Starting /dee2/code/volunteer_pipeline.sh SRR7169068 current disk space = 3056896172032 free memory = 1577914836 SRR7169068 SRAfilesize f354733850cc9eb82973d6ae3b19de0f SRR7169068.sra SRR7169068.sra file validated SRR7169068 is paired end SRR7169068 is conventional basespace SRR7169068 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169068_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91875 34.0 33.0 34.0 33.0 34.0 2 33.331 34.0 33.0 34.0 33.0 34.0 3 33.32425 34.0 33.0 34.0 33.0 34.0 4 33.392 34.0 33.0 34.0 33.0 34.0 5 33.3815 34.0 33.0 34.0 33.0 34.0 6 36.84225 38.0 37.0 38.0 35.0 38.0 7 37.2815 38.0 38.0 38.0 36.0 38.0 8 37.43075 38.0 38.0 38.0 37.0 38.0 9 37.41575 38.0 38.0 38.0 37.0 38.0 10-14 37.440000000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.38225 38.0 38.0 38.0 37.0 38.0 20-24 37.4105 38.0 38.0 38.0 37.0 38.0 25-29 37.2966 38.0 38.0 38.0 37.0 38.0 30-34 37.303399999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.19445 38.0 38.0 38.0 36.6 38.0 40-44 36.8837 38.0 38.0 38.0 35.2 38.0 45-49 36.7592 38.0 38.0 38.0 34.6 38.0 50-54 36.63925 38.0 38.0 38.0 34.2 38.0 55-59 36.5246 38.0 38.0 38.0 34.0 38.0 60-64 36.49905 38.0 38.0 38.0 34.0 38.0 65-69 36.4497 38.0 37.4 38.0 34.0 38.0 70-74 36.37365 38.0 37.0 38.0 33.6 38.0 75-79 36.2512 38.0 37.0 38.0 33.2 38.0 80-84 36.0687 38.0 37.0 38.0 32.6 38.0 85-89 35.914100000000005 38.0 37.0 38.0 32.2 38.0 90-94 35.6653 38.0 36.6 38.0 30.6 38.0 95-99 35.521449999999994 38.0 36.0 38.0 29.8 38.0 100-104 35.4107 38.0 36.0 38.0 29.4 38.0 105-109 35.1268 38.0 35.8 38.0 28.8 38.0 110-114 34.8802 38.0 35.4 38.0 27.2 38.0 115-119 34.56245 38.0 35.0 38.0 26.0 38.0 120-124 34.3086 38.0 34.8 38.0 24.6 38.0 125-129 33.94985 38.0 34.2 38.0 22.8 38.0 130-134 33.41865 38.0 34.0 38.0 19.8 38.0 135-139 32.851150000000004 38.0 33.0 38.0 15.0 38.0 140-144 32.26415 37.0 33.0 38.0 14.0 38.0 145-149 31.4012 36.8 32.2 38.0 9.0 38.0 150-151 26.993499999999997 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 1.0 15 2.0 16 4.0 17 2.0 18 3.0 19 5.0 20 8.0 21 12.0 22 14.0 23 20.0 24 21.0 25 25.0 26 33.0 27 32.0 28 39.0 29 52.0 30 49.0 31 95.0 32 125.0 33 148.0 34 241.0 35 426.0 36 1018.0 37 1620.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.86409736308317 14.0973630831643 8.975659229208926 33.062880324543606 2 24.55 12.775 31.900000000000002 30.775000000000002 3 20.075000000000003 17.575 25.8 36.55 4 23.425 25.75 23.674999999999997 27.150000000000002 5 23.9 28.199999999999996 24.775 23.125 6 21.5 33.900000000000006 22.95 21.65 7 15.425 28.050000000000004 39.1 17.424999999999997 8 18.25 28.725 29.525000000000002 23.5 9 17.175 25.974999999999998 32.800000000000004 24.05 10-14 20.150000000000002 29.25 27.555000000000003 23.044999999999998 15-19 20.5 28.689999999999998 27.224999999999998 23.585 20-24 20.855 28.465 27.715 22.965 25-29 20.76 28.96 27.275 23.005 30-34 20.195 28.09 28.22 23.494999999999997 35-39 20.48 28.345 27.105 24.07 40-44 19.935 29.215000000000003 27.295 23.555 45-49 21.04 28.005000000000003 27.02 23.935000000000002 50-54 20.815 28.54 27.12 23.525 55-59 20.71 28.52 27.205000000000002 23.565 60-64 20.135 28.975 27.13 23.76 65-69 20.23 28.375 27.77 23.625 70-74 20.365 28.315 27.529999999999998 23.79 75-79 20.265 28.449999999999996 27.21 24.075 80-84 20.665 28.475 26.895000000000003 23.965 85-89 20.705000000000002 28.29 27.42 23.585 90-94 20.7 28.189999999999998 27.015 24.095 95-99 20.46 28.075 27.384999999999998 24.08 100-104 20.79 27.950000000000003 27.54 23.72 105-109 20.94 28.025 27.345000000000002 23.69 110-114 20.96 27.744999999999997 27.555000000000003 23.74 115-119 20.715 28.199999999999996 27.54 23.544999999999998 120-124 21.035 28.194999999999997 27.084999999999997 23.685000000000002 125-129 20.875 28.110000000000003 27.445000000000004 23.57 130-134 21.371068553427673 27.881394069703486 27.296364818240914 23.45117255862793 135-139 20.71103555177759 28.32141607080354 26.916345817290864 24.051202560128008 140-144 21.605 28.095 27.189999999999998 23.11 145-149 20.695 27.74 27.525 24.04 150-151 19.8625 28.000000000000004 28.0875 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 3.5 24 4.0 25 2.0 26 2.0 27 6.5 28 11.0 29 14.5 30 14.5 31 14.5 32 25.5 33 39.0 34 42.0 35 55.0 36 76.5 37 95.5 38 112.5 39 135.5 40 176.0 41 213.5 42 240.5 43 256.0 44 270.5 45 279.0 46 272.0 47 258.5 48 248.5 49 222.5 50 181.5 51 163.0 52 139.0 53 100.0 54 80.0 55 65.5 56 50.0 57 34.0 58 22.0 59 18.0 60 12.5 61 11.5 62 8.0 63 3.0 64 3.5 65 4.5 66 2.0 67 1.5 68 2.0 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.2374999999999998 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138-139 1.5750000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTAAAA 10 0.006830828 145.0 1 CATACAT 10 0.006830828 145.0 5 >>END_MODULE SRR7169068 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169068_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71675 33.0 33.0 34.0 32.0 34.0 2 32.9225 33.0 33.0 34.0 32.0 34.0 3 32.86025 34.0 33.0 34.0 32.0 34.0 4 32.85875 34.0 33.0 34.0 32.0 34.0 5 32.8065 34.0 33.0 34.0 32.0 34.0 6 37.05275 38.0 38.0 38.0 36.0 38.0 7 37.0735 38.0 38.0 38.0 37.0 38.0 8 37.136 38.0 38.0 38.0 37.0 38.0 9 37.14425 38.0 38.0 38.0 37.0 38.0 10-14 37.046549999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.03945 38.0 38.0 38.0 36.8 38.0 20-24 37.0293 38.0 38.0 38.0 36.6 38.0 25-29 37.048950000000005 38.0 38.0 38.0 36.6 38.0 30-34 36.99295 38.0 38.0 38.0 36.4 38.0 35-39 36.91459999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.8487 38.0 38.0 38.0 36.0 38.0 45-49 36.91705 38.0 38.0 38.0 36.0 38.0 50-54 36.84665 38.0 38.0 38.0 35.8 38.0 55-59 36.7922 38.0 38.0 38.0 35.8 38.0 60-64 36.7932 38.0 38.0 38.0 36.0 38.0 65-69 36.7505 38.0 38.0 38.0 36.0 38.0 70-74 36.64055 38.0 38.0 38.0 35.0 38.0 75-79 36.54975 38.0 38.0 38.0 34.4 38.0 80-84 36.50255 38.0 38.0 38.0 34.4 38.0 85-89 36.491499999999995 38.0 38.0 38.0 34.6 38.0 90-94 36.338 38.0 38.0 38.0 34.0 38.0 95-99 36.23815 38.0 38.0 38.0 34.0 38.0 100-104 36.1274 38.0 38.0 38.0 33.6 38.0 105-109 35.9792 38.0 37.8 38.0 33.4 38.0 110-114 35.8161 38.0 37.6 38.0 33.0 38.0 115-119 35.69785 38.0 37.2 38.0 31.4 38.0 120-124 35.529700000000005 38.0 37.0 38.0 31.0 38.0 125-129 35.20055 38.0 36.4 38.0 29.0 38.0 130-134 34.97775 38.0 36.0 38.0 27.8 38.0 135-139 34.63685 38.0 36.0 38.0 27.4 38.0 140-144 34.2089 38.0 35.0 38.0 23.6 38.0 145-149 33.5807 38.0 35.0 38.0 18.6 38.0 150-151 29.804750000000002 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 0.0 6 2.0 7 0.0 8 2.0 9 4.0 10 2.0 11 3.0 12 0.0 13 5.0 14 1.0 15 2.0 16 4.0 17 2.0 18 6.0 19 8.0 20 9.0 21 12.0 22 21.0 23 13.0 24 15.0 25 30.0 26 18.0 27 16.0 28 38.0 29 35.0 30 44.0 31 55.0 32 62.0 33 83.0 34 136.0 35 207.0 36 475.0 37 2681.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.35908977244311 23.030757689422355 13.653413353338333 26.9567391847962 2 27.306826706676667 28.93223305826457 26.481620405101275 17.27931982995749 3 20.89066800100075 27.195396547410557 31.3234926194646 20.590442832124094 4 23.225 33.300000000000004 24.425 19.05 5 25.55 35.4 21.6 17.45 6 21.5 37.375 23.200000000000003 17.925 7 21.15 23.025000000000002 37.0 18.825 8 22.025 25.650000000000002 27.375 24.95 9 21.575 25.624999999999996 28.95 23.849999999999998 10-14 23.305 28.89 25.97 21.834999999999997 15-19 23.68 28.235 26.815 21.27 20-24 23.185 28.015 26.995 21.805 25-29 23.265 28.12 27.08 21.535 30-34 22.57 27.825 27.339999999999996 22.264999999999997 35-39 23.655 28.375 27.01 20.96 40-44 23.605 28.075 27.415 20.905 45-49 22.725 27.825 28.084999999999997 21.365000000000002 50-54 23.84 27.38 27.389999999999997 21.39 55-59 23.43 27.975 27.42 21.175 60-64 23.435 27.96 27.67 20.935000000000002 65-69 23.425 27.884999999999998 27.61 21.08 70-74 23.785 27.66 27.54 21.015 75-79 23.60118005900295 27.236361818090906 28.041402070103505 21.12105605280264 80-84 23.895 27.534999999999997 27.595 20.974999999999998 85-89 23.255 28.065 27.47 21.21 90-94 23.97 27.534999999999997 27.450000000000003 21.044999999999998 95-99 23.419999999999998 27.57 27.425 21.584999999999997 100-104 24.145 27.334999999999997 27.505000000000003 21.015 105-109 23.605 27.389999999999997 28.055000000000003 20.95 110-114 24.455 27.455000000000002 27.839999999999996 20.25 115-119 24.68 27.71 27.29 20.32 120-124 23.599999999999998 28.26 27.839999999999996 20.3 125-129 24.255 27.62 26.85 21.275 130-134 24.025 28.565 26.705000000000002 20.705000000000002 135-139 24.165 27.325 27.785 20.724999999999998 140-144 23.62 27.505000000000003 27.779999999999998 21.095 145-149 24.246369554331498 27.641462193289932 27.060590886329493 21.051577366049074 150-151 23.448102538326214 27.9969841668761 27.93415431012817 20.620758984669514 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 1.0 26 1.0 27 2.5 28 3.5 29 6.5 30 10.0 31 10.0 32 13.0 33 23.5 34 31.5 35 47.5 36 68.0 37 86.0 38 117.5 39 142.5 40 173.0 41 220.5 42 270.0 43 288.5 44 281.0 45 295.5 46 304.0 47 275.0 48 247.0 49 208.0 50 181.0 51 164.0 52 126.5 53 100.5 54 70.5 55 54.0 56 46.0 57 35.0 58 25.5 59 18.5 60 15.0 61 9.5 62 7.5 63 6.5 64 4.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.15 150-151 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.7250000000000001 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.3625 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138-139 1.5750000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGGAG 10 0.006830828 145.0 145 >>END_MODULE Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771701 spots for SRR7169068.sra Written 771701 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra Read 771682 spots for SRR7169068.sra Written 771682 spots for SRR7169068.sra SRR ids: ['SRR7169068.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nweyiepg SRR7169068.sra spots: 15433659 blocks: [[1, 771682], [771683, 1543364], [1543365, 2315046], [2315047, 3086728], [3086729, 3858410], [3858411, 4630092], [4630093, 5401774], [5401775, 6173456], [6173457, 6945138], [6945139, 7716820], [7716821, 8488502], [8488503, 9260184], [9260185, 10031866], [10031867, 10803548], [10803549, 11575230], [11575231, 12346912], [12346913, 13118594], [13118595, 13890276], [13890277, 14661958], [14661959, 15433659]] SRR7169068 file size 5208260 SRR7169068 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169068 SRR7169068_1.fastq SRR7169068_2.fastq Input file: SRR7169068_1.fastq Paired file: SRR7169068_2.fastq trimmed: SRR7169068-trimmed-pair1.fastq, SRR7169068-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:22:40 2025 >> started Mon Feb 10 19:23:02 2025 >> done (21.525s) 15433659 read pairs processed; of these: 15183 ( 0.10%) short read pairs filtered out after trimming by size control 10744 ( 0.07%) empty read pairs filtered out after trimming by size control 15407732 (99.83%) read pairs available; of these: 6959061 (45.17%) trimmed read pairs available after processing 8448671 (54.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 3 0.00% 23 7 0.00% 24 4 0.00% 25 4 0.00% 26 7 0.00% 27 9 0.00% 28 4 0.00% 29 7 0.00% 30 9 0.00% 31 4 0.00% 32 10 0.00% 33 8 0.00% 34 6 0.00% 35 3 0.00% 36 7 0.00% 37 16 0.00% 38 18 0.00% 39 18 0.00% 40 13 0.00% 41 18 0.00% 42 16 0.00% 43 16 0.00% 44 27 0.00% 45 23 0.00% 46 23 0.00% 47 38 0.00% 48 27 0.00% 49 24 0.00% 50 39 0.00% 51 29 0.00% 52 36 0.00% 53 40 0.00% 54 37 0.00% 55 39 0.00% 56 65 0.00% 57 50 0.00% 58 55 0.00% 59 82 0.00% 60 64 0.00% 61 90 0.00% 62 98 0.00% 63 118 0.00% 64 98 0.00% 65 123 0.00% 66 142 0.00% 67 135 0.00% 68 160 0.00% 69 235 0.00% 70 222 0.00% 71 221 0.00% 72 276 0.00% 73 277 0.00% 74 343 0.00% 75 336 0.00% 76 383 0.00% 77 391 0.00% 78 448 0.00% 79 533 0.00% 80 548 0.00% 81 587 0.00% 82 722 0.00% 83 886 0.01% 84 1601 0.01% 85 2018 0.01% 86 2110 0.01% 87 2272 0.01% 88 2449 0.02% 89 2553 0.02% 90 2503 0.02% 91 2542 0.02% 92 2647 0.02% 93 2912 0.02% 94 3011 0.02% 95 3200 0.02% 96 3370 0.02% 97 3651 0.02% 98 3913 0.03% 99 4063 0.03% 100 4387 0.03% 101 4788 0.03% 102 4906 0.03% 103 5290 0.03% 104 5751 0.04% 105 6215 0.04% 106 6635 0.04% 107 7027 0.05% 108 7464 0.05% 109 7961 0.05% 110 8200 0.05% 111 8778 0.06% 112 9370 0.06% 113 10329 0.07% 114 10753 0.07% 115 11522 0.07% 116 12265 0.08% 117 12980 0.08% 118 13714 0.09% 119 14439 0.09% 120 15109 0.10% 121 16246 0.11% 122 17398 0.11% 123 18306 0.12% 124 19263 0.13% 125 20873 0.14% 126 22395 0.15% 127 24058 0.16% 128 25727 0.17% 129 27907 0.18% 130 29721 0.19% 131 31930 0.21% 132 34610 0.22% 133 37728 0.24% 134 40324 0.26% 135 44159 0.29% 136 48535 0.32% 137 53502 0.35% 138 60056 0.39% 139 66508 0.43% 140 74566 0.48% 141 82999 0.54% 142 96067 0.62% 143 106165 0.69% 144 125015 0.81% 145 152513 0.99% 146 192854 1.25% 147 268697 1.74% 148 417537 2.71% 149 848679 5.51% 150 3713740 24.10% 151 8448671 54.83% 15407732 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.2 sequence=CGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGGCAGTCAAAGATGAGATCACCTGAGAAACAAGGCGGTTAAGATTGGTGTAAGTGGGACGCTCAATGTCAAGAGAGCGCCTGCAAATGTCATAGATGGCCTCATTGTCAAGGAGCACAGCAACATCAGTATGCTCAAGGAGAGAGTGAGTTGAAAGGACACTGTTGTAGGGCTCTACAACTGATGTGGAAACTTGCGGGGATGGATATACAGTGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=22 fanout-score=68.65 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=14.7 sequence=CTTCTTCATCAGC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=36 prefix-density=0.26 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.18 sequence-density-rank=4 fanout-score=35.22 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=10.9 sequence=TGTTGGTGGTGG SRR7169068 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:23:47 Started mapping on | Feb 10 19:23:47 Finished on | Feb 10 19:25:34 Mapping speed, Million of reads per hour | 518.39 Number of input reads | 15407732 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14396293 Uniquely mapped reads % | 93.44% Average mapped length | 296.83 Number of splices: Total | 13432752 Number of splices: Annotated (sjdb) | 13215171 Number of splices: GT/AG | 13253479 Number of splices: GC/AG | 140966 Number of splices: AT/AC | 10548 Number of splices: Non-canonical | 27759 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258112 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 22861 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.71% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 769911 769911 769911 N_multimapping 258112 258112 258112 N_noFeature 268096 14205503 338664 N_ambiguous 185137 1176 64004 UnstrandedReadsAssigned:13943060 PositiveStrandReadsAssigned:189614 NegativeStrandReadsAssigned:13993625 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169068 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169068-trimmed-pair1.fastq SRR7169068-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,407,732 reads, 13,891,530 reads pseudoaligned [quant] estimated average fragment length: 275.3 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,291 rounds 52401 SRR7169068.ke.tsv 34699 SRR7169068.se.tsv 87100 total ==> SRR7169068.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.7 304 11.7363 Potri.005G024800.1.v4.1 1035 760.7 29 2.56633 Potri.004G059700.1.v4.1 961 686.713 2 0.196057 Potri.007G009000.2.v4.1 1416 1141.7 0 0 Potri.003G141000.2.v4.1 2943 2668.7 244.032 6.15566 Potri.016G087400.1.v4.1 270 59.0908 1185.56 1350.61 Potri.015G069301.1.v4.1 564 295.221 0 0 Potri.010G195200.1.v4.1 1773 1498.7 12 0.539007 Potri.012G127500.1.v4.1 977 702.713 2659 254.723 ==> SRR7169068.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2096 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 297 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169068 completed mapping pipeline successfully