Starting /dee2/code/volunteer_pipeline.sh SRR7169064 current disk space = 3057351073792 free memory = 1528411148 SRR7169064 SRAfilesize 1eca14b96fe010c08b46770889d237fb SRR7169064.sra SRR7169064.sra file validated SRR7169064 is paired end SRR7169064 is conventional basespace SRR7169064 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169064_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6475 34.0 33.0 34.0 33.0 34.0 2 33.31425 34.0 33.0 34.0 32.0 34.0 3 33.32775 34.0 33.0 34.0 33.0 34.0 4 33.42325 34.0 33.0 34.0 33.0 34.0 5 33.4565 34.0 33.0 34.0 33.0 34.0 6 37.088 38.0 37.0 38.0 36.0 38.0 7 37.28525 38.0 38.0 38.0 37.0 38.0 8 37.42775 38.0 38.0 38.0 37.0 38.0 9 37.409 38.0 38.0 38.0 37.0 38.0 10-14 37.09995 38.0 38.0 38.0 35.8 38.0 15-19 37.10015 38.0 38.0 38.0 36.0 38.0 20-24 37.38175 38.0 38.0 38.0 37.0 38.0 25-29 37.19055000000001 38.0 38.0 38.0 36.2 38.0 30-34 37.253 38.0 38.0 38.0 36.8 38.0 35-39 37.24725 38.0 38.0 38.0 36.4 38.0 40-44 37.09135 38.0 38.0 38.0 36.2 38.0 45-49 36.86135 38.0 38.0 38.0 35.0 38.0 50-54 36.73825 38.0 38.0 38.0 34.8 38.0 55-59 36.34665 38.0 37.4 38.0 33.6 38.0 60-64 36.5535 38.0 38.0 38.0 34.0 38.0 65-69 36.36319999999999 38.0 37.4 38.0 33.4 38.0 70-74 36.26525 38.0 37.4 38.0 33.6 38.0 75-79 36.281949999999995 38.0 37.2 38.0 33.6 38.0 80-84 36.246300000000005 38.0 37.0 38.0 33.4 38.0 85-89 35.93055 38.0 37.0 38.0 31.8 38.0 90-94 35.7106 38.0 36.8 38.0 30.4 38.0 95-99 35.8157 38.0 37.0 38.0 31.8 38.0 100-104 35.366 38.0 36.0 38.0 29.0 38.0 105-109 34.66395 38.0 35.0 38.0 24.4 38.0 110-114 35.06945 38.0 35.6 38.0 27.8 38.0 115-119 35.15839999999999 38.0 36.0 38.0 28.6 38.0 120-124 34.8486 38.0 35.0 38.0 27.6 38.0 125-129 34.0085 38.0 34.4 38.0 22.2 38.0 130-134 34.3711 38.0 34.8 38.0 25.8 38.0 135-139 33.82090000000001 38.0 34.0 38.0 22.6 38.0 140-144 32.836850000000005 38.0 33.2 38.0 15.6 38.0 145-149 32.3962 38.0 33.2 38.0 14.0 38.0 150-151 28.610625 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 1.0 10 2.0 11 0.0 12 0.0 13 2.0 14 0.0 15 2.0 16 1.0 17 2.0 18 4.0 19 1.0 20 4.0 21 5.0 22 7.0 23 12.0 24 18.0 25 20.0 26 32.0 27 23.0 28 56.0 29 61.0 30 79.0 31 91.0 32 118.0 33 145.0 34 225.0 35 357.0 36 886.0 37 1843.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.75775442194309 13.253012048192772 9.382209689823123 32.607023840041016 2 25.45 13.675 31.025000000000002 29.849999999999998 3 19.8 19.75 28.000000000000004 32.45 4 23.1 27.700000000000003 23.95 25.25 5 23.925 32.0 23.425 20.65 6 19.975 35.3 23.599999999999998 21.125 7 15.174999999999999 27.250000000000004 40.425 17.150000000000002 8 17.4 26.275 30.625000000000004 25.7 9 18.575 24.349999999999998 33.45 23.625 10-14 20.474999999999998 29.89 27.200000000000003 22.435 15-19 19.744999999999997 28.835 27.72 23.7 20-24 20.18 28.925 27.639999999999997 23.255 25-29 20.0 29.459999999999997 27.389999999999997 23.150000000000002 30-34 19.465 28.84 27.24 24.455 35-39 20.235 28.854999999999997 26.979999999999997 23.93 40-44 20.025000000000002 29.299999999999997 27.24 23.435 45-49 20.215 28.535 27.57 23.68 50-54 19.830000000000002 29.549999999999997 27.27 23.35 55-59 20.49 29.459999999999997 26.529999999999998 23.52 60-64 20.605 29.020000000000003 26.93 23.445 65-69 20.325 29.005 27.255000000000003 23.415 70-74 20.0880132019803 29.11936790518578 27.114067110066507 23.678551782767414 75-79 20.22101105055253 28.97144857242862 27.316365818290915 23.491174558727938 80-84 20.642064206420642 28.227822782278228 27.457745774577457 23.672367236723673 85-89 20.169999999999998 28.660000000000004 27.785 23.385 90-94 20.332033203320332 28.562856285628563 27.457745774577457 23.647364736473648 95-99 20.549999999999997 29.049999999999997 26.88 23.52 100-104 20.665 28.58 27.250000000000004 23.505000000000003 105-109 20.119999999999997 28.04 27.889999999999997 23.95 110-114 20.82208220822082 28.197819781978197 27.627762776277624 23.352335233523352 115-119 20.10701070107011 28.467846784678468 27.45274527452745 23.97239723972397 120-124 20.363054458168726 28.199229884482673 27.704155623343503 23.733560034005098 125-129 20.193028954343152 28.264239635945394 27.20908136220433 24.333650047507128 130-134 21.15 28.134999999999998 26.99 23.724999999999998 135-139 20.79 27.58 27.715 23.915 140-144 20.810000000000002 28.449999999999996 27.185 23.555 145-149 20.41602080104005 28.106405320266013 27.471373568678437 24.0062003100155 150-151 21.277659707463435 27.94099262407801 26.903362920365048 23.87798474809351 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.0 24 1.5 25 1.0 26 1.0 27 4.5 28 10.5 29 15.5 30 18.5 31 27.5 32 37.0 33 42.5 34 60.0 35 71.0 36 85.0 37 108.5 38 123.0 39 151.0 40 180.5 41 207.0 42 242.0 43 267.5 44 275.0 45 266.0 46 278.5 47 270.5 48 229.0 49 208.5 50 176.5 51 137.0 52 114.0 53 94.0 54 72.0 55 53.0 56 40.0 57 33.5 58 23.5 59 12.5 60 11.5 61 9.5 62 6.0 63 5.0 64 5.5 65 4.5 66 1.5 67 2.0 68 2.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.005 80-84 0.01 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.01 120-124 0.015 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.07500000000000001 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3625 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8500000000000001 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 1.0499999999999998 0.0 0.0 0.0 0.0 136-137 1.1625 0.0 0.0 0.0 0.0 138-139 1.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169064 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169064_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82775 33.0 33.0 34.0 32.0 34.0 2 32.988 34.0 33.0 34.0 32.0 34.0 3 32.93825 34.0 33.0 34.0 32.0 34.0 4 32.802 34.0 33.0 34.0 32.0 34.0 5 32.947 34.0 33.0 34.0 32.0 34.0 6 37.046 38.0 38.0 38.0 36.0 38.0 7 36.9295 38.0 38.0 38.0 36.0 38.0 8 37.03275 38.0 38.0 38.0 37.0 38.0 9 36.6795 38.0 38.0 38.0 36.0 38.0 10-14 36.777 38.0 38.0 38.0 35.8 38.0 15-19 36.897450000000006 38.0 38.0 38.0 36.2 38.0 20-24 36.7648 38.0 38.0 38.0 35.8 38.0 25-29 36.91185 38.0 38.0 38.0 36.0 38.0 30-34 36.9084 38.0 38.0 38.0 36.0 38.0 35-39 36.49535 38.0 38.0 38.0 34.8 38.0 40-44 36.54615 38.0 38.0 38.0 34.6 38.0 45-49 36.77235 38.0 38.0 38.0 35.8 38.0 50-54 36.823350000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.639700000000005 38.0 38.0 38.0 34.8 38.0 60-64 36.693650000000005 38.0 38.0 38.0 35.4 38.0 65-69 36.62675 38.0 38.0 38.0 35.0 38.0 70-74 36.249399999999994 38.0 38.0 38.0 33.8 38.0 75-79 36.347249999999995 38.0 38.0 38.0 33.8 38.0 80-84 36.32875 38.0 38.0 38.0 34.0 38.0 85-89 36.0142 38.0 37.8 38.0 32.8 38.0 90-94 35.9827 38.0 38.0 38.0 32.6 38.0 95-99 36.064350000000005 38.0 38.0 38.0 33.4 38.0 100-104 36.004450000000006 38.0 37.8 38.0 33.4 38.0 105-109 35.640100000000004 38.0 37.2 38.0 31.2 38.0 110-114 35.24175 38.0 36.8 38.0 28.6 38.0 115-119 35.0629 38.0 36.0 38.0 27.4 38.0 120-124 35.220549999999996 38.0 36.2 38.0 28.6 38.0 125-129 35.11 38.0 36.0 38.0 28.8 38.0 130-134 34.46995 38.0 35.2 38.0 24.2 38.0 135-139 33.7465 38.0 34.6 38.0 19.0 38.0 140-144 34.013999999999996 38.0 35.0 38.0 22.6 38.0 145-149 33.5137 38.0 35.0 38.0 18.6 38.0 150-151 30.1555 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 2.0 5 2.0 6 1.0 7 3.0 8 2.0 9 1.0 10 1.0 11 1.0 12 2.0 13 2.0 14 2.0 15 7.0 16 6.0 17 1.0 18 10.0 19 10.0 20 11.0 21 7.0 22 11.0 23 12.0 24 20.0 25 25.0 26 26.0 27 31.0 28 33.0 29 48.0 30 56.0 31 71.0 32 91.0 33 113.0 34 168.0 35 241.0 36 473.0 37 2500.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45851090498872 24.442216094259212 13.38681373777889 22.712459262973177 2 29.45 26.25 27.3 17.0 3 22.25 27.950000000000003 31.125000000000004 18.675 4 22.900000000000002 33.4 24.0 19.7 5 24.675 36.6 20.275000000000002 18.45 6 21.6 37.675 21.875 18.85 7 20.325 23.3 37.4 18.975 8 22.05 25.775 26.924999999999997 25.25 9 22.05 25.124999999999996 28.749999999999996 24.075 10-14 22.78113905695285 29.141457072853644 26.21131056552828 21.86609330466523 15-19 23.411170558527928 28.191409570478527 27.141357067853395 21.256062803140157 20-24 23.332333233323332 28.277827782778274 27.782778277827784 20.607060706070605 25-29 23.91097774443611 28.067016754188543 27.101775443860966 20.920230057514377 30-34 23.131939581874562 28.06842052615785 27.738321496448936 21.061318395518654 35-39 23.215803950987745 28.16704176044011 27.56689172293073 21.05026256564141 40-44 23.087698234028718 28.155485517034368 27.39506728700786 21.36174896192906 45-49 23.071921576472942 28.22846854056217 27.58327498249475 21.11633490047014 50-54 23.258140349122193 28.249887460611212 27.649677387085482 20.84229480318111 55-59 23.880000000000003 27.825 27.355 20.94 60-64 23.040760190047514 27.62690672668167 28.22705676419105 21.10527631907977 65-69 23.40468093618724 27.955591118223644 27.625525105021005 21.014202840568114 70-74 23.35350302545382 27.664149622443368 27.529129369405407 21.453217982697403 75-79 23.415853963490875 27.35683920980245 28.652163040760193 20.575143785946487 80-84 23.385523485568505 27.152218498324242 28.332749737381825 21.129508278725424 85-89 23.771188559427973 27.281364068203413 28.351417570878546 20.596029801490072 90-94 23.56089022255564 27.20180045011253 28.232058014503625 21.005251312828207 95-99 23.67210163048915 28.108432529758925 27.403220966289886 20.81624487346204 100-104 23.01230123012301 28.06280628062806 27.682768276827684 21.242124212421242 105-109 23.84192096048024 27.743871935967984 28.329164582291146 20.08504252126063 110-114 24.110849882447102 27.06217798009104 27.992596668500823 20.834375468961035 115-119 23.935983995999 27.581895473868467 27.45686421605401 21.02525631407852 120-124 24.299859971994398 26.980396079215847 28.325665133026607 20.39407881576315 125-129 23.570892723180794 28.042010502625658 27.76694173543386 20.62015503875969 130-134 23.532649487115336 27.805854390793094 28.261195896922693 20.400300225168877 135-139 23.668017409575267 27.870328680774424 27.500125068787835 20.961528840862474 140-144 23.427885336935315 28.27054880184101 27.154935214367903 21.146630646855773 145-149 23.70185092546273 27.738869434717362 27.423711855927962 21.135567783891947 150-151 23.845865131990493 27.336419366946078 27.98698861503816 20.83072688602527 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.5 25 3.0 26 3.5 27 2.0 28 3.5 29 6.5 30 10.5 31 16.0 32 23.5 33 31.0 34 40.0 35 49.5 36 65.5 37 104.0 38 138.5 39 157.0 40 196.5 41 233.5 42 243.5 43 282.0 44 303.0 45 282.5 46 280.0 47 267.5 48 232.0 49 200.0 50 168.0 51 135.5 52 127.5 53 106.0 54 69.5 55 47.5 56 38.5 57 33.0 58 21.5 59 16.0 60 14.0 61 9.5 62 8.0 63 9.5 64 5.0 65 2.0 66 2.0 67 1.0 68 1.5 69 3.5 70 2.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.005 20-24 0.01 25-29 0.025 30-34 0.03 35-39 0.025 40-44 0.055 45-49 0.03 50-54 0.034999999999999996 55-59 0.0 60-64 0.025 65-69 0.02 70-74 0.015 75-79 0.025 80-84 0.045 85-89 0.005 90-94 0.025 95-99 0.03 100-104 0.01 105-109 0.05 110-114 0.045 115-119 0.025 120-124 0.02 125-129 0.025 130-134 0.075 135-139 0.055 140-144 0.055 145-149 0.05 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.07500000000000001 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3625 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.8999999999999999 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138-139 1.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAAA 10 0.006577216 146.82278 1 >>END_MODULE Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra Read 951885 spots for SRR7169064.sra Written 951885 spots for SRR7169064.sra SRR ids: ['SRR7169064.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7vaw2paq SRR7169064.sra spots: 19037700 blocks: [[1, 951885], [951886, 1903770], [1903771, 2855655], [2855656, 3807540], [3807541, 4759425], [4759426, 5711310], [5711311, 6663195], [6663196, 7615080], [7615081, 8566965], [8566966, 9518850], [9518851, 10470735], [10470736, 11422620], [11422621, 12374505], [12374506, 13326390], [13326391, 14278275], [14278276, 15230160], [15230161, 16182045], [16182046, 17133930], [17133931, 18085815], [18085816, 19037700]] SRR7169064 file size 6429551 SRR7169064 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169064 SRR7169064_1.fastq SRR7169064_2.fastq Input file: SRR7169064_1.fastq Paired file: SRR7169064_2.fastq trimmed: SRR7169064-trimmed-pair1.fastq, SRR7169064-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:49:03 2025 >> started Mon Feb 10 18:49:26 2025 >> done (22.357s) 19037700 read pairs processed; of these: 18422 ( 0.10%) short read pairs filtered out after trimming by size control 10217 ( 0.05%) empty read pairs filtered out after trimming by size control 19009061 (99.85%) read pairs available; of these: 9057607 (47.65%) trimmed read pairs available after processing 9951454 (52.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 5 0.00% 21 2 0.00% 22 6 0.00% 23 4 0.00% 24 6 0.00% 25 5 0.00% 26 7 0.00% 27 10 0.00% 28 5 0.00% 29 10 0.00% 30 9 0.00% 31 7 0.00% 32 11 0.00% 33 8 0.00% 34 9 0.00% 35 8 0.00% 36 8 0.00% 37 12 0.00% 38 11 0.00% 39 14 0.00% 40 12 0.00% 41 17 0.00% 42 22 0.00% 43 27 0.00% 44 32 0.00% 45 30 0.00% 46 31 0.00% 47 36 0.00% 48 34 0.00% 49 42 0.00% 50 32 0.00% 51 40 0.00% 52 33 0.00% 53 45 0.00% 54 50 0.00% 55 47 0.00% 56 62 0.00% 57 66 0.00% 58 81 0.00% 59 72 0.00% 60 94 0.00% 61 116 0.00% 62 121 0.00% 63 136 0.00% 64 184 0.00% 65 192 0.00% 66 242 0.00% 67 247 0.00% 68 182 0.00% 69 241 0.00% 70 236 0.00% 71 317 0.00% 72 323 0.00% 73 349 0.00% 74 369 0.00% 75 367 0.00% 76 410 0.00% 77 579 0.00% 78 554 0.00% 79 602 0.00% 80 679 0.00% 81 847 0.00% 82 911 0.00% 83 1125 0.01% 84 2037 0.01% 85 2527 0.01% 86 2660 0.01% 87 2731 0.01% 88 2827 0.01% 89 2856 0.02% 90 3066 0.02% 91 3214 0.02% 92 3161 0.02% 93 3540 0.02% 94 3382 0.02% 95 3681 0.02% 96 3968 0.02% 97 4107 0.02% 98 4492 0.02% 99 4774 0.03% 100 5219 0.03% 101 5664 0.03% 102 5918 0.03% 103 6354 0.03% 104 6616 0.03% 105 7376 0.04% 106 7661 0.04% 107 8186 0.04% 108 8748 0.05% 109 9205 0.05% 110 9729 0.05% 111 10643 0.06% 112 11231 0.06% 113 11961 0.06% 114 12920 0.07% 115 13850 0.07% 116 14560 0.08% 117 15544 0.08% 118 16414 0.09% 119 17405 0.09% 120 18203 0.10% 121 19559 0.10% 122 20814 0.11% 123 22068 0.12% 124 23969 0.13% 125 26278 0.14% 126 27836 0.15% 127 30022 0.16% 128 31722 0.17% 129 34367 0.18% 130 36626 0.19% 131 39757 0.21% 132 43714 0.23% 133 46796 0.25% 134 51750 0.27% 135 56642 0.30% 136 61952 0.33% 137 68559 0.36% 138 76465 0.40% 139 84836 0.45% 140 94568 0.50% 141 107593 0.57% 142 127102 0.67% 143 143228 0.75% 144 173458 0.91% 145 216286 1.14% 146 278947 1.47% 147 382019 2.01% 148 581923 3.06% 149 1144919 6.02% 150 4717001 24.81% 151 9951454 52.35% 19009061 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=264.53 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=35 prefix-density=0.25 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.14 sequence-density-rank=9 fanout-score=51.76 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=13.7 sequence=TGTTGGTGGTGG SRR7169064 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:50:11 Started mapping on | Feb 10 18:50:11 Finished on | Feb 10 18:52:36 Mapping speed, Million of reads per hour | 471.95 Number of input reads | 19009061 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17585649 Uniquely mapped reads % | 92.51% Average mapped length | 296.56 Number of splices: Total | 16672748 Number of splices: Annotated (sjdb) | 16408414 Number of splices: GT/AG | 16432926 Number of splices: GC/AG | 191050 Number of splices: AT/AC | 13432 Number of splices: Non-canonical | 35340 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338610 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 68735 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.23% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1106305 1106305 1106305 N_multimapping 338610 338610 338610 N_noFeature 391219 17388602 467885 N_ambiguous 198417 1273 77049 UnstrandedReadsAssigned:16996013 PositiveStrandReadsAssigned:195774 NegativeStrandReadsAssigned:17040715 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169064 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169064-trimmed-pair1.fastq SRR7169064-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,009,061 reads, 16,975,327 reads pseudoaligned [quant] estimated average fragment length: 281.941 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,252 rounds 52401 SRR7169064.ke.tsv 34699 SRR7169064.se.tsv 87100 total ==> SRR7169064.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.06 365 11.2053 Potri.005G024800.1.v4.1 1035 754.059 43 3.04093 Potri.004G059700.1.v4.1 961 680.092 2 0.156821 Potri.007G009000.2.v4.1 1416 1135.06 0 0 Potri.003G141000.2.v4.1 2943 2662.06 372.125 7.45442 Potri.016G087400.1.v4.1 270 59.5802 1175 1051.67 Potri.015G069301.1.v4.1 564 290.748 0 0 Potri.010G195200.1.v4.1 1773 1492.06 7 0.250182 Potri.012G127500.1.v4.1 977 696.079 5856 448.627 ==> SRR7169064.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1468 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 370 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169064 completed mapping pipeline successfully