Starting /dee2/code/volunteer_pipeline.sh SRR7169072 current disk space = 3057360945152 free memory = 1018843164 SRR7169072 SRAfilesize d95a6347be8c4b1c826f9c05c8073d2c SRR7169072.sra SRR7169072.sra file validated SRR7169072 is paired end SRR7169072 is conventional basespace SRR7169072 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169072_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9075 34.0 33.0 34.0 33.0 34.0 2 33.3475 34.0 34.0 34.0 33.0 34.0 3 33.377 34.0 34.0 34.0 33.0 34.0 4 33.46175 34.0 34.0 34.0 33.0 34.0 5 33.45075 34.0 34.0 34.0 33.0 34.0 6 36.957 38.0 37.0 38.0 36.0 38.0 7 37.33625 38.0 38.0 38.0 37.0 38.0 8 37.51325 38.0 38.0 38.0 37.0 38.0 9 37.4665 38.0 38.0 38.0 37.0 38.0 10-14 37.52915 38.0 38.0 38.0 38.0 38.0 15-19 37.437850000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.478 38.0 38.0 38.0 37.2 38.0 25-29 37.41234999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.34935 38.0 38.0 38.0 37.0 38.0 35-39 37.2306 38.0 38.0 38.0 36.6 38.0 40-44 37.03205 38.0 38.0 38.0 35.8 38.0 45-49 36.84285 38.0 38.0 38.0 35.0 38.0 50-54 36.77935 38.0 38.0 38.0 34.8 38.0 55-59 36.6794 38.0 38.0 38.0 34.4 38.0 60-64 36.558949999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.47410000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.3975 38.0 37.6 38.0 34.0 38.0 75-79 36.3487 38.0 37.2 38.0 33.6 38.0 80-84 36.17005 38.0 37.0 38.0 33.0 38.0 85-89 36.01615 38.0 37.0 38.0 32.4 38.0 90-94 35.85485 38.0 37.0 38.0 31.2 38.0 95-99 35.75065 38.0 36.8 38.0 30.8 38.0 100-104 35.5728 38.0 36.0 38.0 30.4 38.0 105-109 35.37734999999999 38.0 36.0 38.0 29.0 38.0 110-114 35.035799999999995 38.0 35.2 38.0 28.2 38.0 115-119 34.7767 38.0 35.0 38.0 27.2 38.0 120-124 34.37885 38.0 34.8 38.0 24.4 38.0 125-129 34.1591 38.0 34.2 38.0 23.4 38.0 130-134 33.7014 38.0 34.0 38.0 21.0 38.0 135-139 33.109249999999996 37.8 33.6 38.0 16.2 38.0 140-144 32.75185 37.8 33.2 38.0 14.6 38.0 145-149 31.9655 37.0 33.0 38.0 11.4 38.0 150-151 27.796 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 3.0 18 6.0 19 4.0 20 15.0 21 6.0 22 14.0 23 11.0 24 22.0 25 24.0 26 26.0 27 26.0 28 36.0 29 53.0 30 64.0 31 64.0 32 105.0 33 147.0 34 215.0 35 426.0 36 958.0 37 1769.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.40772750381291 12.913065582104727 9.15099135739705 33.52821555668531 2 24.825 12.825000000000001 31.4 30.95 3 19.5 17.825 26.200000000000003 36.475 4 23.0 24.6 24.275 28.125 5 23.9 29.425 23.9 22.775000000000002 6 21.75 32.574999999999996 24.85 20.825 7 15.525 28.275 39.074999999999996 17.125 8 18.3 26.724999999999998 30.8 24.175 9 17.525 26.400000000000002 32.4 23.674999999999997 10-14 20.080000000000002 29.445 27.145000000000003 23.330000000000002 15-19 19.900000000000002 28.999999999999996 27.474999999999998 23.625 20-24 20.235 28.58 27.474999999999998 23.71 25-29 20.275000000000002 28.93 27.355 23.44 30-34 20.055 28.999999999999996 27.36 23.585 35-39 20.24 28.744999999999997 27.224999999999998 23.79 40-44 20.150000000000002 29.085 26.765 24.0 45-49 20.39 28.925 27.485 23.200000000000003 50-54 20.905 27.87 27.395000000000003 23.830000000000002 55-59 20.915 28.384999999999998 27.055 23.645 60-64 20.580000000000002 28.299999999999997 27.11 24.01 65-69 20.330000000000002 28.105000000000004 27.439999999999998 24.125 70-74 20.5 27.915 27.76 23.825 75-79 20.435 27.985 27.62 23.96 80-84 20.26 28.62 26.865 24.255 85-89 20.23 28.754999999999995 27.384999999999998 23.630000000000003 90-94 20.87 28.595 26.705000000000002 23.830000000000002 95-99 20.369999999999997 27.79 27.605 24.235 100-104 20.75 28.16 27.375 23.715 105-109 20.695 28.105000000000004 27.029999999999998 24.169999999999998 110-114 21.099999999999998 28.18 27.61 23.11 115-119 20.44 28.060000000000002 27.51 23.990000000000002 120-124 20.305 28.360000000000003 27.18 24.154999999999998 125-129 21.32 27.55 27.445000000000004 23.685000000000002 130-134 21.025 27.755000000000003 27.495000000000005 23.724999999999998 135-139 20.74 28.225 27.485 23.549999999999997 140-144 21.485000000000003 27.76 26.955000000000002 23.799999999999997 145-149 21.709999999999997 27.525 26.96 23.805 150-151 21.05 28.000000000000004 26.674999999999997 24.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 1.0 20 0.0 21 1.0 22 2.0 23 2.5 24 2.0 25 2.5 26 3.5 27 9.0 28 13.0 29 10.0 30 13.5 31 25.5 32 31.5 33 32.5 34 47.0 35 64.5 36 77.5 37 94.0 38 118.5 39 140.0 40 156.5 41 191.5 42 229.0 43 257.0 44 280.0 45 286.0 46 271.5 47 256.5 48 243.0 49 206.5 50 174.0 51 167.5 52 139.5 53 109.5 54 87.5 55 58.0 56 41.5 57 33.0 58 32.5 59 24.0 60 10.0 61 6.5 62 10.5 63 10.0 64 6.5 65 4.5 66 2.5 67 3.5 68 4.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5875 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.8999999999999999 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.3875000000000002 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138-139 1.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAGG 10 0.006830828 145.0 145 >>END_MODULE SRR7169072 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169072_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7525 33.0 33.0 34.0 32.0 34.0 2 32.77975 33.0 33.0 34.0 32.0 34.0 3 32.901 34.0 33.0 34.0 32.0 34.0 4 32.7065 34.0 33.0 34.0 32.0 34.0 5 32.73725 34.0 33.0 34.0 32.0 34.0 6 36.945 38.0 38.0 38.0 36.0 38.0 7 36.89625 38.0 38.0 38.0 36.0 38.0 8 36.79725 38.0 38.0 38.0 36.0 38.0 9 36.89125 38.0 38.0 38.0 36.0 38.0 10-14 36.9542 38.0 38.0 38.0 36.6 38.0 15-19 36.91799999999999 38.0 38.0 38.0 36.6 38.0 20-24 36.8241 38.0 38.0 38.0 36.4 38.0 25-29 36.884499999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.9067 38.0 38.0 38.0 36.4 38.0 35-39 36.8552 38.0 38.0 38.0 36.2 38.0 40-44 36.726 38.0 38.0 38.0 36.0 38.0 45-49 36.7758 38.0 38.0 38.0 36.0 38.0 50-54 36.827600000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.717150000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.7087 38.0 38.0 38.0 36.0 38.0 65-69 36.580400000000004 38.0 38.0 38.0 35.2 38.0 70-74 36.4589 38.0 38.0 38.0 35.0 38.0 75-79 36.394450000000006 38.0 38.0 38.0 34.8 38.0 80-84 36.499900000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.4169 38.0 38.0 38.0 34.8 38.0 90-94 36.32395 38.0 38.0 38.0 34.2 38.0 95-99 36.0668 38.0 38.0 38.0 33.6 38.0 100-104 35.9713 38.0 38.0 38.0 33.4 38.0 105-109 35.80745 38.0 38.0 38.0 32.6 38.0 110-114 35.65105 38.0 38.0 38.0 31.8 38.0 115-119 35.5506 38.0 37.0 38.0 31.0 38.0 120-124 35.34545 38.0 37.0 38.0 31.0 38.0 125-129 35.29385 38.0 36.8 38.0 30.4 38.0 130-134 34.945350000000005 38.0 36.0 38.0 28.6 38.0 135-139 34.666000000000004 38.0 36.0 38.0 27.6 38.0 140-144 34.15935 38.0 35.2 38.0 24.6 38.0 145-149 33.431650000000005 38.0 35.0 38.0 17.2 38.0 150-151 29.893250000000002 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 4.0 5 2.0 6 1.0 7 4.0 8 2.0 9 0.0 10 2.0 11 1.0 12 3.0 13 3.0 14 5.0 15 8.0 16 4.0 17 5.0 18 7.0 19 5.0 20 7.0 21 9.0 22 17.0 23 15.0 24 15.0 25 25.0 26 14.0 27 32.0 28 31.0 29 39.0 30 44.0 31 58.0 32 74.0 33 94.0 34 120.0 35 203.0 36 417.0 37 2717.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 23.75 12.6 25.7 2 28.299999999999997 26.575 27.525 17.599999999999998 3 20.349999999999998 28.875 31.25 19.525000000000002 4 23.05 33.324999999999996 23.849999999999998 19.775000000000002 5 24.95 35.125 22.125 17.8 6 21.8 36.325 22.400000000000002 19.475 7 21.275 23.65 35.925000000000004 19.15 8 22.375 25.775 26.075 25.775 9 21.125 25.674999999999997 28.549999999999997 24.65 10-14 23.505000000000003 29.2 25.765 21.529999999999998 15-19 23.52 27.49 27.235 21.755 20-24 23.89 27.96 26.840000000000003 21.310000000000002 25-29 23.315 28.24 27.12 21.325 30-34 23.305 28.53 26.865 21.3 35-39 23.810000000000002 27.985 26.865 21.34 40-44 23.925 28.189999999999998 26.685 21.2 45-49 23.195 27.565 28.1 21.14 50-54 23.474999999999998 27.99 27.439999999999998 21.095 55-59 24.085 27.96 27.139999999999997 20.815 60-64 23.810000000000002 27.985 27.66 20.544999999999998 65-69 23.380140421263793 28.39518555667001 27.111334002006014 21.113340020060182 70-74 24.106605099377635 27.35394499096567 27.333868701064045 21.20558120859265 75-79 23.771067415730336 27.49297752808989 27.81400481540931 20.921950240770464 80-84 23.876193809690484 27.30636531826591 27.85139256962848 20.96604830241512 85-89 23.785 27.939999999999998 26.895000000000003 21.38 90-94 23.885 27.805000000000003 27.87 20.44 95-99 23.97 27.939999999999998 27.195000000000004 20.895 100-104 23.82 28.07 27.57 20.54 105-109 23.990000000000002 27.165 27.865000000000002 20.979999999999997 110-114 24.099999999999998 27.195000000000004 27.52 21.185000000000002 115-119 24.66 27.54 27.700000000000003 20.1 120-124 24.18 28.000000000000004 27.405 20.415 125-129 23.965 28.185 27.05 20.8 130-134 24.38 27.92 27.49 20.21 135-139 24.026006501625407 28.072018004501125 27.636909227306827 20.26506626656664 140-144 24.443109576012414 27.66681683936527 27.311408119337237 20.578665465285077 145-149 24.743615523828673 27.29237884576714 27.30746028554193 20.656545344862256 150-151 24.428733745739176 26.97891680343391 27.93839161722005 20.653957833606867 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 3.5 27 4.5 28 6.0 29 7.0 30 6.0 31 11.5 32 17.0 33 27.0 34 39.0 35 43.5 36 58.0 37 74.5 38 105.0 39 143.5 40 186.5 41 233.0 42 264.5 43 274.0 44 277.0 45 300.0 46 299.0 47 271.0 48 242.0 49 208.0 50 177.5 51 151.0 52 121.0 53 113.0 54 97.5 55 65.0 56 47.0 57 31.5 58 22.0 59 19.5 60 13.5 61 7.0 62 7.0 63 6.5 64 5.0 65 3.0 66 2.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.3 70-74 0.38 75-79 0.32 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.025 140-144 0.11499999999999999 145-149 0.54 150-151 0.9875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138-139 1.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923931 spots for SRR7169072.sra Written 923931 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra Read 923916 spots for SRR7169072.sra Written 923916 spots for SRR7169072.sra SRR ids: ['SRR7169072.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ai459s7 SRR7169072.sra spots: 18478335 blocks: [[1, 923916], [923917, 1847832], [1847833, 2771748], [2771749, 3695664], [3695665, 4619580], [4619581, 5543496], [5543497, 6467412], [6467413, 7391328], [7391329, 8315244], [8315245, 9239160], [9239161, 10163076], [10163077, 11086992], [11086993, 12010908], [12010909, 12934824], [12934825, 13858740], [13858741, 14782656], [14782657, 15706572], [15706573, 16630488], [16630489, 17554404], [17554405, 18478335]] SRR7169072 file size 6240001 SRR7169072 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169072 SRR7169072_1.fastq SRR7169072_2.fastq Input file: SRR7169072_1.fastq Paired file: SRR7169072_2.fastq trimmed: SRR7169072-trimmed-pair1.fastq, SRR7169072-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:47:53 2025 >> started Mon Feb 10 18:48:13 2025 >> done (20.013s) 18478335 read pairs processed; of these: 24482 ( 0.13%) short read pairs filtered out after trimming by size control 20704 ( 0.11%) empty read pairs filtered out after trimming by size control 18433149 (99.76%) read pairs available; of these: 8569812 (46.49%) trimmed read pairs available after processing 9863337 (53.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 4 0.00% 21 1 0.00% 22 11 0.00% 23 13 0.00% 24 6 0.00% 25 11 0.00% 26 7 0.00% 27 14 0.00% 28 14 0.00% 29 9 0.00% 30 13 0.00% 31 10 0.00% 32 13 0.00% 33 10 0.00% 34 11 0.00% 35 13 0.00% 36 16 0.00% 37 15 0.00% 38 22 0.00% 39 24 0.00% 40 26 0.00% 41 22 0.00% 42 24 0.00% 43 37 0.00% 44 28 0.00% 45 40 0.00% 46 37 0.00% 47 46 0.00% 48 34 0.00% 49 50 0.00% 50 55 0.00% 51 55 0.00% 52 48 0.00% 53 53 0.00% 54 82 0.00% 55 76 0.00% 56 76 0.00% 57 109 0.00% 58 94 0.00% 59 125 0.00% 60 129 0.00% 61 146 0.00% 62 155 0.00% 63 169 0.00% 64 181 0.00% 65 182 0.00% 66 211 0.00% 67 240 0.00% 68 276 0.00% 69 272 0.00% 70 317 0.00% 71 347 0.00% 72 420 0.00% 73 443 0.00% 74 488 0.00% 75 469 0.00% 76 592 0.00% 77 644 0.00% 78 740 0.00% 79 810 0.00% 80 876 0.00% 81 951 0.01% 82 1183 0.01% 83 1393 0.01% 84 2536 0.01% 85 3193 0.02% 86 3415 0.02% 87 3563 0.02% 88 3752 0.02% 89 3820 0.02% 90 3722 0.02% 91 3932 0.02% 92 4028 0.02% 93 4437 0.02% 94 4844 0.03% 95 5025 0.03% 96 5429 0.03% 97 5732 0.03% 98 6071 0.03% 99 6327 0.03% 100 6865 0.04% 101 7284 0.04% 102 7760 0.04% 103 8134 0.04% 104 8881 0.05% 105 9438 0.05% 106 9967 0.05% 107 10651 0.06% 108 11294 0.06% 109 11873 0.06% 110 12510 0.07% 111 13242 0.07% 112 14093 0.08% 113 15212 0.08% 114 15969 0.09% 115 17398 0.09% 116 18235 0.10% 117 19544 0.11% 118 20339 0.11% 119 20910 0.11% 120 22300 0.12% 121 23708 0.13% 122 24831 0.13% 123 26814 0.15% 124 28394 0.15% 125 29975 0.16% 126 32053 0.17% 127 34420 0.19% 128 36753 0.20% 129 38810 0.21% 130 41228 0.22% 131 44531 0.24% 132 48082 0.26% 133 51632 0.28% 134 54987 0.30% 135 59424 0.32% 136 64450 0.35% 137 71352 0.39% 138 77952 0.42% 139 86516 0.47% 140 95323 0.52% 141 104407 0.57% 142 117096 0.64% 143 132898 0.72% 144 156185 0.85% 145 188716 1.02% 146 241796 1.31% 147 329583 1.79% 148 515386 2.80% 149 1013135 5.50% 150 4434651 24.06% 151 9863337 53.51% 18433149 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=15.19 fanout-score-rank=20 prefix-density=0.35 prefix-fanout=7.1 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=333.08 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=20.9 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=38 prefix-density=0.17 prefix-fanout=2.3 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=214.01 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=24.1 sequence=GAAGAAGAAGAAA SRR7169072 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:49:15 Started mapping on | Feb 10 18:49:15 Finished on | Feb 10 18:51:51 Mapping speed, Million of reads per hour | 425.38 Number of input reads | 18433149 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17094192 Uniquely mapped reads % | 92.74% Average mapped length | 296.17 Number of splices: Total | 16070664 Number of splices: Annotated (sjdb) | 15817077 Number of splices: GT/AG | 15840624 Number of splices: GC/AG | 183342 Number of splices: AT/AC | 14586 Number of splices: Non-canonical | 32112 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341382 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 24657 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.24% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1020597 1020597 1020597 N_multimapping 341382 341382 341382 N_noFeature 306285 16891300 391148 N_ambiguous 183364 902 64714 UnstrandedReadsAssigned:16604543 PositiveStrandReadsAssigned:201990 NegativeStrandReadsAssigned:16638330 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169072 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169072-trimmed-pair1.fastq SRR7169072-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,433,149 reads, 16,557,454 reads pseudoaligned [quant] estimated average fragment length: 261.701 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52401 SRR7169072.ke.tsv 34699 SRR7169072.se.tsv 87100 total ==> SRR7169072.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.3 339 10.3297 Potri.005G024800.1.v4.1 1035 774.299 20 1.3831 Potri.004G059700.1.v4.1 961 700.31 3 0.229384 Potri.007G009000.2.v4.1 1416 1155.3 0 0 Potri.003G141000.2.v4.1 2943 2682.3 310 6.18853 Potri.016G087400.1.v4.1 270 64.5188 1727 1433.3 Potri.015G069301.1.v4.1 564 307.519 0 0 Potri.010G195200.1.v4.1 1773 1512.3 59 2.08904 Potri.012G127500.1.v4.1 977 716.299 4957 370.559 ==> SRR7169072.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1735 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169072 completed mapping pipeline successfully