Starting /dee2/code/volunteer_pipeline.sh SRR7169069 current disk space = 3057639084032 free memory = 1341922400 SRR7169069 SRAfilesize 07dd4672d29d7c62c86adb945b9a9e75 SRR7169069.sra SRR7169069.sra file validated SRR7169069 is paired end SRR7169069 is conventional basespace SRR7169069 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169069_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1235 34.0 33.0 34.0 33.0 34.0 2 33.3835 34.0 34.0 34.0 33.0 34.0 3 33.44275 34.0 34.0 34.0 33.0 34.0 4 33.52775 34.0 34.0 34.0 33.0 34.0 5 33.50175 34.0 34.0 34.0 33.0 34.0 6 36.941 38.0 37.0 38.0 35.0 38.0 7 37.26875 38.0 38.0 38.0 36.0 38.0 8 37.42 38.0 38.0 38.0 37.0 38.0 9 37.4205 38.0 38.0 38.0 37.0 38.0 10-14 37.47455 38.0 38.0 38.0 37.0 38.0 15-19 37.40535 38.0 38.0 38.0 37.0 38.0 20-24 37.3604 38.0 38.0 38.0 37.0 38.0 25-29 37.333600000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.282050000000005 38.0 38.0 38.0 36.6 38.0 35-39 37.12955 38.0 38.0 38.0 36.2 38.0 40-44 36.8223 38.0 38.0 38.0 35.0 38.0 45-49 36.66625 38.0 38.0 38.0 34.2 38.0 50-54 36.55155 38.0 38.0 38.0 34.0 38.0 55-59 36.4211 38.0 37.2 38.0 34.0 38.0 60-64 36.31165 38.0 37.0 38.0 33.6 38.0 65-69 36.18125 38.0 37.0 38.0 33.0 38.0 70-74 36.02885 38.0 37.0 38.0 32.4 38.0 75-79 35.93955 38.0 37.0 38.0 32.6 38.0 80-84 35.769149999999996 38.0 36.8 38.0 31.0 38.0 85-89 35.61785 38.0 36.0 38.0 30.2 38.0 90-94 35.34824999999999 38.0 36.0 38.0 29.0 38.0 95-99 35.2759 38.0 36.0 38.0 29.0 38.0 100-104 35.0502 38.0 35.8 38.0 29.0 38.0 105-109 34.9485 38.0 35.4 38.0 28.4 38.0 110-114 34.469049999999996 38.0 34.8 38.0 26.2 38.0 115-119 34.14705 38.0 34.0 38.0 23.6 38.0 120-124 33.84055 38.0 34.0 38.0 22.6 38.0 125-129 33.5336 38.0 34.0 38.0 19.0 38.0 130-134 33.00555000000001 37.4 33.4 38.0 16.2 38.0 135-139 32.390699999999995 36.6 32.0 38.0 14.8 38.0 140-144 31.87065 36.0 31.6 38.0 14.0 38.0 145-149 30.8342 36.0 31.0 38.0 8.8 38.0 150-151 26.375875 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 2.0 11 0.0 12 1.0 13 2.0 14 1.0 15 4.0 16 4.0 17 7.0 18 8.0 19 11.0 20 8.0 21 7.0 22 14.0 23 10.0 24 21.0 25 25.0 26 27.0 27 36.0 28 50.0 29 47.0 30 72.0 31 75.0 32 116.0 33 181.0 34 306.0 35 532.0 36 1145.0 37 1285.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.98001517834556 13.205160637490513 10.295977738426512 33.51884644573742 2 24.125 14.899999999999999 30.625000000000004 30.349999999999998 3 19.45 19.05 26.025 35.475 4 21.875 23.9 24.65 29.575000000000003 5 22.650000000000002 31.35 23.875 22.125 6 21.45 32.675 24.525 21.349999999999998 7 14.975 29.2 38.275 17.549999999999997 8 17.349999999999998 28.125 30.125 24.4 9 17.375 25.624999999999996 33.074999999999996 23.925 10-14 19.634999999999998 30.055 27.305 23.005 15-19 19.625 29.515 27.26 23.599999999999998 20-24 19.835 29.485 26.99 23.69 25-29 20.085 28.810000000000002 27.224999999999998 23.880000000000003 30-34 19.89 29.18 27.205000000000002 23.724999999999998 35-39 19.71 29.354999999999997 27.045 23.89 40-44 20.375 29.275000000000002 26.875 23.474999999999998 45-49 20.665 28.575 27.025 23.735 50-54 19.865 28.67 27.389999999999997 24.075 55-59 19.939999999999998 28.544999999999998 27.405 24.11 60-64 20.02 28.765 27.075 24.14 65-69 20.46 28.98 27.075 23.485 70-74 19.869999999999997 28.62 27.51 24.0 75-79 20.325 28.265 26.924999999999997 24.485 80-84 20.09 28.77 27.400000000000002 23.74 85-89 20.095 28.975 27.325 23.605 90-94 20.849999999999998 28.075 27.334999999999997 23.74 95-99 20.645 28.22 27.205000000000002 23.93 100-104 20.265 28.544999999999998 27.395000000000003 23.794999999999998 105-109 20.5 28.32 27.355 23.825 110-114 20.055 28.294999999999998 27.57 24.08 115-119 20.115 28.560000000000002 27.045 24.279999999999998 120-124 20.515 28.125 27.134999999999998 24.224999999999998 125-129 20.745 28.325 27.334999999999997 23.595 130-134 20.59 28.134999999999998 27.685 23.59 135-139 20.78 28.21 27.065 23.945 140-144 21.12 27.810000000000002 26.919999999999998 24.15 145-149 21.17 27.994999999999997 27.12 23.715 150-151 21.0 28.6625 26.35 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 1.5 23 2.0 24 1.5 25 3.5 26 8.0 27 8.0 28 10.0 29 15.0 30 20.5 31 28.5 32 35.5 33 40.0 34 50.0 35 76.5 36 90.5 37 89.5 38 109.0 39 135.0 40 181.0 41 212.5 42 221.0 43 241.0 44 259.0 45 271.5 46 267.0 47 240.5 48 234.5 49 232.5 50 193.5 51 155.5 52 127.0 53 107.5 54 87.0 55 60.0 56 37.5 57 29.0 58 25.5 59 18.5 60 12.0 61 13.0 62 11.5 63 5.0 64 4.5 65 4.0 66 1.5 67 0.5 68 1.5 69 3.0 70 2.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49672873678914 98.85000000000001 2 0.45294413688978363 0.8999999999999999 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.025163563160543533 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACATCTATCTCGTATGC 6 0.15 TruSeq Adapter, Index 8 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.30000000000000004 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.3875 0.0 0.0 0.0 0.0 126-127 0.4625 0.0 0.0 0.0 0.0 128-129 0.5875 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.7375 0.0 0.0 0.0 0.0 134-135 0.8500000000000001 0.0 0.0 0.0 0.0 136-137 1.0375 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTAAGA 10 0.006830828 145.0 1 TGATGGA 20 0.00593511 29.0 75-79 >>END_MODULE SRR7169069 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169069_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78675 33.0 33.0 34.0 32.0 34.0 2 32.79725 34.0 33.0 34.0 32.0 34.0 3 32.89175 34.0 33.0 34.0 32.0 34.0 4 32.74975 34.0 33.0 34.0 32.0 34.0 5 32.76425 34.0 33.0 34.0 32.0 34.0 6 36.9675 38.0 38.0 38.0 37.0 38.0 7 36.958 38.0 38.0 38.0 36.0 38.0 8 36.9465 38.0 38.0 38.0 36.0 38.0 9 36.95875 38.0 38.0 38.0 37.0 38.0 10-14 37.00075 38.0 38.0 38.0 37.0 38.0 15-19 36.898450000000004 38.0 38.0 38.0 36.6 38.0 20-24 36.83845 38.0 38.0 38.0 36.6 38.0 25-29 36.914 38.0 38.0 38.0 37.0 38.0 30-34 36.84745 38.0 38.0 38.0 37.0 38.0 35-39 36.8077 38.0 38.0 38.0 36.6 38.0 40-44 36.7369 38.0 38.0 38.0 36.0 38.0 45-49 36.707350000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.67265 38.0 38.0 38.0 36.0 38.0 55-59 36.6742 38.0 38.0 38.0 36.0 38.0 60-64 36.68495 38.0 38.0 38.0 36.0 38.0 65-69 36.53505 38.0 38.0 38.0 35.4 38.0 70-74 36.44405 38.0 38.0 38.0 35.0 38.0 75-79 36.3324 38.0 38.0 38.0 34.8 38.0 80-84 36.335300000000004 38.0 38.0 38.0 34.4 38.0 85-89 36.256150000000005 38.0 38.0 38.0 34.4 38.0 90-94 36.1709 38.0 38.0 38.0 34.0 38.0 95-99 36.02285 38.0 38.0 38.0 34.0 38.0 100-104 35.91695 38.0 38.0 38.0 33.4 38.0 105-109 35.84105 38.0 38.0 38.0 33.0 38.0 110-114 35.585 38.0 37.8 38.0 31.6 38.0 115-119 35.4759 38.0 37.4 38.0 31.0 38.0 120-124 35.23675 38.0 37.0 38.0 30.2 38.0 125-129 35.04185 38.0 36.6 38.0 28.8 38.0 130-134 34.8292 38.0 36.0 38.0 27.6 38.0 135-139 34.39705 38.0 35.8 38.0 25.4 38.0 140-144 34.05989999999999 38.0 35.4 38.0 22.8 38.0 145-149 33.1857 38.0 35.0 38.0 15.4 38.0 150-151 29.741125000000004 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 8.0 4 5.0 5 1.0 6 1.0 7 1.0 8 4.0 9 0.0 10 1.0 11 6.0 12 3.0 13 2.0 14 6.0 15 9.0 16 5.0 17 8.0 18 3.0 19 10.0 20 7.0 21 5.0 22 10.0 23 15.0 24 17.0 25 21.0 26 23.0 27 22.0 28 32.0 29 24.0 30 42.0 31 58.0 32 59.0 33 78.0 34 134.0 35 201.0 36 465.0 37 2696.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.2 23.724999999999998 15.25 22.825 2 29.325000000000003 26.55 26.400000000000002 17.724999999999998 3 21.175 28.625 30.45 19.75 4 22.575 34.275 22.925 20.225 5 24.825 34.8 22.85 17.525 6 22.900000000000002 35.949999999999996 21.8 19.35 7 21.075 23.175 36.375 19.375 8 22.55 24.5 27.1 25.85 9 22.5 25.174999999999997 27.675 24.65 10-14 23.735 28.854999999999997 25.72 21.69 15-19 23.64 28.299999999999997 26.655 21.404999999999998 20-24 23.580000000000002 28.375 26.615 21.43 25-29 23.835 28.765 26.590000000000003 20.810000000000002 30-34 23.44 28.384999999999998 26.8 21.375 35-39 23.96 27.650000000000002 27.38 21.01 40-44 24.26 27.544999999999998 26.889999999999997 21.305 45-49 23.775 28.044999999999998 27.084999999999997 21.095 50-54 23.565 27.68 27.279999999999998 21.475 55-59 23.855 27.715 27.275 21.154999999999998 60-64 23.525 28.105000000000004 27.279999999999998 21.09 65-69 23.999198356631094 28.433288240893834 26.73981662407936 20.827696778395712 70-74 23.69159815520353 27.331060757970725 28.10306797673952 20.874273110086225 75-79 24.2097881079998 27.22536692881831 27.926664329008666 20.63818063417322 80-84 24.44 27.389999999999997 27.355 20.815 85-89 24.57 27.339999999999996 27.465 20.625 90-94 24.2 27.735 27.67 20.395 95-99 23.87 27.505000000000003 27.495000000000005 21.13 100-104 24.45 27.779999999999998 27.265 20.505000000000003 105-109 23.835 27.245 27.665 21.255 110-114 24.099999999999998 27.485 27.32 21.095 115-119 23.91 27.74 27.474999999999998 20.875 120-124 23.91 28.225 26.99 20.875 125-129 23.835 27.3 27.944999999999997 20.919999999999998 130-134 24.57 27.24 27.615000000000002 20.575 135-139 24.317431743174318 27.302730273027304 27.77777777777778 20.602060206020603 140-144 23.924354612767658 27.826696017610566 27.31138683209926 20.937562537522513 145-149 24.287434765154554 27.54415897230028 27.378562826174228 20.789843436370937 150-151 24.565819280140953 27.875660709791088 27.422602567329474 20.135917442738485 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 1.0 26 2.5 27 3.0 28 2.5 29 3.0 30 9.0 31 10.5 32 10.5 33 18.0 34 25.5 35 38.5 36 56.5 37 87.5 38 128.0 39 151.5 40 170.5 41 210.5 42 248.0 43 262.5 44 276.0 45 296.0 46 300.0 47 300.5 48 268.0 49 215.5 50 180.5 51 157.0 52 129.5 53 102.5 54 84.0 55 65.0 56 52.0 57 39.5 58 28.0 59 14.0 60 11.0 61 10.0 62 6.0 63 4.5 64 5.0 65 3.5 66 1.5 67 1.5 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.20500000000000002 70-74 0.26 75-79 0.185 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.06 145-149 0.36 150-151 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57243460764587 98.97500000000001 2 0.35211267605633806 0.7000000000000001 3 0.025150905432595575 0.075 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.025150905432595575 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.2625 0.0 0.0 0.0 0.0 120-121 0.30000000000000004 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.3875 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.5875 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.7124999999999999 0.0 0.0 0.0 0.0 134-135 0.825 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138-139 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 130-134 >>END_MODULE Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745644 spots for SRR7169069.sra Written 745644 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra Read 745626 spots for SRR7169069.sra Written 745626 spots for SRR7169069.sra SRR ids: ['SRR7169069.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4vq3dike SRR7169069.sra spots: 14912538 blocks: [[1, 745626], [745627, 1491252], [1491253, 2236878], [2236879, 2982504], [2982505, 3728130], [3728131, 4473756], [4473757, 5219382], [5219383, 5965008], [5965009, 6710634], [6710635, 7456260], [7456261, 8201886], [8201887, 8947512], [8947513, 9693138], [9693139, 10438764], [10438765, 11184390], [11184391, 11930016], [11930017, 12675642], [12675643, 13421268], [13421269, 14166894], [14166895, 14912538]] SRR7169069 file size 5031669 SRR7169069 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169069 SRR7169069_1.fastq SRR7169069_2.fastq Input file: SRR7169069_1.fastq Paired file: SRR7169069_2.fastq trimmed: SRR7169069-trimmed-pair1.fastq, SRR7169069-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:18:41 2025 >> started Mon Feb 10 18:18:58 2025 >> done (17.208s) 14912538 read pairs processed; of these: 22085 ( 0.15%) short read pairs filtered out after trimming by size control 29909 ( 0.20%) empty read pairs filtered out after trimming by size control 14860544 (99.65%) read pairs available; of these: 7320400 (49.26%) trimmed read pairs available after processing 7540144 (50.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 6 0.00% 21 5 0.00% 22 12 0.00% 23 7 0.00% 24 2 0.00% 25 9 0.00% 26 3 0.00% 27 20 0.00% 28 5 0.00% 29 12 0.00% 30 15 0.00% 31 19 0.00% 32 7 0.00% 33 11 0.00% 34 8 0.00% 35 10 0.00% 36 23 0.00% 37 19 0.00% 38 20 0.00% 39 12 0.00% 40 11 0.00% 41 16 0.00% 42 32 0.00% 43 37 0.00% 44 24 0.00% 45 39 0.00% 46 50 0.00% 47 30 0.00% 48 34 0.00% 49 33 0.00% 50 32 0.00% 51 51 0.00% 52 64 0.00% 53 63 0.00% 54 60 0.00% 55 61 0.00% 56 86 0.00% 57 82 0.00% 58 80 0.00% 59 79 0.00% 60 115 0.00% 61 120 0.00% 62 129 0.00% 63 137 0.00% 64 150 0.00% 65 179 0.00% 66 207 0.00% 67 175 0.00% 68 222 0.00% 69 240 0.00% 70 266 0.00% 71 323 0.00% 72 318 0.00% 73 327 0.00% 74 387 0.00% 75 380 0.00% 76 468 0.00% 77 515 0.00% 78 514 0.00% 79 649 0.00% 80 657 0.00% 81 803 0.01% 82 889 0.01% 83 1125 0.01% 84 2014 0.01% 85 2493 0.02% 86 2550 0.02% 87 2693 0.02% 88 2859 0.02% 89 2863 0.02% 90 2987 0.02% 91 3033 0.02% 92 3302 0.02% 93 3480 0.02% 94 3620 0.02% 95 3669 0.02% 96 3978 0.03% 97 4383 0.03% 98 4775 0.03% 99 4911 0.03% 100 5283 0.04% 101 5487 0.04% 102 5967 0.04% 103 6258 0.04% 104 6478 0.04% 105 7137 0.05% 106 7522 0.05% 107 7950 0.05% 108 8430 0.06% 109 8770 0.06% 110 9470 0.06% 111 10052 0.07% 112 10650 0.07% 113 11388 0.08% 114 11870 0.08% 115 12682 0.09% 116 13421 0.09% 117 14267 0.10% 118 15160 0.10% 119 15959 0.11% 120 16808 0.11% 121 17830 0.12% 122 19043 0.13% 123 20405 0.14% 124 21663 0.15% 125 23016 0.15% 126 24630 0.17% 127 26608 0.18% 128 28120 0.19% 129 29917 0.20% 130 32165 0.22% 131 34746 0.23% 132 37388 0.25% 133 40658 0.27% 134 43544 0.29% 135 47552 0.32% 136 52099 0.35% 137 57669 0.39% 138 64151 0.43% 139 71439 0.48% 140 78962 0.53% 141 87797 0.59% 142 99503 0.67% 143 114799 0.77% 144 135864 0.91% 145 167390 1.13% 146 218600 1.47% 147 303593 2.04% 148 478745 3.22% 149 935490 6.30% 150 3731900 25.11% 151 7540144 50.74% 14860544 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=298.35 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=18.6 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=32 prefix-density=0.34 prefix-fanout=2.6 sequence=GTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=137.06 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=14.2 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169069 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:19:51 Started mapping on | Feb 10 18:19:51 Finished on | Feb 10 18:21:50 Mapping speed, Million of reads per hour | 449.56 Number of input reads | 14860544 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13604385 Uniquely mapped reads % | 91.55% Average mapped length | 296.09 Number of splices: Total | 12351259 Number of splices: Annotated (sjdb) | 12147020 Number of splices: GT/AG | 12180118 Number of splices: GC/AG | 137068 Number of splices: AT/AC | 9361 Number of splices: Non-canonical | 24712 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299038 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 22453 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.24% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 979020 979020 979020 N_multimapping 299038 299038 299038 N_noFeature 252670 13425005 322517 N_ambiguous 166352 803 56315 UnstrandedReadsAssigned:13185363 PositiveStrandReadsAssigned:178577 NegativeStrandReadsAssigned:13225553 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169069 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169069-trimmed-pair1.fastq SRR7169069-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,860,544 reads, 13,170,028 reads pseudoaligned [quant] estimated average fragment length: 271.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7169069.ke.tsv 34699 SRR7169069.se.tsv 87100 total ==> SRR7169069.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.26 205 6.94244 Potri.005G024800.1.v4.1 1035 764.26 65 5.03255 Potri.004G059700.1.v4.1 961 690.277 5 0.42861 Potri.007G009000.2.v4.1 1416 1145.26 0 0 Potri.003G141000.2.v4.1 2943 2672.26 227 5.02647 Potri.016G087400.1.v4.1 270 59.0394 1684.49 1688.27 Potri.015G069301.1.v4.1 564 297.798 0 0 Potri.010G195200.1.v4.1 1773 1502.26 8 0.315109 Potri.012G127500.1.v4.1 977 706.266 3801 318.453 ==> SRR7169069.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1309 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169069 completed mapping pipeline successfully