6 38.0 35-39 37.054199999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.93855 38.0 38.0 38.0 35.4 38.0 45-49 36.685249999999996 38.0 38.0 38.0 34.2 38.0 50-54 36.630199999999995 38.0 38.0 38.0 34.2 38.0 55-59 36.5809 38.0 38.0 38.0 34.0 38.0 60-64 36.6262 38.0 38.0 38.0 34.2 38.0 65-69 36.4834 38.0 37.8 38.0 33.8 38.0 70-74 36.20305 38.0 37.2 38.0 33.2 38.0 75-79 36.19055 38.0 37.0 38.0 33.2 38.0 80-84 35.68705 38.0 36.6 38.0 30.4 38.0 85-89 35.92745 38.0 37.0 38.0 31.8 38.0 90-94 35.75735 38.0 37.0 38.0 31.0 38.0 95-99 35.38695 38.0 36.0 38.0 29.0 38.0 100-104 35.09779999999999 38.0 35.8 38.0 28.6 38.0 105-109 34.5292 38.0 35.0 38.0 24.8 38.0 110-114 34.53065 38.0 35.0 38.0 25.6 38.0 115-119 34.925650000000005 38.0 35.2 38.0 27.6 38.0 120-124 34.057900000000004 38.0 34.4 38.0 23.0 38.0 125-129 33.7756 38.0 34.0 38.0 22.2 38.0 130-134 33.54445 38.0 34.0 38.0 20.2 38.0 135-139 33.34705 37.8 33.8 38.0 19.0 38.0 140-144 32.12785 36.4 31.8 38.0 14.4 38.0 145-149 31.209899999999998 36.0 31.0 38.0 11.4 38.0 150-151 26.823 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 0.0 13 1.0 14 3.0 15 5.0 16 1.0 17 3.0 18 5.0 19 4.0 20 8.0 21 16.0 22 9.0 23 14.0 24 16.0 25 16.0 26 22.0 27 26.0 28 52.0 29 62.0 30 73.0 31 107.0 32 123.0 33 185.0 34 288.0 35 442.0 36 953.0 37 1563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.5118230358505 14.340198321891688 10.882278159166031 35.26570048309179 2 23.825 13.675 32.975 29.525000000000002 3 19.625 19.3 26.200000000000003 34.875 4 21.9 26.075 24.325 27.700000000000003 5 23.275000000000002 30.599999999999998 24.45 21.675 6 20.775 33.5 24.9 20.825 7 14.05 27.775 39.925 18.25 8 17.8 26.0 31.55 24.65 9 16.825000000000003 25.874999999999996 33.625 23.674999999999997 10-14 19.775000000000002 29.735 27.365000000000002 23.125 15-19 20.135 28.299999999999997 27.845 23.72 20-24 19.755 28.935 27.384999999999998 23.925 25-29 19.45 29.054999999999996 27.565 23.93 30-34 20.01 28.79 27.200000000000003 24.0 35-39 19.86 28.815 27.589999999999996 23.735 40-44 20.215 28.865000000000002 27.105 23.815 45-49 20.424999999999997 28.754999999999995 27.125 23.695 50-54 20.175 27.935 27.63 24.26 55-59 20.455000000000002 28.139999999999997 27.229999999999997 24.175 60-64 20.62 28.28 27.334999999999997 23.765 65-69 20.3 28.15 27.99 23.56 70-74 20.419999999999998 28.194999999999997 27.51 23.875 75-79 20.055 28.125 27.345000000000002 24.474999999999998 80-84 20.355 27.915 27.625 24.104999999999997 85-89 20.415 28.29 27.855 23.44 90-94 20.54 28.560000000000002 27.29 23.61 95-99 19.830000000000002 28.025 28.395 23.75 100-104 20.48 28.07 27.145000000000003 24.305 105-109 20.91 28.23 27.615000000000002 23.244999999999997 110-114 20.724999999999998 28.095 27.839999999999996 23.34 115-119 20.485 28.060000000000002 27.48 23.974999999999998 120-124 20.925 28.255000000000003 27.544999999999998 23.275000000000002 125-129 20.715 28.15 27.045 24.09 130-134 21.055 27.794999999999998 27.665 23.485 135-139 20.419999999999998 27.884999999999998 27.555000000000003 24.14 140-144 20.985 27.544999999999998 27.58 23.89 145-149 20.495 27.845 27.21 24.45 150-151 20.8875 27.3875 27.6125 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.5 18 1.5 19 2.0 20 1.5 21 1.0 22 1.0 23 2.0 24 2.0 25 2.0 26 3.0 27 3.0 28 6.5 29 9.5 30 12.5 31 22.0 32 36.0 33 36.0 34 42.5 35 68.5 36 81.0 37 97.0 38 123.5 39 143.5 40 180.5 41 218.5 42 240.5 43 259.0 44 263.5 45 269.0 46 274.0 47 275.5 48 247.0 49 200.5 50 190.5 51 169.0 52 127.5 53 104.5 54 79.0 55 56.5 56 43.5 57 32.0 58 18.5 59 11.0 60 11.0 61 7.5 62 6.0 63 3.5 64 2.0 65 2.0 66 1.0 67 1.5 68 2.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.2875 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.4125 0.0 0.0 0.0 0.0 126-127 0.4875 0.0 0.0 0.0 0.0 128-129 0.5625 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.7124999999999999 0.0 0.0 0.0 0.0 134-135 0.8125 0.0 0.0 0.0 0.0 136-137 0.8875 0.0 0.0 0.0 0.0 138-139 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCTC 45 0.008960331 48.329166 7 >>END_MODULE SRR7169063 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169063_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96175 33.0 33.0 34.0 32.0 34.0 2 32.9355 34.0 33.0 34.0 32.0 34.0 3 33.0485 34.0 33.0 34.0 32.0 34.0 4 32.86625 34.0 33.0 34.0 32.0 34.0 5 32.9905 34.0 33.0 34.0 32.0 34.0 6 37.192 38.0 38.0 38.0 37.0 38.0 7 37.17975 38.0 38.0 38.0 37.0 38.0 8 37.17175 38.0 38.0 38.0 37.0 38.0 9 36.96975 38.0 38.0 38.0 36.0 38.0 10-14 36.963 38.0 38.0 38.0 36.2 38.0 15-19 37.183699999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.150349999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.0752 38.0 38.0 38.0 37.0 38.0 30-34 37.08365 38.0 38.0 38.0 37.0 38.0 35-39 36.953649999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.9017 38.0 38.0 38.0 36.0 38.0 45-49 36.96795 38.0 38.0 38.0 36.2 38.0 50-54 37.0323 38.0 38.0 38.0 36.6 38.0 55-59 36.97165 38.0 38.0 38.0 36.0 38.0 60-64 36.820100000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.84615 38.0 38.0 38.0 36.0 38.0 70-74 36.773450000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.693599999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.51185 38.0 38.0 38.0 34.4 38.0 85-89 36.4853 38.0 38.0 38.0 34.4 38.0 90-94 36.25015 38.0 38.0 38.0 33.6 38.0 95-99 36.503 38.0 38.0 38.0 34.6 38.0 100-104 36.35045 38.0 38.0 38.0 34.0 38.0 105-109 36.2647 38.0 38.0 38.0 33.8 38.0 110-114 35.904849999999996 38.0 37.0 38.0 32.6 38.0 115-119 35.890049999999995 38.0 37.4 38.0 32.4 38.0 120-124 35.8147 38.0 37.0 38.0 31.6 38.0 125-129 35.40905 38.0 36.2 38.0 30.4 38.0 130-134 35.027100000000004 38.0 36.0 38.0 27.8 38.0 135-139 34.85785 38.0 35.6 38.0 28.0 38.0 140-144 34.63605 38.0 35.2 38.0 27.4 38.0 145-149 33.9187 38.0 35.0 38.0 22.8 38.0 150-151 30.3635 36.0 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 0.0 11 2.0 12 1.0 13 1.0 14 4.0 15 0.0 16 1.0 17 1.0 18 3.0 19 6.0 20 9.0 21 8.0 22 7.0 23 9.0 24 11.0 25 17.0 26 23.0 27 25.0 28 39.0 29 46.0 30 46.0 31 55.0 32 74.0 33 105.0 34 143.0 35 212.0 36 481.0 37 2658.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.225 23.150000000000002 14.875 25.75 2 27.85 26.400000000000002 28.075 17.675 3 20.27027027027027 29.354354354354356 31.681681681681685 18.693693693693696 4 23.623623623623622 34.15915915915916 23.3983983983984 18.81881881881882 5 24.91868901676257 35.551663747810856 21.36602451838879 18.16362271703778 6 21.25 37.775 22.85 18.125 7 21.075 23.65 36.975 18.3 8 21.95 25.525 27.275 25.25 9 22.175 25.324999999999996 28.95 23.549999999999997 10-14 23.105 28.95 26.674999999999997 21.27 15-19 22.675 28.08 27.450000000000003 21.795 20-24 23.155 28.585 27.26 21.0 25-29 23.57 28.24 27.345000000000002 20.845 30-34 22.7 28.285 27.96 21.055 35-39 22.975 28.43 27.62 20.974999999999998 40-44 23.22 28.000000000000004 27.66 21.12 45-49 23.285 28.435 27.04 21.240000000000002 50-54 23.064999999999998 28.62 27.85 20.465 55-59 24.065 27.38 27.79 20.765 60-64 22.955000000000002 28.415000000000003 28.34 20.29 65-69 23.645 27.615000000000002 27.544999999999998 21.195 70-74 23.72 27.615000000000002 27.985 20.68 75-79 24.104999999999997 27.18 28.04 20.674999999999997 80-84 23.849999999999998 27.71 27.41 21.029999999999998 85-89 24.035 27.855 27.305 20.805 90-94 24.154999999999998 27.284999999999997 27.575 20.985 95-99 23.830000000000002 27.345000000000002 28.060000000000002 20.765 100-104 23.11 28.13 27.845 20.915 105-109 23.98 27.794999999999998 27.685 20.54 110-114 24.2 27.02 27.950000000000003 20.830000000000002 115-119 24.015 27.88 27.595 20.51 120-124 24.11 27.625 27.794999999999998 20.47 125-129 23.549999999999997 27.445000000000004 28.144999999999996 20.86 130-134 23.695 28.065 27.415 20.825 135-139 24.065 27.334999999999997 27.955000000000002 20.645 140-144 23.674999999999997 28.360000000000003 26.584999999999997 21.38 145-149 24.095 27.865000000000002 27.310000000000002 20.73 150-151 23.9875 28.225 27.400000000000002 20.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 2.5 26 3.5 27 3.5 28 4.0 29 5.5 30 7.5 31 13.0 32 14.5 33 20.5 34 39.0 35 52.0 36 66.0 37 91.0 38 117.5 39 154.0 40 187.0 41 223.0 42 267.0 43 303.5 44 316.0 45 301.0 46 288.5 47 266.5 48 246.5 49 226.0 50 184.5 51 149.0 52 127.0 53 96.5 54 66.5 55 45.5 56 31.0 57 18.5 58 9.5 59 12.5 60 12.5 61 9.5 62 6.0 63 2.0 64 0.5 65 0.5 66 0.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.1 4 0.1 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.2625 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.42500000000000004 0.0 0.0 0.0 0.0 126-127 0.4875 0.0 0.0 0.0 0.0 128-129 0.5625 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.7124999999999999 0.0 0.0 0.0 0.0 134-135 0.825 0.0 0.0 0.0 0.0 136-137 0.9125 0.0 0.0 0.0 0.0 138-139 1.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920133 spots for SRR7169063.sra Written 920133 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra Read 920118 spots for SRR7169063.sra Written 920118 spots for SRR7169063.sra SRR ids: ['SRR7169063.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0mrn74_8 SRR7169063.sra spots: 18402375 blocks: [[1, 920118], [920119, 1840236], [1840237, 2760354], [2760355, 3680472], [3680473, 4600590], [4600591, 5520708], [5520709, 6440826], [6440827, 7360944], [7360945, 8281062], [8281063, 9201180], [9201181, 10121298], [10121299, 11041416], [11041417, 11961534], [11961535, 12881652], [12881653, 13801770], [13801771, 14721888], [14721889, 15642006], [15642007, 16562124], [16562125, 17482242], [17482243, 18402375]] SRR7169063 file size 6214260 SRR7169063 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169063 SRR7169063_1.fastq SRR7169063_2.fastq Input file: SRR7169063_1.fastq Paired file: SRR7169063_2.fastq trimmed: SRR7169063-trimmed-pair1.fastq, SRR7169063-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:24:05 2025 >> started Mon Feb 10 18:24:25 2025 >> done (19.968s) 18402375 read pairs processed; of these: 16974 ( 0.09%) short read pairs filtered out after trimming by size control 10939 ( 0.06%) empty read pairs filtered out after trimming by size control 18374462 (99.85%) read pairs available; of these: 7766954 (42.27%) trimmed read pairs available after processing 10607508 (57.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 0 0.00% 25 1 0.00% 26 9 0.00% 27 8 0.00% 28 5 0.00% 29 4 0.00% 30 10 0.00% 31 7 0.00% 32 4 0.00% 33 8 0.00% 34 4 0.00% 35 5 0.00% 36 6 0.00% 37 8 0.00% 38 6 0.00% 39 14 0.00% 40 14 0.00% 41 8 0.00% 42 11 0.00% 43 12 0.00% 44 13 0.00% 45 11 0.00% 46 14 0.00% 47 17 0.00% 48 20 0.00% 49 20 0.00% 50 28 0.00% 51 24 0.00% 52 12 0.00% 53 30 0.00% 54 45 0.00% 55 23 0.00% 56 34 0.00% 57 39 0.00% 58 45 0.00% 59 62 0.00% 60 56 0.00% 61 52 0.00% 62 63 0.00% 63 58 0.00% 64 66 0.00% 65 94 0.00% 66 86 0.00% 67 117 0.00% 68 126 0.00% 69 194 0.00% 70 180 0.00% 71 156 0.00% 72 190 0.00% 73 205 0.00% 74 221 0.00% 75 234 0.00% 76 256 0.00% 77 311 0.00% 78 329 0.00% 79 392 0.00% 80 468 0.00% 81 523 0.00% 82 605 0.00% 83 731 0.00% 84 1505 0.01% 85 2114 0.01% 86 2075 0.01% 87 2276 0.01% 88 2306 0.01% 89 2313 0.01% 90 2424 0.01% 91 2506 0.01% 92 2674 0.01% 93 2863 0.02% 94 3060 0.02% 95 3123 0.02% 96 3361 0.02% 97 3638 0.02% 98 3726 0.02% 99 3964 0.02% 100 4401 0.02% 101 4602 0.03% 102 4952 0.03% 103 5218 0.03% 104 5611 0.03% 105 6033 0.03% 106 6493 0.04% 107 6847 0.04% 108 7351 0.04% 109 7710 0.04% 110 8211 0.04% 111 9011 0.05% 112 9505 0.05% 113 9995 0.05% 114 10635 0.06% 115 11249 0.06% 116 12075 0.07% 117 12621 0.07% 118 13546 0.07% 119 14125 0.08% 120 15179 0.08% 121 15636 0.09% 122 16780 0.09% 123 17983 0.10% 124 19267 0.10% 125 20819 0.11% 126 22144 0.12% 127 23931 0.13% 128 25167 0.14% 129 26861 0.15% 130 29028 0.16% 131 31383 0.17% 132 33711 0.18% 133 36866 0.20% 134 39663 0.22% 135 43178 0.23% 136 47786 0.26% 137 52410 0.29% 138 58106 0.32% 139 64027 0.35% 140 71305 0.39% 141 80125 0.44% 142 92225 0.50% 143 107204 0.58% 144 128861 0.70% 145 158708 0.86% 146 206246 1.12% 147 285110 1.55% 148 446341 2.43% 149 888259 4.83% 150 4442210 24.18% 151 10607508 57.73% 18374462 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=35 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=264.46 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=18.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=41 prefix-density=0.22 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=10 fanout-score=46.21 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=12.4 sequence=TGTTGGTGGTGG SRR7169063 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:25:14 Started mapping on | Feb 10 18:25:14 Finished on | Feb 10 18:26:52 Mapping speed, Million of reads per hour | 674.98 Number of input reads | 18374462 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17528459 Uniquely mapped reads % | 95.40% Average mapped length | 297.57 Number of splices: Total | 16752685 Number of splices: Annotated (sjdb) | 16488376 Number of splices: GT/AG | 16521303 Number of splices: GC/AG | 183488 Number of splices: AT/AC | 12642 Number of splices: Non-canonical | 35252 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304411 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 17408 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 559799 559799 559799 N_multimapping 304411 304411 304411 N_noFeature 333333 17303939 421111 N_ambiguous 212776 1355 74988 UnstrandedReadsAssigned:16982350 PositiveStrandReadsAssigned:223165 NegativeStrandReadsAssigned:17032360 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169063 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169063-trimmed-pair1.fastq SRR7169063-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,374,462 reads, 16,867,690 reads pseudoaligned [quant] estimated average fragment length: 276.066 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7169063.ke.tsv 34699 SRR7169063.se.tsv 87100 total ==> SRR7169063.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.93 363 11.5031 Potri.005G024800.1.v4.1 1035 759.934 47 3.41594 Potri.004G059700.1.v4.1 961 685.975 7 0.563609 Potri.007G009000.2.v4.1 1416 1140.93 0 0 Potri.003G141000.2.v4.1 2943 2667.93 307.034 6.35622 Potri.016G087400.1.v4.1 270 59.9207 1450 1336.53 Potri.015G069301.1.v4.1 564 295.134 0 0 Potri.010G195200.1.v4.1 1773 1497.93 25 0.921798 Potri.012G127500.1.v4.1 977 701.962 4723 371.615 ==> SRR7169063.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1641 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 348 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169063 completed mapping pipeline successfully