Starting /dee2/code/volunteer_pipeline.sh SRR7169065 current disk space = 3057415684096 free memory = 1529090768 SRR7169065 SRAfilesize 0142bdb59dee0fa9108b0981a4e494a1 SRR7169065.sra SRR7169065.sra file validated SRR7169065 is paired end SRR7169065 is conventional basespace SRR7169065 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169065_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94275 34.0 33.0 34.0 33.0 34.0 2 33.32925 34.0 34.0 34.0 33.0 34.0 3 33.39025 34.0 34.0 34.0 33.0 34.0 4 33.496 34.0 34.0 34.0 33.0 34.0 5 33.40975 34.0 34.0 34.0 33.0 34.0 6 36.935 38.0 37.0 38.0 35.0 38.0 7 37.298 38.0 38.0 38.0 36.0 38.0 8 37.461 38.0 38.0 38.0 37.0 38.0 9 37.431 38.0 38.0 38.0 37.0 38.0 10-14 37.4711 38.0 38.0 38.0 37.2 38.0 15-19 37.44215 38.0 38.0 38.0 37.0 38.0 20-24 37.38555 38.0 38.0 38.0 37.0 38.0 25-29 37.35765 38.0 38.0 38.0 37.0 38.0 30-34 37.2986 38.0 38.0 38.0 37.0 38.0 35-39 37.205 38.0 38.0 38.0 36.6 38.0 40-44 36.9193 38.0 38.0 38.0 35.4 38.0 45-49 36.7154 38.0 38.0 38.0 34.2 38.0 50-54 36.69369999999999 38.0 38.0 38.0 34.4 38.0 55-59 36.5577 38.0 38.0 38.0 34.0 38.0 60-64 36.50605 38.0 38.0 38.0 34.0 38.0 65-69 36.362 38.0 37.2 38.0 34.0 38.0 70-74 36.272800000000004 38.0 37.0 38.0 33.4 38.0 75-79 36.16095 38.0 37.0 38.0 33.2 38.0 80-84 36.0395 38.0 37.0 38.0 33.0 38.0 85-89 35.95355 38.0 37.0 38.0 32.0 38.0 90-94 35.735699999999994 38.0 36.6 38.0 31.0 38.0 95-99 35.55835 38.0 36.0 38.0 29.8 38.0 100-104 35.380799999999994 38.0 36.0 38.0 29.0 38.0 105-109 35.21725 38.0 36.0 38.0 28.8 38.0 110-114 34.8526 38.0 35.0 38.0 27.6 38.0 115-119 34.551550000000006 38.0 35.0 38.0 26.2 38.0 120-124 34.168350000000004 38.0 34.2 38.0 23.8 38.0 125-129 33.90045 38.0 34.0 38.0 23.0 38.0 130-134 33.43755 38.0 33.8 38.0 19.4 38.0 135-139 32.72725 37.8 33.2 38.0 14.8 38.0 140-144 32.31455 36.6 32.6 38.0 14.2 38.0 145-149 31.4858 36.0 32.2 38.0 11.4 38.0 150-151 27.445 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 0.0 16 5.0 17 2.0 18 3.0 19 5.0 20 13.0 21 13.0 22 9.0 23 20.0 24 18.0 25 16.0 26 31.0 27 34.0 28 40.0 29 38.0 30 71.0 31 81.0 32 107.0 33 169.0 34 245.0 35 432.0 36 1072.0 37 1567.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.701193196242706 13.683676059913683 8.555470931708555 35.05965981213506 2 24.775 13.025 32.574999999999996 29.625 3 19.425 18.625 27.450000000000003 34.5 4 23.200000000000003 25.074999999999996 23.125 28.599999999999998 5 22.3 30.825000000000003 23.599999999999998 23.275000000000002 6 20.825 33.15 24.4 21.625 7 15.1 28.4 39.925 16.575 8 18.25 29.425 28.249999999999996 24.075 9 17.65 25.924999999999997 33.074999999999996 23.35 10-14 19.675 30.44 27.450000000000003 22.435 15-19 19.735 29.409999999999997 27.72 23.135 20-24 19.845 29.285 27.27 23.599999999999998 25-29 20.375 29.215000000000003 27.034999999999997 23.375 30-34 19.855 29.37 27.21 23.565 35-39 19.495 29.325000000000003 26.83 24.349999999999998 40-44 20.305 29.459999999999997 27.38 22.855 45-49 20.195 28.849999999999998 27.3 23.655 50-54 20.549999999999997 28.89 27.200000000000003 23.36 55-59 20.39 28.634999999999998 26.840000000000003 24.135 60-64 19.975 28.62 27.48 23.925 65-69 20.185 28.84 27.05 23.925 70-74 20.064999999999998 28.64 27.365000000000002 23.93 75-79 20.49 28.860000000000003 27.150000000000002 23.5 80-84 19.88 28.285 28.055000000000003 23.78 85-89 20.255000000000003 28.299999999999997 27.325 24.12 90-94 20.54 28.7 27.24 23.52 95-99 20.005 28.435 27.200000000000003 24.36 100-104 20.7 28.515 27.095000000000002 23.69 105-109 20.535 27.975 27.3 24.19 110-114 20.48 28.444999999999997 26.905 24.169999999999998 115-119 20.39 28.21 27.529999999999998 23.87 120-124 20.3 28.775000000000002 27.455000000000002 23.47 125-129 20.94 27.639999999999997 27.365000000000002 24.055 130-134 21.215 27.575 27.665 23.544999999999998 135-139 20.919999999999998 27.755000000000003 27.72 23.605 140-144 20.595 27.639999999999997 27.544999999999998 24.22 145-149 20.495 27.765 27.855 23.885 150-151 21.1875 28.787499999999998 25.974999999999998 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 4.5 25 5.0 26 5.5 27 9.5 28 13.0 29 14.0 30 17.5 31 28.5 32 40.0 33 51.0 34 63.0 35 72.5 36 83.0 37 99.5 38 114.5 39 142.5 40 184.0 41 204.5 42 214.0 43 243.0 44 267.0 45 261.0 46 261.0 47 255.5 48 243.0 49 218.0 50 186.0 51 162.5 52 127.5 53 102.0 54 85.0 55 54.5 56 36.5 57 33.5 58 22.5 59 18.0 60 12.0 61 5.5 62 5.5 63 5.5 64 5.0 65 4.0 66 1.5 67 3.0 68 5.0 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138-139 1.3250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTTT 10 0.006830828 145.0 9 CCTTTTA 10 0.006830828 145.0 5 >>END_MODULE SRR7169065 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169065_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76875 33.0 33.0 34.0 32.0 34.0 2 32.8535 33.0 33.0 34.0 32.0 34.0 3 32.93225 34.0 33.0 34.0 32.0 34.0 4 32.779 34.0 33.0 34.0 32.0 34.0 5 32.84075 34.0 33.0 34.0 32.0 34.0 6 36.98425 38.0 38.0 38.0 36.0 38.0 7 36.96475 38.0 38.0 38.0 36.0 38.0 8 36.90975 38.0 38.0 38.0 36.0 38.0 9 36.99775 38.0 38.0 38.0 37.0 38.0 10-14 37.02165 38.0 38.0 38.0 36.6 38.0 15-19 36.96605 38.0 38.0 38.0 36.8 38.0 20-24 36.9165 38.0 38.0 38.0 36.4 38.0 25-29 36.96990000000001 38.0 38.0 38.0 37.0 38.0 30-34 36.945100000000004 38.0 38.0 38.0 36.6 38.0 35-39 36.91455 38.0 38.0 38.0 36.2 38.0 40-44 36.841499999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.75285 38.0 38.0 38.0 36.0 38.0 50-54 36.81055 38.0 38.0 38.0 36.0 38.0 55-59 36.76390000000001 38.0 38.0 38.0 35.8 38.0 60-64 36.7633 38.0 38.0 38.0 36.0 38.0 65-69 36.5751 38.0 38.0 38.0 35.4 38.0 70-74 36.4812 38.0 38.0 38.0 35.2 38.0 75-79 36.4853 38.0 38.0 38.0 35.0 38.0 80-84 36.50405 38.0 38.0 38.0 34.8 38.0 85-89 36.48445 38.0 38.0 38.0 34.8 38.0 90-94 36.40405 38.0 38.0 38.0 34.0 38.0 95-99 36.1704 38.0 38.0 38.0 33.8 38.0 100-104 36.06585 38.0 38.0 38.0 33.6 38.0 105-109 36.018950000000004 38.0 38.0 38.0 33.2 38.0 110-114 35.83225 38.0 37.8 38.0 33.0 38.0 115-119 35.62555 38.0 37.4 38.0 31.4 38.0 120-124 35.3156 38.0 37.0 38.0 29.6 38.0 125-129 35.26655 38.0 36.4 38.0 30.4 38.0 130-134 34.887299999999996 38.0 36.0 38.0 27.8 38.0 135-139 34.6286 38.0 36.0 38.0 27.4 38.0 140-144 34.284000000000006 38.0 35.4 38.0 24.8 38.0 145-149 33.442150000000005 38.0 35.0 38.0 18.6 38.0 150-151 29.432125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 7.0 4 4.0 5 4.0 6 1.0 7 2.0 8 0.0 9 2.0 10 1.0 11 0.0 12 4.0 13 1.0 14 2.0 15 3.0 16 4.0 17 5.0 18 8.0 19 4.0 20 3.0 21 2.0 22 8.0 23 18.0 24 13.0 25 28.0 26 29.0 27 29.0 28 33.0 29 39.0 30 48.0 31 55.0 32 67.0 33 97.0 34 110.0 35 218.0 36 503.0 37 2640.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.875 24.15 13.575000000000001 25.4 2 30.975 26.525 26.375 16.125 3 22.575 28.725 29.725 18.975 4 24.65 32.7 23.75 18.9 5 25.1 35.3 21.675 17.925 6 22.3 37.65 22.125 17.925 7 21.75 23.325000000000003 36.225 18.7 8 22.45 26.85 27.05 23.65 9 22.575 25.575 28.725 23.125 10-14 23.915 28.985 26.005 21.095 15-19 23.93 27.315 27.485 21.27 20-24 23.150000000000002 28.17 27.375 21.305 25-29 23.995 28.68 26.02 21.305 30-34 23.875 27.54 27.284999999999997 21.3 35-39 23.494999999999997 27.565 27.655 21.285 40-44 23.94 27.705000000000002 27.105 21.25 45-49 23.645 27.305 27.644999999999996 21.404999999999998 50-54 23.580000000000002 28.435 27.355 20.630000000000003 55-59 24.21 27.205000000000002 27.265 21.32 60-64 23.175 27.644999999999996 27.779999999999998 21.4 65-69 24.449460747429143 27.594682718836218 27.2385252069225 20.71733132681214 70-74 23.897003463333835 28.329066907594235 27.06921648346133 20.7047131456106 75-79 24.421464785904323 27.930324782892423 27.071934139852416 20.576276291350837 80-84 23.986199309965496 27.486374318715935 27.57637881894095 20.95104755237762 85-89 24.735 27.85 26.83 20.585 90-94 24.015 27.87 27.060000000000002 21.055 95-99 23.465 28.095 27.560000000000002 20.880000000000003 100-104 24.135 27.334999999999997 27.665 20.865000000000002 105-109 24.085 27.505000000000003 27.49 20.919999999999998 110-114 23.974999999999998 27.87 26.83 21.325 115-119 24.310000000000002 27.58 27.42 20.69 120-124 23.815 27.525 27.529999999999998 21.13 125-129 23.93 28.225 27.18 20.665 130-134 24.709999999999997 27.005000000000003 27.750000000000004 20.535 135-139 24.00840294102936 27.57465112789476 27.38458460461161 21.03236132646426 140-144 24.42029348424901 27.82090449241248 27.03961536535283 20.719186657985677 145-149 23.87752023731711 27.50766755492986 28.181406807783198 20.433405399969832 150-151 25.315656565656564 27.22222222222222 27.32323232323232 20.13888888888889 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 0.0 26 0.0 27 1.0 28 3.0 29 4.0 30 4.5 31 7.0 32 11.5 33 20.5 34 32.0 35 43.5 36 59.0 37 83.5 38 104.5 39 142.0 40 185.0 41 221.0 42 267.0 43 284.5 44 281.5 45 286.0 46 283.5 47 274.5 48 261.5 49 235.5 50 209.5 51 169.0 52 127.0 53 108.0 54 84.5 55 59.5 56 41.5 57 28.0 58 20.5 59 15.0 60 9.5 61 5.0 62 4.0 63 3.5 64 5.0 65 4.0 66 2.0 67 2.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.325 70-74 0.385 75-79 0.395 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.034999999999999996 140-144 0.165 145-149 0.555 150-151 1.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.2125 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138-139 1.3250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCGG 10 0.006830828 145.0 9 GAATATA 10 0.006830828 145.0 4 >>END_MODULE Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra Read 812141 spots for SRR7169065.sra Written 812141 spots for SRR7169065.sra SRR ids: ['SRR7169065.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xv_hldhq SRR7169065.sra spots: 16242820 blocks: [[1, 812141], [812142, 1624282], [1624283, 2436423], [2436424, 3248564], [3248565, 4060705], [4060706, 4872846], [4872847, 5684987], [5684988, 6497128], [6497129, 7309269], [7309270, 8121410], [8121411, 8933551], [8933552, 9745692], [9745693, 10557833], [10557834, 11369974], [11369975, 12182115], [12182116, 12994256], [12994257, 13806397], [13806398, 14618538], [14618539, 15430679], [15430680, 16242820]] SRR7169065 file size 5482458 SRR7169065 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169065 SRR7169065_1.fastq SRR7169065_2.fastq Input file: SRR7169065_1.fastq Paired file: SRR7169065_2.fastq trimmed: SRR7169065-trimmed-pair1.fastq, SRR7169065-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:43:12 2025 >> started Mon Feb 10 18:43:36 2025 >> done (23.753s) 16242820 read pairs processed; of these: 19629 ( 0.12%) short read pairs filtered out after trimming by size control 16129 ( 0.10%) empty read pairs filtered out after trimming by size control 16207062 (99.78%) read pairs available; of these: 7674154 (47.35%) trimmed read pairs available after processing 8532908 (52.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 3 0.00% 21 8 0.00% 22 6 0.00% 23 6 0.00% 24 5 0.00% 25 7 0.00% 26 1 0.00% 27 9 0.00% 28 6 0.00% 29 10 0.00% 30 18 0.00% 31 6 0.00% 32 10 0.00% 33 10 0.00% 34 10 0.00% 35 10 0.00% 36 8 0.00% 37 21 0.00% 38 16 0.00% 39 18 0.00% 40 26 0.00% 41 21 0.00% 42 25 0.00% 43 22 0.00% 44 25 0.00% 45 29 0.00% 46 34 0.00% 47 28 0.00% 48 35 0.00% 49 44 0.00% 50 38 0.00% 51 52 0.00% 52 64 0.00% 53 41 0.00% 54 61 0.00% 55 71 0.00% 56 70 0.00% 57 79 0.00% 58 71 0.00% 59 80 0.00% 60 97 0.00% 61 113 0.00% 62 119 0.00% 63 157 0.00% 64 129 0.00% 65 152 0.00% 66 157 0.00% 67 168 0.00% 68 233 0.00% 69 250 0.00% 70 246 0.00% 71 274 0.00% 72 303 0.00% 73 331 0.00% 74 415 0.00% 75 438 0.00% 76 492 0.00% 77 536 0.00% 78 625 0.00% 79 661 0.00% 80 756 0.00% 81 824 0.01% 82 992 0.01% 83 1173 0.01% 84 2089 0.01% 85 2481 0.02% 86 2593 0.02% 87 2707 0.02% 88 2926 0.02% 89 2874 0.02% 90 2966 0.02% 91 3115 0.02% 92 3276 0.02% 93 3536 0.02% 94 3811 0.02% 95 4072 0.03% 96 4283 0.03% 97 4637 0.03% 98 5000 0.03% 99 5134 0.03% 100 5562 0.03% 101 5632 0.03% 102 6133 0.04% 103 6359 0.04% 104 6869 0.04% 105 7601 0.05% 106 8063 0.05% 107 8333 0.05% 108 9145 0.06% 109 9673 0.06% 110 10318 0.06% 111 10841 0.07% 112 11513 0.07% 113 12451 0.08% 114 12889 0.08% 115 13853 0.09% 116 14939 0.09% 117 15536 0.10% 118 16618 0.10% 119 17490 0.11% 120 18658 0.12% 121 19441 0.12% 122 21019 0.13% 123 22448 0.14% 124 23797 0.15% 125 25064 0.15% 126 27159 0.17% 127 29116 0.18% 128 30797 0.19% 129 33081 0.20% 130 35602 0.22% 131 38092 0.24% 132 41111 0.25% 133 44340 0.27% 134 47608 0.29% 135 51466 0.32% 136 56544 0.35% 137 61939 0.38% 138 68918 0.43% 139 75901 0.47% 140 83246 0.51% 141 92842 0.57% 142 104529 0.64% 143 119914 0.74% 144 140290 0.87% 145 171978 1.06% 146 220449 1.36% 147 304575 1.88% 148 477769 2.95% 149 938737 5.79% 150 3971653 24.51% 151 8532908 52.65% 16207062 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=41 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=262.46 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=17.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=47 prefix-density=0.22 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=47 fanout-score=153.87 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=13.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7169065 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:44:21 Started mapping on | Feb 10 18:44:21 Finished on | Feb 10 18:46:32 Mapping speed, Million of reads per hour | 445.38 Number of input reads | 16207062 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15149893 Uniquely mapped reads % | 93.48% Average mapped length | 296.23 Number of splices: Total | 14177792 Number of splices: Annotated (sjdb) | 13955070 Number of splices: GT/AG | 13976948 Number of splices: GC/AG | 162366 Number of splices: AT/AC | 11693 Number of splices: Non-canonical | 26785 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289172 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 19918 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.58% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 787593 787593 787593 N_multimapping 289172 289172 289172 N_noFeature 266567 14962010 339729 N_ambiguous 174949 832 59703 UnstrandedReadsAssigned:14708377 PositiveStrandReadsAssigned:187051 NegativeStrandReadsAssigned:14750461 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169065 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169065-trimmed-pair1.fastq SRR7169065-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,207,062 reads, 14,656,888 reads pseudoaligned [quant] estimated average fragment length: 269.876 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR7169065.ke.tsv 34699 SRR7169065.se.tsv 87100 total ==> SRR7169065.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.12 280 8.80093 Potri.005G024800.1.v4.1 1035 766.124 28 2.00933 Potri.004G059700.1.v4.1 961 692.145 7 0.556023 Potri.007G009000.2.v4.1 1416 1147.12 0 0 Potri.003G141000.2.v4.1 2943 2674.12 233 4.79033 Potri.016G087400.1.v4.1 270 61.7692 1650.48 1469.03 Potri.015G069301.1.v4.1 564 300.41 0 0 Potri.010G195200.1.v4.1 1773 1504.12 18 0.657931 Potri.012G127500.1.v4.1 977 708.124 7281 565.292 ==> SRR7169065.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1057 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169065 completed mapping pipeline successfully