Starting /dee2/code/volunteer_pipeline.sh SRR7169071 current disk space = 3056896172032 free memory = 1516702124 SRR7169071 SRAfilesize 6a7b4c23fe1d11f4f76ed0b7b3b4f072 SRR7169071.sra SRR7169071.sra file validated SRR7169071 is paired end SRR7169071 is conventional basespace SRR7169071 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169071_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9745 34.0 33.0 34.0 33.0 34.0 2 33.4555 34.0 34.0 34.0 33.0 34.0 3 33.52 34.0 34.0 34.0 33.0 34.0 4 33.519 34.0 34.0 34.0 33.0 34.0 5 33.57525 34.0 34.0 34.0 33.0 34.0 6 37.24775 38.0 38.0 38.0 36.0 38.0 7 37.48375 38.0 38.0 38.0 37.0 38.0 8 37.50425 38.0 38.0 38.0 37.0 38.0 9 37.53575 38.0 38.0 38.0 38.0 38.0 10-14 37.48455 38.0 38.0 38.0 37.4 38.0 15-19 37.4288 38.0 38.0 38.0 37.0 38.0 20-24 37.44325 38.0 38.0 38.0 37.0 38.0 25-29 37.35675 38.0 38.0 38.0 37.0 38.0 30-34 37.29105 38.0 38.0 38.0 36.8 38.0 35-39 37.11905 38.0 38.0 38.0 36.6 38.0 40-44 36.71045 38.0 38.0 38.0 34.6 38.0 45-49 36.4915 38.0 38.0 38.0 34.0 38.0 50-54 36.41459999999999 38.0 38.0 38.0 33.8 38.0 55-59 36.25515 38.0 37.0 38.0 33.4 38.0 60-64 36.21255 38.0 37.0 38.0 33.0 38.0 65-69 36.01625 38.0 37.0 38.0 32.6 38.0 70-74 35.984750000000005 38.0 37.0 38.0 32.8 38.0 75-79 35.75425 38.0 37.0 38.0 31.0 38.0 80-84 35.6975 38.0 37.0 38.0 31.0 38.0 85-89 35.44595 38.0 36.2 38.0 29.4 38.0 90-94 35.18175 38.0 36.0 38.0 28.8 38.0 95-99 35.194649999999996 38.0 36.0 38.0 29.0 38.0 100-104 34.70285 38.0 35.4 38.0 27.2 38.0 105-109 34.55989999999999 38.0 35.0 38.0 26.0 38.0 110-114 34.09385 38.0 34.4 38.0 23.0 38.0 115-119 34.02035 38.0 34.2 38.0 23.0 38.0 120-124 33.716750000000005 38.0 34.2 38.0 19.4 38.0 125-129 33.1565 37.8 33.4 38.0 15.0 38.0 130-134 32.623000000000005 37.4 32.6 38.0 15.0 38.0 135-139 32.4269 37.4 32.6 38.0 14.6 38.0 140-144 31.689249999999998 36.0 31.0 38.0 14.0 38.0 145-149 30.66175 36.0 30.6 38.0 8.6 38.0 150-151 26.464875 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 3.0 11 6.0 12 2.0 13 5.0 14 4.0 15 10.0 16 5.0 17 7.0 18 4.0 19 8.0 20 13.0 21 13.0 22 9.0 23 19.0 24 20.0 25 30.0 26 44.0 27 35.0 28 45.0 29 53.0 30 72.0 31 88.0 32 119.0 33 162.0 34 254.0 35 478.0 36 1049.0 37 1440.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.53728684143548 15.118350725375413 10.537032323746502 32.8073301094426 2 24.0 14.149999999999999 31.2 30.65 3 18.975 18.975 27.275 34.775 4 21.275 24.15 25.474999999999998 29.099999999999998 5 22.6 30.825000000000003 23.674999999999997 22.900000000000002 6 19.950000000000003 33.900000000000006 24.8 21.349999999999998 7 14.075 30.925000000000004 38.1 16.900000000000002 8 16.85 28.9 31.275 22.975 9 16.475 28.1 33.800000000000004 21.625 10-14 18.615000000000002 31.569999999999997 27.965 21.85 15-19 18.865000000000002 30.375000000000004 27.175 23.585 20-24 18.925 30.615 27.08 23.380000000000003 25-29 19.0 30.495 26.99 23.515 30-34 19.43 29.904999999999998 27.265 23.400000000000002 35-39 19.245 29.299999999999997 27.325 24.13 40-44 19.470000000000002 29.815 27.279999999999998 23.435 45-49 19.405 30.070000000000004 27.395000000000003 23.13 50-54 19.05 30.2 26.695 24.055 55-59 19.49 29.99 27.310000000000002 23.21 60-64 19.67 29.575000000000003 26.784999999999997 23.97 65-69 19.525000000000002 29.39 27.47 23.615 70-74 19.265 29.805 27.529999999999998 23.400000000000002 75-79 19.794999999999998 29.29 27.255000000000003 23.66 80-84 19.5 29.15 27.49 23.86 85-89 19.72 29.39 27.029999999999998 23.86 90-94 20.13 29.365000000000002 26.490000000000002 24.015 95-99 19.735 28.945 27.16 24.16 100-104 20.06205274483311 28.71941149977481 27.44332682780363 23.77520892758845 105-109 19.665 28.854999999999997 27.334999999999997 24.145 110-114 20.109158279505284 28.36112362926243 27.795303189624953 23.73441490160733 115-119 19.945 29.4 26.61 24.044999999999998 120-124 20.281224979983985 28.93314651721377 26.551240992794234 24.234387510008006 125-129 20.005 28.084999999999997 27.544999999999998 24.365000000000002 130-134 20.599999999999998 28.48 27.084999999999997 23.835 135-139 20.235 28.244999999999997 26.875 24.645 140-144 20.165 28.375 27.345000000000002 24.115000000000002 145-149 20.855 28.015 26.465 24.665 150-151 20.2625 28.6875 26.937499999999996 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.5 11 1.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 1.5 19 0.0 20 1.5 21 2.0 22 3.5 23 4.0 24 3.0 25 7.5 26 12.5 27 15.0 28 17.0 29 19.5 30 33.5 31 42.5 32 55.5 33 75.0 34 84.0 35 98.5 36 116.5 37 131.5 38 136.0 39 163.5 40 196.0 41 194.0 42 212.5 43 233.0 44 232.5 45 228.5 46 231.5 47 239.5 48 210.0 49 167.0 50 158.0 51 147.5 52 110.0 53 88.5 54 73.5 55 59.0 56 47.0 57 29.5 58 27.0 59 26.5 60 16.0 61 10.0 62 10.0 63 9.0 64 5.5 65 2.0 66 0.5 67 0.0 68 0.5 69 2.0 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.0 110-114 0.145 115-119 0.0 120-124 0.08 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.3265511178095956 0.65 3 0.07535795026375283 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.5125000000000002 0.0 0.0 0.0 0.0 138-139 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCTCA 10 0.0068343505 144.975 145 >>END_MODULE SRR7169071 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169071_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77375 33.0 33.0 34.0 32.0 34.0 2 32.89975 34.0 33.0 34.0 32.0 34.0 3 32.867 34.0 33.0 34.0 32.0 34.0 4 32.8115 34.0 33.0 34.0 32.0 34.0 5 32.87225 34.0 33.0 34.0 32.0 34.0 6 37.03975 38.0 38.0 38.0 37.0 38.0 7 36.9725 38.0 38.0 38.0 37.0 38.0 8 36.875 38.0 38.0 38.0 37.0 38.0 9 36.9805 38.0 38.0 38.0 37.0 38.0 10-14 36.884750000000004 38.0 38.0 38.0 37.0 38.0 15-19 36.930600000000005 38.0 38.0 38.0 37.0 38.0 20-24 36.859899999999996 38.0 38.0 38.0 37.0 38.0 25-29 36.8274 38.0 38.0 38.0 37.0 38.0 30-34 36.800399999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.78 38.0 38.0 38.0 36.8 38.0 40-44 36.7143 38.0 38.0 38.0 36.4 38.0 45-49 36.69435 38.0 38.0 38.0 36.2 38.0 50-54 36.5745 38.0 38.0 38.0 36.0 38.0 55-59 36.49535 38.0 38.0 38.0 36.0 38.0 60-64 36.38945 38.0 38.0 38.0 35.6 38.0 65-69 36.2037 38.0 38.0 38.0 35.0 38.0 70-74 36.12145 38.0 38.0 38.0 34.6 38.0 75-79 36.0416 38.0 38.0 38.0 34.2 38.0 80-84 36.16705 38.0 38.0 38.0 34.0 38.0 85-89 36.1356 38.0 38.0 38.0 34.4 38.0 90-94 36.02535 38.0 38.0 38.0 34.0 38.0 95-99 35.92225 38.0 38.0 38.0 33.8 38.0 100-104 35.70325 38.0 38.0 38.0 33.0 38.0 105-109 35.4678 38.0 38.0 38.0 31.0 38.0 110-114 35.4084 38.0 37.8 38.0 30.8 38.0 115-119 35.26005 38.0 37.6 38.0 29.8 38.0 120-124 35.1123 38.0 37.2 38.0 29.0 38.0 125-129 34.7699 38.0 36.2 38.0 27.6 38.0 130-134 34.5726 38.0 36.0 38.0 26.4 38.0 135-139 34.00485 38.0 36.0 38.0 22.2 38.0 140-144 33.537 38.0 35.0 38.0 17.0 38.0 145-149 32.8385 38.0 35.0 38.0 11.2 38.0 150-151 29.558999999999997 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 9.0 4 4.0 5 2.0 6 6.0 7 2.0 8 4.0 9 1.0 10 2.0 11 4.0 12 12.0 13 10.0 14 6.0 15 5.0 16 6.0 17 7.0 18 4.0 19 9.0 20 12.0 21 9.0 22 7.0 23 11.0 24 21.0 25 24.0 26 16.0 27 25.0 28 35.0 29 44.0 30 43.0 31 52.0 32 62.0 33 77.0 34 110.0 35 177.0 36 448.0 37 2715.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.006024096385545 21.78714859437751 15.863453815261044 23.343373493975903 2 27.988994497248626 27.863931965982992 26.138069034517258 18.009004502251123 3 21.11055527763882 29.214607303651825 29.139569784892444 20.535267633816908 4 24.75 32.75 24.05 18.45 5 25.674999999999997 33.650000000000006 22.625 18.05 6 21.325 35.975 23.9 18.8 7 22.400000000000002 22.35 35.9 19.35 8 22.85 26.150000000000002 26.174999999999997 24.825 9 23.05 26.924999999999997 28.499999999999996 21.525 10-14 24.355 28.21 25.669999999999998 21.765 15-19 23.715 28.585 26.665 21.035 20-24 24.485 27.544999999999998 26.650000000000002 21.32 25-29 23.735 28.23 27.055 20.979999999999997 30-34 24.005000000000003 27.725 27.474999999999998 20.794999999999998 35-39 24.26 27.884999999999998 26.91 20.945 40-44 23.84 27.875 27.6 20.685000000000002 45-49 23.974999999999998 27.744999999999997 27.32 20.96 50-54 23.60310699072914 27.93786018541719 27.61713856176397 20.841894262089703 55-59 24.6411723376493 27.762722071665163 26.83428686138713 20.761818729298405 60-64 23.48538129207274 27.85089922636391 27.333467296292575 21.330252185270773 65-69 24.55449543136958 27.04831137361805 27.623807360290776 20.77338583472159 70-74 24.25314664105545 27.584289541525553 27.842086640044485 20.320477177374514 75-79 24.138279591630447 27.853027393106238 27.423430708581826 20.585262306681493 80-84 24.175161954502084 27.79591221814895 27.40420830613167 20.624717521217296 85-89 24.210948868483115 27.23167243715189 27.582919363741283 20.974459330623716 90-94 24.6411723376493 27.26588376994881 27.85305630834086 20.239887584061027 95-99 24.51447784413108 27.420083304059816 27.46022983891203 20.605209012897074 100-104 24.366373902133 27.97992471769134 27.498117942283564 20.155583437892098 105-109 24.61607949412827 27.546923617384323 27.53688647997591 20.300110408511493 110-114 24.651209475057716 27.19562380808993 28.073873331325906 20.079293385526448 115-119 24.547051442910917 27.548306148055207 28.19573400250941 19.70890840652447 120-124 23.89460476787955 27.728983688833125 27.613550815558348 20.762860727728985 125-129 24.5069008782936 27.80426599749059 27.7038895859473 19.984943538268507 130-134 24.62109806283248 26.733915487303022 28.385024590986653 20.259961858877848 135-139 23.754731264193794 27.03507443855665 29.104213979308604 20.105980317940954 140-144 23.938321536905967 26.926188068756318 28.89787664307381 20.237613751263904 145-149 24.60695810934172 27.325286540217057 27.964296581803428 20.103458768637793 150-151 24.2532096097623 27.291216473878226 28.524215075632387 19.931358840727086 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 2.5 23 3.0 24 2.5 25 2.5 26 3.0 27 5.0 28 3.5 29 4.5 30 8.5 31 14.0 32 17.0 33 29.0 34 38.0 35 44.5 36 65.0 37 73.5 38 91.5 39 148.0 40 185.0 41 201.5 42 227.0 43 258.0 44 295.0 45 308.5 46 301.5 47 283.5 48 243.0 49 215.0 50 186.5 51 146.0 52 128.0 53 118.5 54 95.0 55 59.0 56 45.5 57 37.0 58 23.0 59 19.5 60 16.0 61 12.0 62 11.0 63 7.0 64 4.5 65 3.5 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.05 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.22499999999999998 55-59 0.37 60-64 0.47000000000000003 65-69 0.955 70-74 1.085 75-79 1.0699999999999998 80-84 0.43499999999999994 85-89 0.35500000000000004 90-94 0.37 95-99 0.365 100-104 0.375 105-109 0.37 110-114 0.37 115-119 0.375 120-124 0.375 125-129 0.375 130-134 0.37 135-139 0.9249999999999999 140-144 1.0999999999999999 145-149 1.41 150-151 1.6625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.2 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662288 spots for SRR7169071.sra Written 662288 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra Read 662284 spots for SRR7169071.sra Written 662284 spots for SRR7169071.sra SRR ids: ['SRR7169071.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6zvi372b SRR7169071.sra spots: 13245684 blocks: [[1, 662284], [662285, 1324568], [1324569, 1986852], [1986853, 2649136], [2649137, 3311420], [3311421, 3973704], [3973705, 4635988], [4635989, 5298272], [5298273, 5960556], [5960557, 6622840], [6622841, 7285124], [7285125, 7947408], [7947409, 8609692], [8609693, 9271976], [9271977, 9934260], [9934261, 10596544], [10596545, 11258828], [11258829, 11921112], [11921113, 12583396], [12583397, 13245684]] SRR7169071 file size 4466827 SRR7169071 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169071 SRR7169071_1.fastq SRR7169071_2.fastq Input file: SRR7169071_1.fastq Paired file: SRR7169071_2.fastq trimmed: SRR7169071-trimmed-pair1.fastq, SRR7169071-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:20:55 2025 >> started Mon Feb 10 19:21:09 2025 >> done (14.208s) 13245684 read pairs processed; of these: 38146 ( 0.29%) short read pairs filtered out after trimming by size control 25756 ( 0.19%) empty read pairs filtered out after trimming by size control 13181782 (99.52%) read pairs available; of these: 6915743 (52.46%) trimmed read pairs available after processing 6266039 (47.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 4 0.00% 21 1 0.00% 22 10 0.00% 23 10 0.00% 24 10 0.00% 25 9 0.00% 26 13 0.00% 27 12 0.00% 28 12 0.00% 29 5 0.00% 30 12 0.00% 31 7 0.00% 32 11 0.00% 33 9 0.00% 34 15 0.00% 35 11 0.00% 36 22 0.00% 37 21 0.00% 38 16 0.00% 39 21 0.00% 40 14 0.00% 41 23 0.00% 42 24 0.00% 43 29 0.00% 44 40 0.00% 45 29 0.00% 46 40 0.00% 47 49 0.00% 48 44 0.00% 49 51 0.00% 50 61 0.00% 51 60 0.00% 52 62 0.00% 53 81 0.00% 54 77 0.00% 55 81 0.00% 56 80 0.00% 57 116 0.00% 58 120 0.00% 59 129 0.00% 60 129 0.00% 61 158 0.00% 62 160 0.00% 63 198 0.00% 64 205 0.00% 65 218 0.00% 66 240 0.00% 67 272 0.00% 68 309 0.00% 69 375 0.00% 70 432 0.00% 71 437 0.00% 72 530 0.00% 73 590 0.00% 74 701 0.01% 75 815 0.01% 76 743 0.01% 77 577 0.00% 78 773 0.01% 79 1169 0.01% 80 1557 0.01% 81 974 0.01% 82 1131 0.01% 83 1397 0.01% 84 2774 0.02% 85 3797 0.03% 86 3950 0.03% 87 3787 0.03% 88 3821 0.03% 89 3863 0.03% 90 3892 0.03% 91 4109 0.03% 92 4293 0.03% 93 4545 0.03% 94 4817 0.04% 95 4945 0.04% 96 5568 0.04% 97 6148 0.05% 98 6962 0.05% 99 8622 0.07% 100 9571 0.07% 101 7057 0.05% 102 7049 0.05% 103 7546 0.06% 104 8002 0.06% 105 8529 0.06% 106 9213 0.07% 107 9892 0.08% 108 10026 0.08% 109 10498 0.08% 110 11224 0.09% 111 11663 0.09% 112 12089 0.09% 113 13089 0.10% 114 13839 0.10% 115 14510 0.11% 116 15118 0.11% 117 16080 0.12% 118 17105 0.13% 119 17665 0.13% 120 18331 0.14% 121 19523 0.15% 122 20758 0.16% 123 22282 0.17% 124 23656 0.18% 125 25070 0.19% 126 26552 0.20% 127 27981 0.21% 128 29820 0.23% 129 31754 0.24% 130 34273 0.26% 131 36022 0.27% 132 38611 0.29% 133 41221 0.31% 134 44210 0.34% 135 48444 0.37% 136 52479 0.40% 137 57442 0.44% 138 63560 0.48% 139 70696 0.54% 140 77526 0.59% 141 86529 0.66% 142 98432 0.75% 143 114708 0.87% 144 137831 1.05% 145 170159 1.29% 146 214526 1.63% 147 297137 2.25% 148 464488 3.52% 149 868902 6.59% 150 3331619 25.27% 151 6266039 47.54% 13181782 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=8.92 fanout-score-rank=20 prefix-density=0.26 prefix-fanout=5.7 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=388.25 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=21.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=28 prefix-density=0.51 prefix-fanout=3.0 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.12 sequence-density-rank=9 fanout-score=250.78 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=25.9 sequence=AAGAAGAAGAAG SRR7169071 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:21:57 Started mapping on | Feb 10 19:21:58 Finished on | Feb 10 19:23:33 Mapping speed, Million of reads per hour | 499.52 Number of input reads | 13181782 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12084986 Uniquely mapped reads % | 91.68% Average mapped length | 294.85 Number of splices: Total | 10222784 Number of splices: Annotated (sjdb) | 10032412 Number of splices: GT/AG | 10060644 Number of splices: GC/AG | 121574 Number of splices: AT/AC | 9224 Number of splices: Non-canonical | 31342 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.03% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269316 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 39326 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.90% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 858797 858797 858797 N_multimapping 269316 269316 269316 N_noFeature 255874 11934323 318891 N_ambiguous 140026 910 51792 UnstrandedReadsAssigned:11689086 PositiveStrandReadsAssigned:149753 NegativeStrandReadsAssigned:11714303 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169071 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169071-trimmed-pair1.fastq SRR7169071-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,181,782 reads, 11,738,884 reads pseudoaligned [quant] estimated average fragment length: 255.348 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR7169071.ke.tsv 34699 SRR7169071.se.tsv 87100 total ==> SRR7169071.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.65 212 7.47806 Potri.005G024800.1.v4.1 1035 780.652 63 5.02052 Potri.004G059700.1.v4.1 961 706.652 2 0.176072 Potri.007G009000.2.v4.1 1416 1161.65 0 0 Potri.003G141000.2.v4.1 2943 2688.65 190 4.39628 Potri.016G087400.1.v4.1 270 63.7417 1376.74 1343.68 Potri.015G069301.1.v4.1 564 312.476 0 0 Potri.010G195200.1.v4.1 1773 1518.65 33 1.35183 Potri.012G127500.1.v4.1 977 722.652 6665 573.769 ==> SRR7169071.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 933 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169071 completed mapping pipeline successfully