Starting /dee2/code/volunteer_pipeline.sh SRR7169070 current disk space = 3057303584768 free memory = 1395566212 SRR7169070 SRAfilesize a4a188f951b12694e73c64d6abd6b4c3 SRR7169070.sra SRR7169070.sra file validated SRR7169070 is paired end SRR7169070 is conventional basespace SRR7169070 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169070_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3355 34.0 33.0 34.0 32.0 34.0 2 33.29275 34.0 33.0 34.0 32.0 34.0 3 33.36725 34.0 33.0 34.0 32.0 34.0 4 33.48225 34.0 33.0 34.0 33.0 34.0 5 33.43375 34.0 33.0 34.0 33.0 34.0 6 37.15325 38.0 37.0 38.0 36.0 38.0 7 35.56025 38.0 37.0 38.0 29.0 38.0 8 36.25 38.0 37.0 38.0 33.0 38.0 9 37.194 38.0 38.0 38.0 36.0 38.0 10-14 37.3902 38.0 38.0 38.0 36.8 38.0 15-19 37.11155 38.0 38.0 38.0 36.0 38.0 20-24 37.4233 38.0 38.0 38.0 37.0 38.0 25-29 37.30995 38.0 38.0 38.0 37.0 38.0 30-34 37.30935 38.0 38.0 38.0 36.8 38.0 35-39 37.37325 38.0 38.0 38.0 37.0 38.0 40-44 36.85680000000001 38.0 37.8 38.0 35.2 38.0 45-49 36.7725 38.0 38.0 38.0 34.8 38.0 50-54 36.338100000000004 38.0 37.4 38.0 32.8 38.0 55-59 36.310249999999996 38.0 37.4 38.0 32.8 38.0 60-64 36.391600000000004 38.0 37.8 38.0 33.0 38.0 65-69 36.297200000000004 38.0 37.0 38.0 33.4 38.0 70-74 36.08785 38.0 37.0 38.0 32.6 38.0 75-79 36.325849999999996 38.0 37.0 38.0 33.6 38.0 80-84 36.13855 38.0 37.0 38.0 33.2 38.0 85-89 35.83625 38.0 36.8 38.0 31.2 38.0 90-94 35.75475 38.0 36.8 38.0 31.0 38.0 95-99 35.615449999999996 38.0 36.4 38.0 30.6 38.0 100-104 35.0322 38.0 35.6 38.0 27.8 38.0 105-109 34.46855 38.0 34.8 38.0 25.0 38.0 110-114 34.66225 38.0 34.6 38.0 26.4 38.0 115-119 34.551550000000006 38.0 34.8 38.0 26.2 38.0 120-124 34.04075 38.0 34.0 38.0 23.0 38.0 125-129 33.60265 38.0 34.0 38.0 19.4 38.0 130-134 33.5167 38.0 33.6 38.0 22.0 38.0 135-139 32.81015 37.6 32.2 38.0 17.4 38.0 140-144 31.47015 36.0 30.4 38.0 13.6 38.0 145-149 30.250549999999997 36.0 30.0 38.0 8.6 38.0 150-151 25.481625 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 2.0 14 2.0 15 2.0 16 1.0 17 5.0 18 2.0 19 6.0 20 6.0 21 8.0 22 14.0 23 17.0 24 16.0 25 24.0 26 39.0 27 32.0 28 51.0 29 72.0 30 74.0 31 91.0 32 135.0 33 211.0 34 259.0 35 507.0 36 1028.0 37 1394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.15651723244364 11.816532780513086 10.287639284788805 33.73931070225447 2 22.7 13.575000000000001 32.574999999999996 31.15 3 19.275000000000002 19.075 25.674999999999997 35.975 4 22.525000000000002 26.0 24.65 26.825 5 22.35 32.9 23.575 21.175 6 20.825 34.5 23.7 20.974999999999998 7 15.7 28.125 39.125 17.05 8 17.8 27.700000000000003 31.025000000000002 23.474999999999998 9 18.05 26.325 31.775 23.849999999999998 10-14 19.885 29.81 26.950000000000003 23.355 15-19 20.235 28.57 27.700000000000003 23.494999999999997 20-24 19.801980198019802 28.352835283528353 27.92279227922792 23.92239223922392 25-29 20.09 28.455000000000002 28.335 23.119999999999997 30-34 19.806980698069808 29.157915791579157 27.567756775677566 23.467346734673466 35-39 20.111005550277515 29.24146207310366 26.866343317165857 23.781189059452974 40-44 20.55116534960488 29.08372511753526 27.238171451435434 23.126938081424427 45-49 19.625 28.84 27.515 24.02 50-54 19.97 28.92 27.105 24.005000000000003 55-59 20.265 28.689999999999998 27.150000000000002 23.895 60-64 19.975 28.970000000000002 27.0 24.055 65-69 20.09 28.660000000000004 27.48 23.77 70-74 20.615 28.694999999999997 27.57 23.119999999999997 75-79 19.81 28.194999999999997 27.839999999999996 24.154999999999998 80-84 20.36 28.694999999999997 27.345000000000002 23.599999999999998 85-89 20.369999999999997 28.625 27.310000000000002 23.695 90-94 20.084016803360672 28.815763152630524 27.015403080616124 24.084816963392676 95-99 19.564999999999998 28.705000000000002 27.395000000000003 24.335 100-104 19.744999999999997 28.189999999999998 27.650000000000002 24.415 105-109 19.49 28.505000000000003 28.000000000000004 24.005000000000003 110-114 19.945 28.325 27.825 23.905 115-119 19.965 28.599999999999998 26.889999999999997 24.545 120-124 20.165 28.735 27.205000000000002 23.895 125-129 20.04 27.68 28.544999999999998 23.735 130-134 20.48 28.18 27.115000000000002 24.224999999999998 135-139 21.04710471047105 27.97779777977798 27.567756775677566 23.407340734073408 140-144 20.495 27.544999999999998 27.92 24.04 145-149 20.307030703070307 28.28782878287829 27.607760776077605 23.7973797379738 150-151 20.5 28.1625 26.974999999999998 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 3.5 25 4.5 26 5.0 27 7.0 28 10.5 29 10.5 30 11.5 31 23.5 32 34.0 33 41.0 34 60.5 35 76.5 36 81.0 37 97.0 38 127.0 39 176.0 40 207.0 41 203.0 42 217.5 43 252.0 44 274.0 45 259.5 46 248.5 47 258.0 48 247.0 49 217.5 50 174.5 51 134.0 52 109.5 53 101.0 54 89.0 55 68.5 56 46.0 57 28.0 58 22.0 59 16.5 60 11.5 61 9.0 62 8.0 63 4.0 64 2.5 65 3.5 66 2.5 67 1.5 68 2.0 69 2.0 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.01 35-39 0.005 40-44 0.03 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.02 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.38749999999999996 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.2 0.0 0.0 0.0 0.0 134-135 1.3250000000000002 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAG 35 0.003315817 62.12679 9 >>END_MODULE SRR7169070 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169070_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9925 33.0 33.0 34.0 32.0 34.0 2 33.02675 34.0 33.0 34.0 32.0 34.0 3 33.02375 34.0 33.0 34.0 32.0 34.0 4 32.95875 34.0 33.0 34.0 32.0 34.0 5 32.95225 34.0 33.0 34.0 32.0 34.0 6 37.0935 38.0 38.0 38.0 37.0 38.0 7 37.0955 38.0 38.0 38.0 37.0 38.0 8 36.4505 38.0 38.0 38.0 34.0 38.0 9 36.98675 38.0 38.0 38.0 36.0 38.0 10-14 36.99725 38.0 38.0 38.0 36.6 38.0 15-19 37.11235 38.0 38.0 38.0 37.0 38.0 20-24 36.989 38.0 38.0 38.0 36.2 38.0 25-29 37.032149999999994 38.0 38.0 38.0 36.8 38.0 30-34 37.037850000000006 38.0 38.0 38.0 37.0 38.0 35-39 36.76225 38.0 38.0 38.0 35.8 38.0 40-44 36.79455 38.0 38.0 38.0 35.8 38.0 45-49 36.915000000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.9249 38.0 38.0 38.0 36.0 38.0 55-59 36.802600000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.682300000000005 38.0 38.0 38.0 35.4 38.0 65-69 36.6374 38.0 38.0 38.0 35.4 38.0 70-74 36.557 38.0 38.0 38.0 35.0 38.0 75-79 36.44285 38.0 38.0 38.0 34.0 38.0 80-84 36.325950000000006 38.0 38.0 38.0 34.0 38.0 85-89 36.042249999999996 38.0 37.8 38.0 32.8 38.0 90-94 36.025800000000004 38.0 38.0 38.0 33.2 38.0 95-99 36.170500000000004 38.0 38.0 38.0 33.8 38.0 100-104 36.014300000000006 38.0 37.8 38.0 32.8 38.0 105-109 35.65840000000001 38.0 37.0 38.0 31.0 38.0 110-114 35.376799999999996 38.0 36.8 38.0 29.2 38.0 115-119 35.126200000000004 38.0 36.0 38.0 28.2 38.0 120-124 35.17675 38.0 36.2 38.0 29.0 38.0 125-129 34.5767 38.0 35.4 38.0 25.4 38.0 130-134 34.176750000000006 38.0 35.0 38.0 23.0 38.0 135-139 33.749449999999996 38.0 34.6 38.0 20.6 38.0 140-144 33.53165 38.0 34.0 38.0 20.6 38.0 145-149 32.5246 38.0 33.2 38.0 13.2 38.0 150-151 28.352 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 3.0 5 2.0 6 3.0 7 1.0 8 1.0 9 2.0 10 1.0 11 2.0 12 1.0 13 1.0 14 1.0 15 2.0 16 2.0 17 7.0 18 10.0 19 9.0 20 6.0 21 8.0 22 9.0 23 13.0 24 19.0 25 26.0 26 29.0 27 20.0 28 38.0 29 40.0 30 52.0 31 60.0 32 104.0 33 113.0 34 163.0 35 270.0 36 638.0 37 2333.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.83445861465366 22.80570142535634 13.928482120530134 25.431357839459867 2 28.782195548887223 26.581645411352838 26.93173293323331 17.704426106526633 3 21.3 27.625 31.674999999999997 19.400000000000002 4 23.375 33.125 23.95 19.55 5 25.025 34.125 22.775000000000002 18.075 6 21.375 37.625 23.849999999999998 17.150000000000002 7 21.175 22.275 38.074999999999996 18.475 8 22.25 27.500000000000004 26.75 23.5 9 22.5 24.875 30.075000000000003 22.55 10-14 22.875 29.125 26.810000000000002 21.19 15-19 23.169999999999998 28.115000000000002 27.589999999999996 21.125 20-24 23.345 28.005000000000003 27.605 21.044999999999998 25-29 23.105 27.83 27.76 21.305 30-34 23.200000000000003 28.389999999999997 27.384999999999998 21.025 35-39 22.52 27.939999999999998 28.125 21.415 40-44 23.294999999999998 27.74 27.800000000000004 21.165 45-49 23.76 27.485 28.04 20.715 50-54 23.085 28.065 27.685 21.165 55-59 23.465 28.215 27.54 20.78 60-64 23.24 26.91 28.634999999999998 21.215 65-69 23.669999999999998 27.92 27.575 20.835 70-74 23.805 27.76 27.700000000000003 20.735 75-79 23.74 26.974999999999998 28.389999999999997 20.895 80-84 23.955000000000002 27.694999999999997 27.700000000000003 20.65 85-89 23.925 27.87 27.575 20.630000000000003 90-94 24.135 27.005000000000003 28.439999999999998 20.419999999999998 95-99 23.885 27.200000000000003 28.485 20.43 100-104 24.09 27.92 27.46 20.53 105-109 23.599999999999998 27.500000000000004 28.065 20.835 110-114 23.61 28.065 27.625 20.7 115-119 23.855 27.67 27.975 20.5 120-124 23.575 27.915 27.884999999999998 20.625 125-129 24.285 27.384999999999998 27.894999999999996 20.435 130-134 24.465 27.089999999999996 28.005000000000003 20.44 135-139 23.855 28.13 27.544999999999998 20.47 140-144 24.03 28.415000000000003 27.595 19.96 145-149 24.19 27.77 27.485 20.555 150-151 23.925 27.487499999999997 27.625 20.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 4.5 28 6.0 29 5.0 30 6.0 31 14.0 32 20.0 33 27.5 34 40.0 35 59.0 36 71.5 37 96.0 38 126.5 39 158.5 40 200.5 41 217.0 42 266.5 43 301.0 44 285.5 45 285.5 46 278.5 47 252.5 48 240.0 49 210.0 50 165.0 51 151.5 52 140.0 53 107.5 54 70.0 55 50.5 56 38.5 57 27.0 58 19.0 59 11.5 60 7.0 61 6.5 62 7.0 63 6.5 64 5.0 65 4.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.2 0.0 0.0 0.0 0.0 134-135 1.3250000000000002 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110934 spots for SRR7169070.sra Written 1110934 spots for SRR7169070.sra Read 1110948 spots for SRR7169070.sra Written 1110948 spots for SRR7169070.sra SRR ids: ['SRR7169070.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sb6ciw07 SRR7169070.sra spots: 22218694 blocks: [[1, 1110934], [1110935, 2221868], [2221869, 3332802], [3332803, 4443736], [4443737, 5554670], [5554671, 6665604], [6665605, 7776538], [7776539, 8887472], [8887473, 9998406], [9998407, 11109340], [11109341, 12220274], [12220275, 13331208], [13331209, 14442142], [14442143, 15553076], [15553077, 16664010], [16664011, 17774944], [17774945, 18885878], [18885879, 19996812], [19996813, 21107746], [21107747, 22218694]] SRR7169070 file size 7507485 SRR7169070 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169070 SRR7169070_1.fastq SRR7169070_2.fastq Input file: SRR7169070_1.fastq Paired file: SRR7169070_2.fastq trimmed: SRR7169070-trimmed-pair1.fastq, SRR7169070-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:53:55 2025 >> started Mon Feb 10 18:54:20 2025 >> done (25.229s) 22218694 read pairs processed; of these: 26383 ( 0.12%) short read pairs filtered out after trimming by size control 15409 ( 0.07%) empty read pairs filtered out after trimming by size control 22176902 (99.81%) read pairs available; of these: 10913551 (49.21%) trimmed read pairs available after processing 11263351 (50.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 7 0.00% 21 8 0.00% 22 5 0.00% 23 3 0.00% 24 8 0.00% 25 7 0.00% 26 11 0.00% 27 11 0.00% 28 10 0.00% 29 8 0.00% 30 15 0.00% 31 7 0.00% 32 9 0.00% 33 9 0.00% 34 12 0.00% 35 12 0.00% 36 11 0.00% 37 10 0.00% 38 12 0.00% 39 21 0.00% 40 14 0.00% 41 14 0.00% 42 14 0.00% 43 16 0.00% 44 18 0.00% 45 23 0.00% 46 27 0.00% 47 30 0.00% 48 29 0.00% 49 27 0.00% 50 25 0.00% 51 38 0.00% 52 46 0.00% 53 43 0.00% 54 51 0.00% 55 50 0.00% 56 48 0.00% 57 67 0.00% 58 70 0.00% 59 88 0.00% 60 101 0.00% 61 101 0.00% 62 106 0.00% 63 115 0.00% 64 138 0.00% 65 125 0.00% 66 182 0.00% 67 202 0.00% 68 249 0.00% 69 268 0.00% 70 329 0.00% 71 331 0.00% 72 293 0.00% 73 328 0.00% 74 333 0.00% 75 436 0.00% 76 525 0.00% 77 527 0.00% 78 565 0.00% 79 680 0.00% 80 801 0.00% 81 922 0.00% 82 1032 0.00% 83 1250 0.01% 84 2358 0.01% 85 3123 0.01% 86 3311 0.01% 87 3532 0.02% 88 3765 0.02% 89 3714 0.02% 90 4060 0.02% 91 4118 0.02% 92 4460 0.02% 93 4283 0.02% 94 4567 0.02% 95 4830 0.02% 96 4914 0.02% 97 5468 0.02% 98 5613 0.03% 99 6063 0.03% 100 6600 0.03% 101 6911 0.03% 102 7421 0.03% 103 7922 0.04% 104 8326 0.04% 105 8892 0.04% 106 9491 0.04% 107 10043 0.05% 108 10860 0.05% 109 11244 0.05% 110 12002 0.05% 111 12811 0.06% 112 13590 0.06% 113 14457 0.07% 114 15459 0.07% 115 16621 0.07% 116 17466 0.08% 117 18539 0.08% 118 19443 0.09% 119 20446 0.09% 120 21448 0.10% 121 22654 0.10% 122 24192 0.11% 123 25812 0.12% 124 27911 0.13% 125 29616 0.13% 126 31883 0.14% 127 34574 0.16% 128 37056 0.17% 129 39637 0.18% 130 42225 0.19% 131 45555 0.21% 132 49784 0.22% 133 53903 0.24% 134 58524 0.26% 135 64021 0.29% 136 70890 0.32% 137 77543 0.35% 138 85561 0.39% 139 95597 0.43% 140 106386 0.48% 141 121347 0.55% 142 141364 0.64% 143 162192 0.73% 144 199552 0.90% 145 248403 1.12% 146 317530 1.43% 147 447136 2.02% 148 690351 3.11% 149 1348261 6.08% 150 5865035 26.45% 151 11263351 50.79% 22176902 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=36 prefix-density=0.19 prefix-fanout=2.6 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCAGGTGGTGCTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=271.14 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=35 prefix-density=0.35 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=219.44 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=24.7 sequence=GAAGAAGAAGAAA SRR7169070 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:55:07 Started mapping on | Feb 10 18:55:07 Finished on | Feb 10 18:57:37 Mapping speed, Million of reads per hour | 532.25 Number of input reads | 22176902 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20819172 Uniquely mapped reads % | 93.88% Average mapped length | 296.63 Number of splices: Total | 20171778 Number of splices: Annotated (sjdb) | 19834938 Number of splices: GT/AG | 19875888 Number of splices: GC/AG | 236086 Number of splices: AT/AC | 16793 Number of splices: Non-canonical | 43011 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399333 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 25703 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.18% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 985464 985464 985464 N_multimapping 399333 399333 399333 N_noFeature 482723 20577400 599907 N_ambiguous 211359 2098 85019 UnstrandedReadsAssigned:20125090 PositiveStrandReadsAssigned:239674 NegativeStrandReadsAssigned:20134246 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169070 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169070-trimmed-pair1.fastq SRR7169070-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,176,902 reads, 19,973,352 reads pseudoaligned [quant] estimated average fragment length: 276.239 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR7169070.ke.tsv 34699 SRR7169070.se.tsv 87100 total ==> SRR7169070.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.76 487 12.4622 Potri.005G024800.1.v4.1 1035 759.761 52 3.05232 Potri.004G059700.1.v4.1 961 685.789 5 0.32515 Potri.007G009000.2.v4.1 1416 1140.76 0 0 Potri.003G141000.2.v4.1 2943 2667.76 418.066 6.98879 Potri.016G087400.1.v4.1 270 60.5226 2094 1542.99 Potri.015G069301.1.v4.1 564 295.294 0 0 Potri.010G195200.1.v4.1 1773 1497.76 19 0.565737 Potri.012G127500.1.v4.1 977 701.761 11909 756.815 ==> SRR7169070.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1920 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 362 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169070 completed mapping pipeline successfully