Starting /dee2/code/volunteer_pipeline.sh SRR7169067 current disk space = 3057311899648 free memory = 1505409740 SRR7169067 SRAfilesize 79ac4cb95caa387a95cba6d61ab653d8 SRR7169067.sra SRR7169067.sra file validated SRR7169067 is paired end SRR7169067 is conventional basespace SRR7169067 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169067_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87475 34.0 33.0 34.0 33.0 34.0 2 33.43425 34.0 34.0 34.0 33.0 34.0 3 33.46525 34.0 34.0 34.0 33.0 34.0 4 33.50925 34.0 34.0 34.0 33.0 34.0 5 33.46675 34.0 34.0 34.0 33.0 34.0 6 37.055 38.0 37.0 38.0 36.0 38.0 7 37.3365 38.0 38.0 38.0 37.0 38.0 8 37.42825 38.0 38.0 38.0 37.0 38.0 9 37.49475 38.0 38.0 38.0 37.0 38.0 10-14 37.4572 38.0 38.0 38.0 37.6 38.0 15-19 37.416199999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.40085 38.0 38.0 38.0 37.0 38.0 25-29 37.33925 38.0 38.0 38.0 37.0 38.0 30-34 37.30785 38.0 38.0 38.0 37.0 38.0 35-39 37.2502 38.0 38.0 38.0 36.8 38.0 40-44 37.0212 38.0 38.0 38.0 36.0 38.0 45-49 36.85265 38.0 38.0 38.0 35.4 38.0 50-54 36.78745 38.0 38.0 38.0 34.8 38.0 55-59 36.72245 38.0 38.0 38.0 34.6 38.0 60-64 36.6524 38.0 38.0 38.0 34.0 38.0 65-69 36.5677 38.0 38.0 38.0 34.2 38.0 70-74 36.5455 38.0 38.0 38.0 34.0 38.0 75-79 36.46785 38.0 38.0 38.0 34.0 38.0 80-84 36.335300000000004 38.0 37.6 38.0 34.0 38.0 85-89 36.1265 38.0 37.0 38.0 33.0 38.0 90-94 35.9927 38.0 37.0 38.0 33.0 38.0 95-99 35.8622 38.0 37.0 38.0 31.6 38.0 100-104 35.56965 38.0 36.6 38.0 29.8 38.0 105-109 35.42695 38.0 36.0 38.0 29.4 38.0 110-114 35.20685 38.0 36.0 38.0 29.0 38.0 115-119 34.98255 38.0 35.6 38.0 28.0 38.0 120-124 34.6834 38.0 35.0 38.0 26.6 38.0 125-129 34.2653 38.0 34.6 38.0 24.2 38.0 130-134 33.92975 38.0 34.0 38.0 22.6 38.0 135-139 33.664300000000004 38.0 34.0 38.0 21.8 38.0 140-144 33.1576 38.0 34.0 38.0 16.2 38.0 145-149 32.32165 38.0 33.0 38.0 13.8 38.0 150-151 28.40025 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 1.0 14 2.0 15 4.0 16 3.0 17 7.0 18 2.0 19 4.0 20 10.0 21 12.0 22 14.0 23 10.0 24 20.0 25 13.0 26 32.0 27 29.0 28 36.0 29 39.0 30 54.0 31 79.0 32 96.0 33 121.0 34 213.0 35 355.0 36 848.0 37 1992.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.11689961880559 14.002541296060992 9.961880559085133 31.918678526048282 2 23.9 14.899999999999999 30.95 30.25 3 18.95 20.974999999999998 26.5 33.575 4 21.15 27.800000000000004 25.374999999999996 25.674999999999997 5 23.5 30.55 24.325 21.625 6 19.975 33.175 25.074999999999996 21.775 7 15.1 27.925 38.95 18.025 8 19.125 25.474999999999998 31.45 23.95 9 17.2 26.1 31.974999999999998 24.725 10-14 19.935 29.385 27.224999999999998 23.455000000000002 15-19 19.830000000000002 28.51 27.66 24.0 20-24 19.835 28.89 27.275 24.0 25-29 19.525000000000002 29.235 27.33 23.91 30-34 19.975 29.095 27.189999999999998 23.74 35-39 20.155 28.475 27.22 24.15 40-44 20.369999999999997 29.375 26.805 23.45 45-49 20.115 28.895 26.945000000000004 24.044999999999998 50-54 20.68 28.754999999999995 26.96 23.605 55-59 20.465 28.73 27.0 23.805 60-64 20.015 28.205000000000002 27.134999999999998 24.645 65-69 20.535 28.77 26.474999999999998 24.22 70-74 19.895 28.425 27.48 24.2 75-79 20.265 28.435 27.384999999999998 23.915 80-84 20.75 28.645 27.04 23.565 85-89 20.515 28.275 27.41 23.799999999999997 90-94 20.07 28.585 27.21 24.135 95-99 20.535 27.58 27.27 24.615000000000002 100-104 20.7 28.575 26.815 23.91 105-109 20.335 27.88 27.500000000000004 24.285 110-114 20.65 27.99 27.755000000000003 23.605 115-119 20.47 28.015 27.49 24.025 120-124 20.785 28.375 27.295 23.544999999999998 125-129 20.599999999999998 27.445000000000004 27.91 24.044999999999998 130-134 20.549999999999997 28.505000000000003 26.779999999999998 24.165 135-139 21.33 27.82 27.150000000000002 23.7 140-144 21.165 28.09 27.32 23.425 145-149 21.7 28.01 26.895000000000003 23.395 150-151 21.1375 27.85 26.8 24.212500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 2.5 25 5.0 26 4.0 27 7.5 28 11.5 29 14.0 30 20.5 31 22.5 32 33.5 33 40.0 34 44.5 35 64.0 36 79.5 37 97.0 38 122.0 39 147.0 40 172.5 41 206.0 42 237.0 43 242.5 44 240.0 45 261.0 46 274.5 47 266.0 48 248.5 49 212.0 50 177.0 51 162.5 52 136.0 53 105.5 54 86.0 55 62.0 56 47.0 57 38.0 58 30.5 59 20.5 60 12.0 61 11.5 62 8.5 63 6.0 64 4.0 65 3.0 66 2.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0125 0.0 94-95 0.05 0.0 0.0 0.025 0.0 96-97 0.075 0.0 0.0 0.025 0.0 98-99 0.0875 0.0 0.0 0.025 0.0 100-101 0.1125 0.0 0.0 0.025 0.0 102-103 0.125 0.0 0.0 0.025 0.0 104-105 0.125 0.0 0.0 0.025 0.0 106-107 0.16249999999999998 0.0 0.0 0.025 0.0 108-109 0.2 0.0 0.0 0.025 0.0 110-111 0.2375 0.0 0.0 0.025 0.0 112-113 0.275 0.0 0.0 0.025 0.0 114-115 0.2875 0.0 0.0 0.025 0.0 116-117 0.375 0.0 0.0 0.025 0.0 118-119 0.4 0.0 0.0 0.025 0.0 120-121 0.475 0.0 0.0 0.025 0.0 122-123 0.55 0.0 0.0 0.025 0.0 124-125 0.5874999999999999 0.0 0.0 0.025 0.0 126-127 0.7375 0.0 0.0 0.025 0.0 128-129 0.8125 0.0 0.0 0.025 0.0 130-131 0.85 0.0 0.0 0.025 0.0 132-133 0.9625 0.0 0.0 0.025 0.0 134-135 1.225 0.0 0.0 0.025 0.0 136-137 1.475 0.0 0.0 0.025 0.0 138-139 1.6749999999999998 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169067 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169067_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55825 33.0 33.0 34.0 32.0 34.0 2 32.71625 33.0 33.0 34.0 32.0 34.0 3 32.68125 34.0 33.0 34.0 32.0 34.0 4 32.65425 34.0 33.0 34.0 32.0 34.0 5 32.7095 34.0 33.0 34.0 32.0 34.0 6 36.72075 38.0 38.0 38.0 36.0 38.0 7 36.7555 38.0 38.0 38.0 36.0 38.0 8 36.774 38.0 38.0 38.0 36.0 38.0 9 36.654 38.0 38.0 38.0 36.0 38.0 10-14 36.6653 38.0 38.0 38.0 35.8 38.0 15-19 36.6333 38.0 38.0 38.0 35.8 38.0 20-24 36.6288 38.0 38.0 38.0 36.0 38.0 25-29 36.59695 38.0 38.0 38.0 35.8 38.0 30-34 36.550749999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.45195 38.0 38.0 38.0 35.6 38.0 40-44 36.411899999999996 38.0 38.0 38.0 34.8 38.0 45-49 36.415049999999994 38.0 38.0 38.0 35.2 38.0 50-54 36.45 38.0 38.0 38.0 35.0 38.0 55-59 36.4358 38.0 38.0 38.0 35.2 38.0 60-64 36.3464 38.0 38.0 38.0 34.6 38.0 65-69 36.269850000000005 38.0 38.0 38.0 34.4 38.0 70-74 36.1476 38.0 38.0 38.0 34.2 38.0 75-79 36.095549999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.01625 38.0 38.0 38.0 33.6 38.0 85-89 35.943 38.0 38.0 38.0 33.4 38.0 90-94 35.8923 38.0 38.0 38.0 33.2 38.0 95-99 35.7559 38.0 38.0 38.0 32.6 38.0 100-104 35.558550000000004 38.0 38.0 38.0 31.4 38.0 105-109 35.47955 38.0 38.0 38.0 31.0 38.0 110-114 35.358250000000005 38.0 37.6 38.0 31.0 38.0 115-119 35.13265 38.0 37.2 38.0 29.2 38.0 120-124 35.0905 38.0 37.0 38.0 29.4 38.0 125-129 34.7235 38.0 36.0 38.0 27.6 38.0 130-134 34.4117 38.0 36.0 38.0 25.2 38.0 135-139 34.1043 38.0 35.8 38.0 22.6 38.0 140-144 33.81255 38.0 35.0 38.0 19.8 38.0 145-149 32.9424 38.0 35.0 38.0 11.4 38.0 150-151 29.666249999999998 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 11.0 4 8.0 5 3.0 6 4.0 7 4.0 8 2.0 9 2.0 10 7.0 11 3.0 12 1.0 13 3.0 14 8.0 15 7.0 16 8.0 17 11.0 18 7.0 19 8.0 20 10.0 21 16.0 22 7.0 23 15.0 24 19.0 25 25.0 26 21.0 27 23.0 28 38.0 29 42.0 30 46.0 31 53.0 32 74.0 33 100.0 34 114.0 35 188.0 36 424.0 37 2670.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.800000000000004 21.8 14.025000000000002 24.375 2 28.025 26.474999999999998 28.7 16.8 3 20.025000000000002 29.425 30.375000000000004 20.175 4 23.575 33.35 23.799999999999997 19.275000000000002 5 23.875 36.8 22.675 16.650000000000002 6 21.6 38.475 22.775000000000002 17.150000000000002 7 21.925 22.45 35.25 20.375 8 22.6 25.775 26.75 24.875 9 21.925 27.224999999999998 28.575 22.275 10-14 23.665 28.475 25.900000000000002 21.959999999999997 15-19 23.69 28.425 26.889999999999997 20.995 20-24 23.665 28.17 26.575 21.59 25-29 23.549999999999997 28.165000000000003 27.145000000000003 21.14 30-34 23.68 27.62 27.095000000000002 21.605 35-39 23.695 27.715 27.185 21.404999999999998 40-44 22.975 28.57 27.125 21.33 45-49 23.53 28.134999999999998 26.83 21.505 50-54 23.330000000000002 28.035 27.83 20.805 55-59 23.674999999999997 27.224999999999998 27.62 21.48 60-64 24.23 27.700000000000003 27.71 20.36 65-69 23.547370001501427 27.581202142034932 27.991592012411793 20.87983584405185 70-74 23.980563069832684 27.717663560765455 27.316902114016635 20.984871255385233 75-79 23.994382586016652 27.159193499849533 27.50526632560939 21.341157588524425 80-84 24.02 27.88 27.339999999999996 20.76 85-89 23.305 27.73 27.689999999999998 21.275 90-94 23.735 27.76 27.655 20.849999999999998 95-99 23.955000000000002 27.465 27.810000000000002 20.77 100-104 24.43 27.125 27.46 20.985 105-109 24.085 27.96 27.544999999999998 20.41 110-114 23.895 27.845 27.389999999999997 20.87 115-119 24.29 27.765 27.29 20.655 120-124 24.295 27.415 27.450000000000003 20.84 125-129 23.665 27.450000000000003 27.689999999999998 21.195 130-134 24.41 27.735 27.1 20.755000000000003 135-139 24.154999999999998 27.310000000000002 27.6 20.935000000000002 140-144 24.07 27.529999999999998 28.044999999999998 20.355 145-149 24.326088047788765 28.04578083429547 27.59901611364891 20.029115004266853 150-151 24.9874245472837 27.540241448692154 27.150402414486923 20.321931589537222 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 1.0 26 2.5 27 4.0 28 3.5 29 4.0 30 7.0 31 10.0 32 22.5 33 27.5 34 30.5 35 50.0 36 64.0 37 89.5 38 113.5 39 145.0 40 191.0 41 224.5 42 240.5 43 259.5 44 286.0 45 290.5 46 292.5 47 278.5 48 256.5 49 222.0 50 168.5 51 145.5 52 130.5 53 105.0 54 84.5 55 62.5 56 44.0 57 39.0 58 29.0 59 16.5 60 11.5 61 6.5 62 7.5 63 7.0 64 4.0 65 4.0 66 4.5 67 4.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.095 70-74 0.19 75-79 0.31 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.395 150-151 0.6 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.9249999999999999 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911465 spots for SRR7169067.sra Written 911465 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra Read 911463 spots for SRR7169067.sra Written 911463 spots for SRR7169067.sra SRR ids: ['SRR7169067.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mpuauhuk SRR7169067.sra spots: 18229262 blocks: [[1, 911463], [911464, 1822926], [1822927, 2734389], [2734390, 3645852], [3645853, 4557315], [4557316, 5468778], [5468779, 6380241], [6380242, 7291704], [7291705, 8203167], [8203168, 9114630], [9114631, 10026093], [10026094, 10937556], [10937557, 11849019], [11849020, 12760482], [12760483, 13671945], [13671946, 14583408], [14583409, 15494871], [15494872, 16406334], [16406335, 17317797], [17317798, 18229262]] SRR7169067 file size 6155598 SRR7169067 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169067 SRR7169067_1.fastq SRR7169067_2.fastq Input file: SRR7169067_1.fastq Paired file: SRR7169067_2.fastq trimmed: SRR7169067-trimmed-pair1.fastq, SRR7169067-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:57:21 2025 >> started Mon Feb 10 18:57:42 2025 >> done (21.053s) 18229262 read pairs processed; of these: 43853 ( 0.24%) short read pairs filtered out after trimming by size control 33108 ( 0.18%) empty read pairs filtered out after trimming by size control 18152301 (99.58%) read pairs available; of these: 8010944 (44.13%) trimmed read pairs available after processing 10141357 (55.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 7 0.00% 21 7 0.00% 22 15 0.00% 23 8 0.00% 24 12 0.00% 25 9 0.00% 26 6 0.00% 27 7 0.00% 28 14 0.00% 29 14 0.00% 30 23 0.00% 31 7 0.00% 32 13 0.00% 33 15 0.00% 34 22 0.00% 35 10 0.00% 36 17 0.00% 37 19 0.00% 38 12 0.00% 39 23 0.00% 40 20 0.00% 41 19 0.00% 42 21 0.00% 43 24 0.00% 44 47 0.00% 45 36 0.00% 46 44 0.00% 47 29 0.00% 48 44 0.00% 49 44 0.00% 50 46 0.00% 51 69 0.00% 52 74 0.00% 53 72 0.00% 54 73 0.00% 55 73 0.00% 56 87 0.00% 57 78 0.00% 58 103 0.00% 59 113 0.00% 60 127 0.00% 61 148 0.00% 62 163 0.00% 63 140 0.00% 64 166 0.00% 65 193 0.00% 66 215 0.00% 67 219 0.00% 68 252 0.00% 69 305 0.00% 70 370 0.00% 71 363 0.00% 72 378 0.00% 73 440 0.00% 74 478 0.00% 75 528 0.00% 76 580 0.00% 77 677 0.00% 78 722 0.00% 79 863 0.00% 80 911 0.01% 81 1068 0.01% 82 1229 0.01% 83 1451 0.01% 84 3369 0.02% 85 4381 0.02% 86 4126 0.02% 87 4099 0.02% 88 4183 0.02% 89 4226 0.02% 90 4343 0.02% 91 4359 0.02% 92 4512 0.02% 93 4840 0.03% 94 4927 0.03% 95 5135 0.03% 96 5558 0.03% 97 5707 0.03% 98 5983 0.03% 99 6145 0.03% 100 6535 0.04% 101 6921 0.04% 102 7522 0.04% 103 8084 0.04% 104 8417 0.05% 105 8800 0.05% 106 9384 0.05% 107 10082 0.06% 108 10392 0.06% 109 11112 0.06% 110 11803 0.07% 111 12528 0.07% 112 13193 0.07% 113 13996 0.08% 114 14785 0.08% 115 15760 0.09% 116 16949 0.09% 117 17671 0.10% 118 18784 0.10% 119 19809 0.11% 120 21075 0.12% 121 21850 0.12% 122 23220 0.13% 123 25185 0.14% 124 26995 0.15% 125 28309 0.16% 126 30385 0.17% 127 32156 0.18% 128 34643 0.19% 129 36868 0.20% 130 39154 0.22% 131 42079 0.23% 132 44937 0.25% 133 48680 0.27% 134 52622 0.29% 135 56836 0.31% 136 61413 0.34% 137 67050 0.37% 138 73816 0.41% 139 81366 0.45% 140 89681 0.49% 141 97795 0.54% 142 108732 0.60% 143 123577 0.68% 144 144360 0.80% 145 174589 0.96% 146 218195 1.20% 147 302329 1.67% 148 451941 2.49% 149 882892 4.86% 150 4236421 23.34% 151 10141357 55.87% 18152301 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.21 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=408.38 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=19.8 sequence=TGCTTTCTTTTCCGTTACATAAGTCTTTACTGTTTGAAGCATAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.70 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=3.8 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=57.15 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=13.8 sequence=TGTTGGTGGTGG SRR7169067 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:58:36 Started mapping on | Feb 10 18:58:36 Finished on | Feb 10 19:01:00 Mapping speed, Million of reads per hour | 453.81 Number of input reads | 18152301 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16723305 Uniquely mapped reads % | 92.13% Average mapped length | 296.29 Number of splices: Total | 15983833 Number of splices: Annotated (sjdb) | 15740092 Number of splices: GT/AG | 15758846 Number of splices: GC/AG | 179532 Number of splices: AT/AC | 12351 Number of splices: Non-canonical | 33104 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320575 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 24475 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.94% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1145179 1145179 1145179 N_multimapping 320575 320575 320575 N_noFeature 299268 16534598 380393 N_ambiguous 176546 819 68443 UnstrandedReadsAssigned:16247491 PositiveStrandReadsAssigned:187888 NegativeStrandReadsAssigned:16274469 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169067 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169067-trimmed-pair1.fastq SRR7169067-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,152,301 reads, 16,211,691 reads pseudoaligned [quant] estimated average fragment length: 270.283 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7169067.ke.tsv 34699 SRR7169067.se.tsv 87100 total ==> SRR7169067.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.72 311 8.86397 Potri.005G024800.1.v4.1 1035 765.717 40 2.60363 Potri.004G059700.1.v4.1 961 691.742 4 0.288206 Potri.007G009000.2.v4.1 1416 1146.72 0 0 Potri.003G141000.2.v4.1 2943 2673.72 299 5.57369 Potri.016G087400.1.v4.1 270 62.2622 1917 1534.56 Potri.015G069301.1.v4.1 564 300.603 0 0 Potri.010G195200.1.v4.1 1773 1503.72 24 0.795486 Potri.012G127500.1.v4.1 977 707.717 9225 649.672 ==> SRR7169067.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 960 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 281 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169067 completed mapping pipeline successfully