Starting /dee2/code/volunteer_pipeline.sh SRR7169073 current disk space = 3057238507520 free memory = 1388154464 SRR7169073 SRAfilesize 71467c882174a5f1f2fce6e3766b4252 SRR7169073.sra SRR7169073.sra file validated SRR7169073 is paired end SRR7169073 is conventional basespace SRR7169073 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169073_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.90975 34.0 33.0 34.0 32.0 34.0 2 33.197 34.0 33.0 34.0 32.0 34.0 3 33.309 34.0 33.0 34.0 32.0 34.0 4 33.439 34.0 33.0 34.0 33.0 34.0 5 33.37475 34.0 33.0 34.0 33.0 34.0 6 37.17425 38.0 38.0 38.0 36.0 38.0 7 35.699 38.0 37.0 38.0 30.0 38.0 8 36.34825 38.0 37.0 38.0 33.0 38.0 9 37.2355 38.0 38.0 38.0 36.0 38.0 10-14 37.38455 38.0 38.0 38.0 37.0 38.0 15-19 37.143150000000006 38.0 38.0 38.0 36.4 38.0 20-24 37.4371 38.0 38.0 38.0 37.0 38.0 25-29 37.31535 38.0 38.0 38.0 37.0 38.0 30-34 37.2963 38.0 38.0 38.0 36.8 38.0 35-39 37.37155 38.0 38.0 38.0 37.0 38.0 40-44 36.855050000000006 38.0 38.0 38.0 35.2 38.0 45-49 36.748000000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.46555 38.0 37.4 38.0 33.8 38.0 55-59 36.351 38.0 37.6 38.0 33.6 38.0 60-64 36.46045 38.0 37.8 38.0 33.6 38.0 65-69 36.38375 38.0 37.2 38.0 33.6 38.0 70-74 36.19295 38.0 37.2 38.0 33.2 38.0 75-79 36.4388 38.0 37.6 38.0 34.0 38.0 80-84 36.24425 38.0 37.4 38.0 33.4 38.0 85-89 35.946549999999995 38.0 37.0 38.0 32.2 38.0 90-94 35.83154999999999 38.0 36.8 38.0 31.4 38.0 95-99 35.6895 38.0 36.8 38.0 30.6 38.0 100-104 35.1579 38.0 35.8 38.0 28.6 38.0 105-109 34.5894 38.0 35.0 38.0 24.4 38.0 110-114 34.7658 38.0 35.2 38.0 26.4 38.0 115-119 34.6864 38.0 35.0 38.0 26.8 38.0 120-124 34.277550000000005 38.0 34.8 38.0 24.0 38.0 125-129 33.820949999999996 38.0 34.0 38.0 22.6 38.0 130-134 33.692299999999996 38.0 33.6 38.0 22.2 38.0 135-139 33.1702 38.0 32.4 38.0 18.2 38.0 140-144 31.98875 36.8 31.4 38.0 13.6 38.0 145-149 30.52675 36.0 30.4 38.0 8.6 38.0 150-151 25.783250000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 2.0 8 1.0 9 0.0 10 2.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 1.0 17 6.0 18 7.0 19 7.0 20 5.0 21 8.0 22 9.0 23 18.0 24 18.0 25 31.0 26 20.0 27 40.0 28 39.0 29 60.0 30 74.0 31 79.0 32 137.0 33 180.0 34 277.0 35 426.0 36 997.0 37 1551.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.905937992643196 14.63478717813978 9.143457698370995 33.31581713084603 2 22.400000000000002 16.175 33.95 27.474999999999998 3 19.525000000000002 21.825 27.150000000000002 31.5 4 21.925 29.599999999999998 24.725 23.75 5 22.400000000000002 33.675 24.325 19.6 6 19.675 36.825 24.75 18.75 7 14.075 26.875 41.375 17.675 8 18.4 25.674999999999997 30.55 25.374999999999996 9 17.125 24.625 33.650000000000006 24.6 10-14 19.455 30.320000000000004 27.145000000000003 23.080000000000002 15-19 19.33 29.21 27.67 23.79 20-24 19.395969798489922 28.68143407170359 27.891394569728483 24.031201560078003 25-29 19.61 29.654999999999998 26.950000000000003 23.785 30-34 19.220961048052402 30.021501075053752 26.72633631681584 24.031201560078003 35-39 19.480974048702436 29.636481824091206 26.916345817290864 23.966198309915494 40-44 19.457918687803172 29.899484922738413 26.568985347802172 24.07361104165625 45-49 19.875 28.58 27.57 23.974999999999998 50-54 19.900000000000002 29.525000000000002 27.465 23.11 55-59 19.515 29.38 27.450000000000003 23.655 60-64 20.23 28.895 27.155 23.72 65-69 19.84 29.475 27.084999999999997 23.599999999999998 70-74 19.305965298264912 29.36646832341617 27.621381069053452 23.70618530926546 75-79 19.919999999999998 29.565 26.974999999999998 23.54 80-84 19.759999999999998 29.054999999999996 27.345000000000002 23.84 85-89 20.116005800290015 28.451422571128553 27.586379318965946 23.84619230961548 90-94 20.196009800490025 28.666433321666084 27.38136906845342 23.756187809390468 95-99 19.63 28.405 28.09 23.875 100-104 20.31 28.255000000000003 27.965 23.47 105-109 20.544999999999998 28.725 26.974999999999998 23.755000000000003 110-114 20.200000000000003 28.74 27.544999999999998 23.515 115-119 20.28 28.685 27.67 23.365 120-124 20.075000000000003 29.020000000000003 27.375 23.53 125-129 19.945 28.985 26.939999999999998 24.13 130-134 20.369999999999997 28.34 27.41 23.880000000000003 135-139 20.15201520152015 28.05780578057806 28.20782078207821 23.582358235823584 140-144 20.64 27.905 27.72 23.735 145-149 21.166058302915143 28.111405570278514 27.27636381819091 23.44617230861543 150-151 20.3125 28.825 26.937499999999996 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 2.0 24 3.5 25 2.0 26 5.5 27 11.0 28 12.5 29 15.5 30 24.0 31 38.0 32 43.5 33 51.5 34 61.0 35 73.0 36 94.0 37 120.0 38 135.5 39 152.5 40 203.5 41 223.0 42 219.5 43 244.0 44 266.0 45 277.5 46 268.5 47 244.0 48 231.5 49 198.5 50 169.5 51 152.5 52 114.5 53 83.0 54 73.0 55 59.5 56 36.0 57 25.0 58 14.0 59 8.5 60 9.5 61 7.0 62 5.0 63 4.0 64 3.0 65 2.0 66 1.0 67 1.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8500000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.75 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169073 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169073_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04825 34.0 33.0 34.0 32.0 34.0 2 33.10075 34.0 33.0 34.0 32.0 34.0 3 33.08075 34.0 33.0 34.0 32.0 34.0 4 33.0215 34.0 33.0 34.0 32.0 34.0 5 33.07275 34.0 33.0 34.0 33.0 34.0 6 37.199 38.0 38.0 38.0 37.0 38.0 7 37.153 38.0 38.0 38.0 37.0 38.0 8 36.66975 38.0 38.0 38.0 35.0 38.0 9 37.1005 38.0 38.0 38.0 37.0 38.0 10-14 37.1346 38.0 38.0 38.0 37.0 38.0 15-19 37.1542 38.0 38.0 38.0 37.0 38.0 20-24 37.08725 38.0 38.0 38.0 37.0 38.0 25-29 37.1378 38.0 38.0 38.0 37.0 38.0 30-34 37.11595 38.0 38.0 38.0 36.8 38.0 35-39 36.817949999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.888799999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.976800000000004 38.0 38.0 38.0 36.2 38.0 50-54 36.9405 38.0 38.0 38.0 36.0 38.0 55-59 36.87555 38.0 38.0 38.0 35.8 38.0 60-64 36.8746 38.0 38.0 38.0 36.0 38.0 65-69 36.78165 38.0 38.0 38.0 35.8 38.0 70-74 36.7118 38.0 38.0 38.0 35.2 38.0 75-79 36.560649999999995 38.0 38.0 38.0 34.4 38.0 80-84 36.40575 38.0 38.0 38.0 34.0 38.0 85-89 36.154 38.0 38.0 38.0 33.4 38.0 90-94 36.202349999999996 38.0 38.0 38.0 33.6 38.0 95-99 36.2742 38.0 38.0 38.0 33.8 38.0 100-104 36.198800000000006 38.0 38.0 38.0 34.0 38.0 105-109 35.90955 38.0 37.2 38.0 33.0 38.0 110-114 35.5425 38.0 36.8 38.0 30.6 38.0 115-119 35.423500000000004 38.0 36.6 38.0 29.8 38.0 120-124 35.486149999999995 38.0 36.6 38.0 30.6 38.0 125-129 34.94535 38.0 35.6 38.0 27.8 38.0 130-134 34.4991 38.0 35.0 38.0 24.6 38.0 135-139 34.142700000000005 38.0 35.0 38.0 23.2 38.0 140-144 33.86465 38.0 34.2 38.0 23.0 38.0 145-149 32.783849999999994 38.0 33.2 38.0 14.8 38.0 150-151 28.643500000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 3.0 5 2.0 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 3.0 13 0.0 14 2.0 15 6.0 16 1.0 17 7.0 18 3.0 19 5.0 20 4.0 21 8.0 22 6.0 23 16.0 24 20.0 25 18.0 26 22.0 27 23.0 28 31.0 29 35.0 30 58.0 31 64.0 32 86.0 33 139.0 34 151.0 35 281.0 36 575.0 37 2420.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.7 23.525 12.5 24.275 2 27.375 27.675 29.975 14.975 3 21.425 28.075 31.15 19.35 4 23.175 33.1 24.25 19.475 5 24.45 35.8 22.2 17.549999999999997 6 20.974999999999998 38.550000000000004 22.85 17.625 7 20.125 22.2 39.025 18.65 8 23.3 24.825 27.150000000000002 24.725 9 21.15 25.0 30.599999999999998 23.25 10-14 23.05 28.82 26.345000000000002 21.785 15-19 22.48 28.689999999999998 27.605 21.224999999999998 20-24 23.419999999999998 28.155 27.615000000000002 20.810000000000002 25-29 22.74 28.575 27.35 21.335 30-34 23.169999999999998 27.615000000000002 27.605 21.61 35-39 23.27 28.03 28.060000000000002 20.64 40-44 24.12 28.065 27.474999999999998 20.34 45-49 23.29 27.37 27.889999999999997 21.45 50-54 23.575 26.93 28.645 20.849999999999998 55-59 23.94 27.98 27.785 20.294999999999998 60-64 23.57 27.625 28.12 20.685000000000002 65-69 23.095 28.205000000000002 27.98 20.72 70-74 23.31 28.18 27.855 20.655 75-79 23.105 27.195000000000004 28.735 20.965 80-84 23.11 28.299999999999997 28.18 20.41 85-89 23.59 28.015 27.939999999999998 20.455000000000002 90-94 22.945 28.315 27.650000000000002 21.09 95-99 23.549999999999997 27.875 28.025 20.549999999999997 100-104 23.630000000000003 28.22 27.16 20.990000000000002 105-109 24.235 27.55 27.744999999999997 20.47 110-114 24.085 27.544999999999998 27.91 20.46 115-119 24.23 27.05 28.249999999999996 20.47 120-124 23.544999999999998 27.029999999999998 28.665000000000003 20.76 125-129 23.23 27.439999999999998 28.444999999999997 20.885 130-134 23.895 27.43 28.139999999999997 20.535 135-139 23.505000000000003 27.36 28.625 20.51 140-144 24.22 26.82 27.965 20.995 145-149 24.54 27.08 28.64 19.74 150-151 24.3875 27.187499999999996 27.825 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 0.5 26 2.5 27 3.5 28 2.5 29 5.0 30 10.5 31 18.0 32 25.5 33 39.5 34 54.5 35 66.0 36 84.0 37 103.0 38 125.5 39 169.5 40 197.0 41 218.5 42 248.5 43 276.5 44 293.0 45 270.5 46 264.5 47 263.0 48 244.5 49 221.5 50 184.5 51 145.5 52 116.5 53 94.5 54 64.0 55 44.0 56 35.0 57 27.0 58 21.5 59 15.5 60 10.0 61 9.0 62 7.0 63 3.5 64 2.5 65 0.0 66 0.5 67 2.0 68 1.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.6625 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.9125000000000001 0.0 0.0 0.0 0.0 132-133 1.0 0.0 0.0 0.0 0.0 134-135 1.1125 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138-139 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGTTA 10 0.006830828 145.0 4 >>END_MODULE Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069807 spots for SRR7169073.sra Written 1069807 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra Read 1069796 spots for SRR7169073.sra Written 1069796 spots for SRR7169073.sra SRR ids: ['SRR7169073.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fmsj1eat SRR7169073.sra spots: 21395931 blocks: [[1, 1069796], [1069797, 2139592], [2139593, 3209388], [3209389, 4279184], [4279185, 5348980], [5348981, 6418776], [6418777, 7488572], [7488573, 8558368], [8558369, 9628164], [9628165, 10697960], [10697961, 11767756], [11767757, 12837552], [12837553, 13907348], [13907349, 14977144], [14977145, 16046940], [16046941, 17116736], [17116737, 18186532], [18186533, 19256328], [19256329, 20326124], [20326125, 21395931]] SRR7169073 file size 7228678 SRR7169073 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169073 SRR7169073_1.fastq SRR7169073_2.fastq Input file: SRR7169073_1.fastq Paired file: SRR7169073_2.fastq trimmed: SRR7169073-trimmed-pair1.fastq, SRR7169073-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:02:13 2025 >> started Mon Feb 10 19:02:37 2025 >> done (23.845s) 21395931 read pairs processed; of these: 20153 ( 0.09%) short read pairs filtered out after trimming by size control 14258 ( 0.07%) empty read pairs filtered out after trimming by size control 21361520 (99.84%) read pairs available; of these: 10292998 (48.18%) trimmed read pairs available after processing 11068522 (51.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 9 0.00% 21 6 0.00% 22 10 0.00% 23 6 0.00% 24 7 0.00% 25 7 0.00% 26 9 0.00% 27 9 0.00% 28 7 0.00% 29 5 0.00% 30 10 0.00% 31 5 0.00% 32 4 0.00% 33 16 0.00% 34 9 0.00% 35 11 0.00% 36 9 0.00% 37 14 0.00% 38 12 0.00% 39 11 0.00% 40 17 0.00% 41 11 0.00% 42 18 0.00% 43 16 0.00% 44 15 0.00% 45 31 0.00% 46 35 0.00% 47 42 0.00% 48 28 0.00% 49 35 0.00% 50 24 0.00% 51 37 0.00% 52 45 0.00% 53 41 0.00% 54 59 0.00% 55 53 0.00% 56 59 0.00% 57 68 0.00% 58 83 0.00% 59 92 0.00% 60 99 0.00% 61 112 0.00% 62 107 0.00% 63 151 0.00% 64 172 0.00% 65 150 0.00% 66 172 0.00% 67 192 0.00% 68 202 0.00% 69 258 0.00% 70 323 0.00% 71 332 0.00% 72 345 0.00% 73 367 0.00% 74 448 0.00% 75 495 0.00% 76 534 0.00% 77 611 0.00% 78 650 0.00% 79 760 0.00% 80 890 0.00% 81 1022 0.00% 82 1144 0.01% 83 1387 0.01% 84 2348 0.01% 85 2845 0.01% 86 3074 0.01% 87 3216 0.02% 88 3452 0.02% 89 3590 0.02% 90 3780 0.02% 91 4072 0.02% 92 4455 0.02% 93 4433 0.02% 94 4639 0.02% 95 4958 0.02% 96 5168 0.02% 97 5622 0.03% 98 5776 0.03% 99 6263 0.03% 100 6576 0.03% 101 7108 0.03% 102 7568 0.04% 103 8249 0.04% 104 8893 0.04% 105 9528 0.04% 106 9897 0.05% 107 10676 0.05% 108 10963 0.05% 109 11946 0.06% 110 12269 0.06% 111 13119 0.06% 112 13792 0.06% 113 15101 0.07% 114 15761 0.07% 115 16582 0.08% 116 17300 0.08% 117 18319 0.09% 118 19480 0.09% 119 20479 0.10% 120 21317 0.10% 121 22282 0.10% 122 24261 0.11% 123 25961 0.12% 124 27926 0.13% 125 29932 0.14% 126 32332 0.15% 127 34021 0.16% 128 36429 0.17% 129 38500 0.18% 130 40913 0.19% 131 44040 0.21% 132 47554 0.22% 133 52030 0.24% 134 56765 0.27% 135 61479 0.29% 136 67618 0.32% 137 73590 0.34% 138 81119 0.38% 139 89146 0.42% 140 99695 0.47% 141 111986 0.52% 142 131070 0.61% 143 149845 0.70% 144 183115 0.86% 145 225073 1.05% 146 290155 1.36% 147 406455 1.90% 148 627068 2.94% 149 1234227 5.78% 150 5593883 26.19% 151 11068522 51.82% 21361520 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=78.40 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.0 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=34 prefix-density=0.28 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=58.73 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.2 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169073 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:03:25 Started mapping on | Feb 10 19:03:25 Finished on | Feb 10 19:05:25 Mapping speed, Million of reads per hour | 640.85 Number of input reads | 21361520 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20126322 Uniquely mapped reads % | 94.22% Average mapped length | 296.53 Number of splices: Total | 18857014 Number of splices: Annotated (sjdb) | 18533752 Number of splices: GT/AG | 18586750 Number of splices: GC/AG | 215305 Number of splices: AT/AC | 15345 Number of splices: Non-canonical | 39614 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353095 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 17968 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 903937 903937 903937 N_multimapping 353095 353095 353095 N_noFeature 520035 19875178 619621 N_ambiguous 234725 1338 82276 UnstrandedReadsAssigned:19371562 PositiveStrandReadsAssigned:249806 NegativeStrandReadsAssigned:19424425 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169073 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169073-trimmed-pair1.fastq SRR7169073-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,361,520 reads, 19,279,015 reads pseudoaligned [quant] estimated average fragment length: 273.688 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR7169073.ke.tsv 34699 SRR7169073.se.tsv 87100 total ==> SRR7169073.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.31 390 10.6705 Potri.005G024800.1.v4.1 1035 762.312 26 1.62868 Potri.004G059700.1.v4.1 961 688.355 5 0.346858 Potri.007G009000.2.v4.1 1416 1143.31 0 0 Potri.003G141000.2.v4.1 2943 2670.31 362 6.47352 Potri.016G087400.1.v4.1 270 62.0958 1876.16 1442.79 Potri.015G069301.1.v4.1 564 297.818 0 0 Potri.010G195200.1.v4.1 1773 1500.31 21 0.668393 Potri.012G127500.1.v4.1 977 704.334 4206 285.158 ==> SRR7169073.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1761 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169073 completed mapping pipeline successfully