Starting /dee2/code/volunteer_pipeline.sh SRR7169066 current disk space = 3057653288960 free memory = 1161353512 SRR7169066 SRAfilesize 91c880957ee25fd24af1f2372f86c36f SRR7169066.sra SRR7169066.sra file validated SRR7169066 is paired end SRR7169066 is conventional basespace SRR7169066 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169066_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7055 34.0 33.0 34.0 33.0 34.0 2 33.32625 34.0 33.0 34.0 33.0 34.0 3 33.372 34.0 33.0 34.0 33.0 34.0 4 33.388 34.0 33.0 34.0 33.0 34.0 5 33.47525 34.0 33.0 34.0 33.0 34.0 6 37.126 38.0 37.0 38.0 36.0 38.0 7 37.42775 38.0 38.0 38.0 37.0 38.0 8 37.47275 38.0 38.0 38.0 37.0 38.0 9 37.587 38.0 38.0 38.0 38.0 38.0 10-14 37.511250000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.481700000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.4054 38.0 38.0 38.0 37.2 38.0 25-29 37.40454999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.378550000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.20890000000001 38.0 38.0 38.0 36.6 38.0 40-44 37.16085 38.0 38.0 38.0 36.2 38.0 45-49 37.048649999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.9818 38.0 38.0 38.0 35.8 38.0 55-59 36.900850000000005 38.0 38.0 38.0 35.2 38.0 60-64 36.95955 38.0 38.0 38.0 35.8 38.0 65-69 36.819599999999994 38.0 38.0 38.0 35.2 38.0 70-74 36.63154999999999 38.0 38.0 38.0 34.4 38.0 75-79 36.63285 38.0 38.0 38.0 34.4 38.0 80-84 36.18455 38.0 37.6 38.0 32.8 38.0 85-89 36.433 38.0 38.0 38.0 34.0 38.0 90-94 36.30795 38.0 38.0 38.0 33.6 38.0 95-99 36.051249999999996 38.0 37.0 38.0 32.8 38.0 100-104 35.763400000000004 38.0 37.0 38.0 30.8 38.0 105-109 35.14445 38.0 36.2 38.0 28.0 38.0 110-114 35.291399999999996 38.0 36.0 38.0 28.6 38.0 115-119 35.6944 38.0 36.6 38.0 31.4 38.0 120-124 34.9862 38.0 35.4 38.0 27.6 38.0 125-129 34.66440000000001 38.0 35.0 38.0 25.8 38.0 130-134 34.6879 38.0 35.0 38.0 27.0 38.0 135-139 34.272299999999994 38.0 35.0 38.0 24.2 38.0 140-144 33.44035 38.0 34.2 38.0 19.0 38.0 145-149 32.72175 38.0 33.8 38.0 14.2 38.0 150-151 28.8485 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 3.0 17 2.0 18 4.0 19 4.0 20 12.0 21 1.0 22 7.0 23 12.0 24 9.0 25 13.0 26 23.0 27 35.0 28 38.0 29 38.0 30 53.0 31 86.0 32 109.0 33 108.0 34 174.0 35 332.0 36 787.0 37 2143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.905273937532 11.955965181771633 8.218125960061444 34.92063492063492 2 23.775 13.025 33.900000000000006 29.299999999999997 3 19.775000000000002 19.0 27.175 34.050000000000004 4 22.6 26.75 24.099999999999998 26.55 5 22.675 31.225 24.45 21.65 6 20.8 35.0 23.425 20.775 7 14.6 28.625 40.275 16.5 8 18.85 26.924999999999997 30.3 23.925 9 17.474999999999998 24.525 32.574999999999996 25.424999999999997 10-14 19.485 30.825000000000003 26.474999999999998 23.215 15-19 20.03 29.049999999999997 27.33 23.59 20-24 19.96 28.875 27.73 23.435 25-29 20.02 29.035 26.8 24.145 30-34 20.435 28.67 27.275 23.62 35-39 19.8 28.685 27.49 24.025 40-44 19.919999999999998 28.87 27.534999999999997 23.674999999999997 45-49 20.49 28.854999999999997 27.485 23.169999999999998 50-54 20.07 28.485 27.825 23.62 55-59 19.71 29.325000000000003 27.13 23.835 60-64 19.74 29.065 27.189999999999998 24.005000000000003 65-69 20.13 28.04 27.76 24.07 70-74 20.044999999999998 28.105000000000004 28.110000000000003 23.74 75-79 20.455000000000002 26.889999999999997 28.349999999999998 24.305 80-84 20.105 28.78 26.700000000000003 24.415 85-89 19.950000000000003 28.754999999999995 27.615000000000002 23.68 90-94 20.575 28.355000000000004 27.065 24.005000000000003 95-99 20.355 28.32 27.27 24.055 100-104 20.525 29.39 26.674999999999997 23.41 105-109 21.035 28.095 27.284999999999997 23.585 110-114 20.599999999999998 28.51 27.365000000000002 23.525 115-119 20.61 28.04 27.125 24.224999999999998 120-124 20.68 28.000000000000004 27.450000000000003 23.87 125-129 20.745 27.76 27.55 23.945 130-134 20.674999999999997 28.52 27.41 23.395 135-139 21.165 27.63 26.590000000000003 24.615000000000002 140-144 21.01 27.935 27.195000000000004 23.86 145-149 21.44 27.915 27.029999999999998 23.615 150-151 21.55 28.487499999999997 26.25 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 2.5 25 2.5 26 4.5 27 8.0 28 8.0 29 12.5 30 17.0 31 20.0 32 29.5 33 46.0 34 60.5 35 62.5 36 82.0 37 117.5 38 134.5 39 143.0 40 170.5 41 200.0 42 241.0 43 268.5 44 261.5 45 267.5 46 262.0 47 249.0 48 242.5 49 223.5 50 189.5 51 154.5 52 119.5 53 92.5 54 79.0 55 58.5 56 38.0 57 28.5 58 22.5 59 17.0 60 14.5 61 12.0 62 8.5 63 4.0 64 2.5 65 2.5 66 4.0 67 4.0 68 1.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.5875 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.8374999999999999 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.15 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169066 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169066_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96 33.0 33.0 34.0 32.0 34.0 2 32.971 34.0 33.0 34.0 32.0 34.0 3 33.015 34.0 33.0 34.0 32.0 34.0 4 32.86675 34.0 33.0 34.0 32.0 34.0 5 33.04925 34.0 33.0 34.0 32.0 34.0 6 37.17375 38.0 38.0 38.0 37.0 38.0 7 37.18625 38.0 38.0 38.0 37.0 38.0 8 37.18 38.0 38.0 38.0 37.0 38.0 9 37.05875 38.0 38.0 38.0 36.0 38.0 10-14 36.93075 38.0 38.0 38.0 36.4 38.0 15-19 37.102850000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.0596 38.0 38.0 38.0 37.0 38.0 25-29 36.9781 38.0 38.0 38.0 36.2 38.0 30-34 37.03925 38.0 38.0 38.0 36.6 38.0 35-39 36.950250000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.838100000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.92045 38.0 38.0 38.0 36.0 38.0 50-54 37.0028 38.0 38.0 38.0 36.0 38.0 55-59 36.9615 38.0 38.0 38.0 36.0 38.0 60-64 36.8298 38.0 38.0 38.0 35.4 38.0 65-69 36.81869999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.6775 38.0 38.0 38.0 35.0 38.0 75-79 36.710750000000004 38.0 38.0 38.0 35.4 38.0 80-84 36.49929999999999 38.0 38.0 38.0 34.2 38.0 85-89 36.40435 38.0 38.0 38.0 34.0 38.0 90-94 36.1691 38.0 37.6 38.0 33.4 38.0 95-99 36.482600000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.184 38.0 38.0 38.0 33.8 38.0 105-109 36.06825 38.0 38.0 38.0 33.0 38.0 110-114 35.7545 38.0 37.0 38.0 31.0 38.0 115-119 35.72345 38.0 37.2 38.0 31.4 38.0 120-124 35.61710000000001 38.0 37.0 38.0 31.0 38.0 125-129 35.199799999999996 38.0 36.0 38.0 28.6 38.0 130-134 34.809650000000005 38.0 35.8 38.0 26.8 38.0 135-139 34.534749999999995 38.0 35.2 38.0 25.4 38.0 140-144 34.3874 38.0 35.0 38.0 25.4 38.0 145-149 33.74485 38.0 34.8 38.0 22.2 38.0 150-151 30.372 36.0 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 2.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 4.0 14 3.0 15 1.0 16 5.0 17 3.0 18 2.0 19 8.0 20 10.0 21 9.0 22 13.0 23 17.0 24 16.0 25 19.0 26 25.0 27 23.0 28 31.0 29 36.0 30 53.0 31 68.0 32 59.0 33 111.0 34 145.0 35 237.0 36 511.0 37 2581.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.825 22.225 12.125 24.825 2 27.900000000000002 26.0 28.275 17.825 3 20.75 26.900000000000002 32.300000000000004 20.05 4 24.15603900975244 33.05826456614154 23.48087021755439 19.30482620655164 5 26.375 34.075 21.575 17.974999999999998 6 20.825 38.525 21.875 18.775 7 20.674999999999997 22.8 37.724999999999994 18.8 8 21.875 25.6 26.974999999999998 25.55 9 22.1 25.275 28.9 23.724999999999998 10-14 23.18 29.64 25.729999999999997 21.45 15-19 23.93 27.815 27.395000000000003 20.86 20-24 22.45 28.565 27.375 21.61 25-29 22.900000000000002 28.465 27.35 21.285 30-34 23.085 28.01 27.85 21.055 35-39 23.07 27.950000000000003 27.529999999999998 21.45 40-44 23.805 27.11 27.825 21.26 45-49 23.425 27.58 28.095 20.9 50-54 23.645 27.425 27.55 21.38 55-59 23.345 27.465 28.425 20.765 60-64 23.73 27.779999999999998 27.529999999999998 20.96 65-69 23.155 27.325 27.935 21.584999999999997 70-74 23.615 27.525 28.395 20.465 75-79 23.52 27.295 28.125 21.060000000000002 80-84 23.595 27.915 27.625 20.865000000000002 85-89 23.69 27.615000000000002 27.93 20.765 90-94 23.775 28.285 27.279999999999998 20.66 95-99 23.974999999999998 27.32 27.875 20.830000000000002 100-104 24.555 27.49 27.339999999999996 20.615 105-109 24.04 27.639999999999997 27.375 20.945 110-114 24.465 27.595 27.52 20.419999999999998 115-119 24.14 27.139999999999997 27.93 20.79 120-124 24.224999999999998 27.750000000000004 27.425 20.599999999999998 125-129 23.86 27.655 28.03 20.455000000000002 130-134 23.895 27.57 27.555000000000003 20.979999999999997 135-139 23.705000000000002 27.83 27.589999999999996 20.875 140-144 24.48 27.6 27.339999999999996 20.580000000000002 145-149 24.135 27.71 27.725 20.43 150-151 24.375 27.5625 27.650000000000002 20.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 0.5 26 1.5 27 2.0 28 2.5 29 7.0 30 8.5 31 13.0 32 18.0 33 25.0 34 32.5 35 54.0 36 79.5 37 86.0 38 110.5 39 148.5 40 191.5 41 231.5 42 255.0 43 281.5 44 281.0 45 288.5 46 300.5 47 281.0 48 255.0 49 214.0 50 181.0 51 158.0 52 122.5 53 87.0 54 68.0 55 53.5 56 42.0 57 31.5 58 21.5 59 14.0 60 8.0 61 6.0 62 8.5 63 6.5 64 4.5 65 4.5 66 3.0 67 2.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5375 0.0 0.0 0.0 0.0 118-119 0.6499999999999999 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.9125000000000001 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.225 0.0 0.0 0.0 0.0 138-139 1.3624999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTCCC 10 0.006830828 145.0 6 >>END_MODULE Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967523 spots for SRR7169066.sra Written 967523 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra Read 967508 spots for SRR7169066.sra Written 967508 spots for SRR7169066.sra SRR ids: ['SRR7169066.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mqnl6l9r SRR7169066.sra spots: 19350175 blocks: [[1, 967508], [967509, 1935016], [1935017, 2902524], [2902525, 3870032], [3870033, 4837540], [4837541, 5805048], [5805049, 6772556], [6772557, 7740064], [7740065, 8707572], [8707573, 9675080], [9675081, 10642588], [10642589, 11610096], [11610097, 12577604], [12577605, 13545112], [13545113, 14512620], [14512621, 15480128], [15480129, 16447636], [16447637, 17415144], [17415145, 18382652], [18382653, 19350175]] SRR7169066 file size 6535439 SRR7169066 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169066 SRR7169066_1.fastq SRR7169066_2.fastq Input file: SRR7169066_1.fastq Paired file: SRR7169066_2.fastq trimmed: SRR7169066-trimmed-pair1.fastq, SRR7169066-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:20:26 2025 >> started Mon Feb 10 18:20:49 2025 >> done (22.493s) 19350175 read pairs processed; of these: 15727 ( 0.08%) short read pairs filtered out after trimming by size control 13721 ( 0.07%) empty read pairs filtered out after trimming by size control 19320727 (99.85%) read pairs available; of these: 7983199 (41.32%) trimmed read pairs available after processing 11337528 (58.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 5 0.00% 21 4 0.00% 22 7 0.00% 23 9 0.00% 24 13 0.00% 25 9 0.00% 26 4 0.00% 27 11 0.00% 28 8 0.00% 29 2 0.00% 30 14 0.00% 31 7 0.00% 32 9 0.00% 33 6 0.00% 34 5 0.00% 35 7 0.00% 36 5 0.00% 37 6 0.00% 38 11 0.00% 39 8 0.00% 40 11 0.00% 41 18 0.00% 42 19 0.00% 43 13 0.00% 44 14 0.00% 45 21 0.00% 46 15 0.00% 47 16 0.00% 48 21 0.00% 49 24 0.00% 50 27 0.00% 51 39 0.00% 52 39 0.00% 53 30 0.00% 54 35 0.00% 55 35 0.00% 56 50 0.00% 57 61 0.00% 58 57 0.00% 59 65 0.00% 60 58 0.00% 61 67 0.00% 62 97 0.00% 63 87 0.00% 64 106 0.00% 65 112 0.00% 66 132 0.00% 67 132 0.00% 68 162 0.00% 69 214 0.00% 70 244 0.00% 71 264 0.00% 72 234 0.00% 73 320 0.00% 74 368 0.00% 75 348 0.00% 76 404 0.00% 77 494 0.00% 78 522 0.00% 79 544 0.00% 80 699 0.00% 81 768 0.00% 82 868 0.00% 83 1044 0.01% 84 1893 0.01% 85 2316 0.01% 86 2423 0.01% 87 2787 0.01% 88 2943 0.02% 89 2993 0.02% 90 3273 0.02% 91 3230 0.02% 92 3422 0.02% 93 3533 0.02% 94 3917 0.02% 95 4071 0.02% 96 4276 0.02% 97 4657 0.02% 98 4935 0.03% 99 5315 0.03% 100 5633 0.03% 101 5876 0.03% 102 6509 0.03% 103 6894 0.04% 104 7056 0.04% 105 7573 0.04% 106 8294 0.04% 107 8516 0.04% 108 8846 0.05% 109 9517 0.05% 110 10038 0.05% 111 10835 0.06% 112 11627 0.06% 113 12383 0.06% 114 13233 0.07% 115 14333 0.07% 116 15082 0.08% 117 15701 0.08% 118 16445 0.09% 119 17055 0.09% 120 18057 0.09% 121 19143 0.10% 122 20453 0.11% 123 21539 0.11% 124 23211 0.12% 125 24773 0.13% 126 26241 0.14% 127 27979 0.14% 128 29963 0.16% 129 31773 0.16% 130 33946 0.18% 131 36300 0.19% 132 39593 0.20% 133 42126 0.22% 134 45629 0.24% 135 49634 0.26% 136 54360 0.28% 137 59066 0.31% 138 63978 0.33% 139 70695 0.37% 140 77868 0.40% 141 86766 0.45% 142 98347 0.51% 143 113670 0.59% 144 134464 0.70% 145 162978 0.84% 146 210316 1.09% 147 286257 1.48% 148 440053 2.28% 149 860352 4.45% 150 4497179 23.28% 151 11337528 58.68% 19320727 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=42 prefix-density=0.16 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=271.08 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=18.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=17.90 fanout-score-rank=8 prefix-density=0.45 prefix-fanout=7.9 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCACGGAGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=41 fanout-score=65.25 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.8 sequence=TTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGT SRR7169066 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:21:38 Started mapping on | Feb 10 18:21:38 Finished on | Feb 10 18:23:41 Mapping speed, Million of reads per hour | 565.48 Number of input reads | 19320727 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18041151 Uniquely mapped reads % | 93.38% Average mapped length | 297.12 Number of splices: Total | 16991869 Number of splices: Annotated (sjdb) | 16721290 Number of splices: GT/AG | 16746447 Number of splices: GC/AG | 196048 Number of splices: AT/AC | 13779 Number of splices: Non-canonical | 35595 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332098 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 124477 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 965602 965602 965602 N_multimapping 332098 332098 332098 N_noFeature 379982 17818884 477958 N_ambiguous 199100 1483 73654 UnstrandedReadsAssigned:17462069 PositiveStrandReadsAssigned:220784 NegativeStrandReadsAssigned:17489539 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169066 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169066-trimmed-pair1.fastq SRR7169066-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,320,727 reads, 17,456,628 reads pseudoaligned [quant] estimated average fragment length: 267.373 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7169066.ke.tsv 34699 SRR7169066.se.tsv 87100 total ==> SRR7169066.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.63 325 9.59572 Potri.005G024800.1.v4.1 1035 768.627 50 3.36426 Potri.004G059700.1.v4.1 961 694.64 5 0.37226 Potri.007G009000.2.v4.1 1416 1149.63 0 0 Potri.003G141000.2.v4.1 2943 2676.63 293.032 5.6619 Potri.016G087400.1.v4.1 270 62.6736 1537 1268.31 Potri.015G069301.1.v4.1 564 302.921 0 0 Potri.010G195200.1.v4.1 1773 1506.63 50 1.71633 Potri.012G127500.1.v4.1 977 710.627 5877 427.71 ==> SRR7169066.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2216 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169066 completed mapping pipeline successfully