Starting /dee2/code/volunteer_pipeline.sh SRR7169074 current disk space = 3057030918144 free memory = 1040778028 SRR7169074 SRAfilesize d987d617afc558fd766cff2a12f89ced SRR7169074.sra SRR7169074.sra file validated SRR7169074 is paired end SRR7169074 is conventional basespace SRR7169074 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169074_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97425 34.0 33.0 34.0 33.0 34.0 2 33.444 34.0 34.0 34.0 33.0 34.0 3 33.5305 34.0 34.0 34.0 33.0 34.0 4 33.52925 34.0 34.0 34.0 33.0 34.0 5 33.55475 34.0 34.0 34.0 33.0 34.0 6 37.254 38.0 38.0 38.0 36.0 38.0 7 37.46325 38.0 38.0 38.0 37.0 38.0 8 37.52675 38.0 38.0 38.0 38.0 38.0 9 37.612 38.0 38.0 38.0 38.0 38.0 10-14 37.59495 38.0 38.0 38.0 38.0 38.0 15-19 37.515100000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.507349999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.47065 38.0 38.0 38.0 38.0 38.0 30-34 37.364250000000006 38.0 38.0 38.0 37.8 38.0 35-39 37.2863 38.0 38.0 38.0 37.0 38.0 40-44 37.102700000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.930049999999994 38.0 38.0 38.0 35.8 38.0 50-54 36.845600000000005 38.0 38.0 38.0 35.6 38.0 55-59 36.74135 38.0 38.0 38.0 35.0 38.0 60-64 36.677550000000004 38.0 38.0 38.0 34.8 38.0 65-69 36.549099999999996 38.0 38.0 38.0 34.2 38.0 70-74 36.5484 38.0 38.0 38.0 34.2 38.0 75-79 36.295249999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.2257 38.0 38.0 38.0 33.6 38.0 85-89 36.035000000000004 38.0 37.2 38.0 33.0 38.0 90-94 35.84325 38.0 37.0 38.0 32.0 38.0 95-99 35.82305 38.0 37.0 38.0 32.6 38.0 100-104 35.407300000000006 38.0 36.6 38.0 29.8 38.0 105-109 35.33325000000001 38.0 36.6 38.0 29.4 38.0 110-114 34.900150000000004 38.0 36.0 38.0 27.8 38.0 115-119 34.888400000000004 38.0 36.0 38.0 28.0 38.0 120-124 34.6667 38.0 35.4 38.0 27.2 38.0 125-129 34.1913 38.0 34.8 38.0 23.2 38.0 130-134 33.710750000000004 38.0 34.0 38.0 22.2 38.0 135-139 33.312349999999995 38.0 34.0 38.0 16.2 38.0 140-144 32.806599999999996 38.0 34.0 38.0 14.2 38.0 145-149 32.041700000000006 38.0 33.0 38.0 11.4 38.0 150-151 28.49325 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 1.0 10 2.0 11 0.0 12 4.0 13 5.0 14 6.0 15 7.0 16 3.0 17 6.0 18 7.0 19 7.0 20 10.0 21 14.0 22 13.0 23 14.0 24 20.0 25 27.0 26 23.0 27 32.0 28 22.0 29 37.0 30 42.0 31 61.0 32 84.0 33 122.0 34 202.0 35 331.0 36 783.0 37 2112.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.26436197254702 14.18403660396543 11.438739196746313 34.11286222674123 2 25.124999999999996 15.049999999999999 29.575000000000003 30.25 3 20.625 18.575 26.450000000000003 34.35 4 22.175 23.9 24.625 29.299999999999997 5 21.875 29.15 24.0 24.975 6 21.0 32.800000000000004 24.05 22.15 7 14.825 31.574999999999996 37.724999999999994 15.875 8 17.150000000000002 30.3 29.299999999999997 23.25 9 16.025 29.025000000000002 31.55 23.400000000000002 10-14 19.175 31.44 26.939999999999998 22.445 15-19 19.265 30.28 27.029999999999998 23.425 20-24 19.259999999999998 30.570000000000004 27.389999999999997 22.78 25-29 19.384999999999998 30.514999999999997 26.845000000000002 23.255 30-34 19.525000000000002 30.125 27.025 23.325000000000003 35-39 19.24 29.985 26.97 23.805 40-44 19.29 29.705 27.584999999999997 23.419999999999998 45-49 19.8 29.945 26.755000000000003 23.5 50-54 19.705000000000002 29.580000000000002 27.495000000000005 23.22 55-59 19.91 29.330000000000002 27.43 23.330000000000002 60-64 19.595000000000002 30.075000000000003 26.615 23.715 65-69 19.875 29.770000000000003 26.665 23.69 70-74 20.11 28.395 27.625 23.87 75-79 19.595000000000002 29.580000000000002 26.905 23.919999999999998 80-84 19.994999999999997 28.82 27.169999999999998 24.015 85-89 19.71 29.244999999999997 27.310000000000002 23.735 90-94 20.150000000000002 29.345 26.605 23.9 95-99 19.86 28.310000000000002 27.775 24.055 100-104 20.44726836101661 29.07744646788073 26.545927556533922 23.92935761456874 105-109 20.11 28.860000000000003 27.205000000000002 23.825 110-114 20.579550573044394 28.832390771232667 26.920574545818525 23.66748410990441 115-119 20.115 28.854999999999997 26.845000000000002 24.185000000000002 120-124 20.401220671369252 28.475661613887638 27.1699434689079 23.95317424583521 125-129 20.601030051502576 28.21641082054103 27.57637881894095 23.60618030901545 130-134 20.32 28.84 27.245 23.595 135-139 20.49 28.360000000000003 27.405 23.745 140-144 20.04 28.134999999999998 27.715 24.11 145-149 20.49 28.455000000000002 27.005000000000003 24.05 150-151 20.9125 27.962500000000002 27.200000000000003 23.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 1.5 23 4.5 24 7.0 25 10.0 26 9.5 27 12.0 28 16.0 29 16.0 30 27.5 31 43.5 32 54.5 33 60.5 34 71.5 35 103.5 36 117.0 37 116.0 38 134.5 39 151.5 40 165.0 41 189.0 42 218.0 43 220.5 44 222.5 45 249.5 46 268.5 47 256.5 48 225.0 49 194.5 50 164.0 51 129.5 52 105.0 53 91.5 54 83.0 55 63.0 56 41.0 57 31.0 58 26.5 59 26.0 60 15.5 61 11.0 62 10.5 63 7.0 64 5.0 65 4.0 66 2.0 67 1.0 68 2.5 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.0 110-114 0.095 115-119 0.0 120-124 0.055 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3518471977883891 0.7000000000000001 3 0.050263885398341285 0.15 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.8375 0.0 0.0 0.0 0.0 130-131 0.9875 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.45 0.0 0.0 0.0 0.0 138-139 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATCAT 10 0.006832588 144.9875 4 >>END_MODULE SRR7169074 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169074_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8075 33.0 33.0 34.0 32.0 34.0 2 32.94275 34.0 33.0 34.0 32.0 34.0 3 33.01525 34.0 33.0 34.0 32.0 34.0 4 32.94825 34.0 33.0 34.0 33.0 34.0 5 32.905 34.0 33.0 34.0 32.0 34.0 6 36.9755 38.0 38.0 38.0 37.0 38.0 7 37.09475 38.0 38.0 38.0 37.0 38.0 8 37.11775 38.0 38.0 38.0 37.0 38.0 9 37.0415 38.0 38.0 38.0 37.0 38.0 10-14 36.9927 38.0 38.0 38.0 37.0 38.0 15-19 36.971599999999995 38.0 38.0 38.0 37.0 38.0 20-24 36.952099999999994 38.0 38.0 38.0 37.0 38.0 25-29 36.92215 38.0 38.0 38.0 37.0 38.0 30-34 36.91985 38.0 38.0 38.0 37.0 38.0 35-39 36.90005 38.0 38.0 38.0 37.0 38.0 40-44 36.9132 38.0 38.0 38.0 37.0 38.0 45-49 36.8439 38.0 38.0 38.0 37.0 38.0 50-54 36.73065 38.0 38.0 38.0 36.6 38.0 55-59 36.6293 38.0 38.0 38.0 36.0 38.0 60-64 36.6228 38.0 38.0 38.0 36.0 38.0 65-69 36.4223 38.0 38.0 38.0 36.0 38.0 70-74 36.39635 38.0 38.0 38.0 35.8 38.0 75-79 36.2645 38.0 38.0 38.0 35.0 38.0 80-84 36.32745 38.0 38.0 38.0 35.0 38.0 85-89 36.345150000000004 38.0 38.0 38.0 35.2 38.0 90-94 36.30775 38.0 38.0 38.0 35.0 38.0 95-99 36.192499999999995 38.0 38.0 38.0 34.4 38.0 100-104 36.0279 38.0 38.0 38.0 34.0 38.0 105-109 35.900400000000005 38.0 38.0 38.0 33.8 38.0 110-114 35.7444 38.0 38.0 38.0 33.2 38.0 115-119 35.543150000000004 38.0 37.8 38.0 31.8 38.0 120-124 35.458850000000005 38.0 38.0 38.0 31.8 38.0 125-129 35.19649999999999 38.0 37.2 38.0 30.2 38.0 130-134 34.899950000000004 38.0 36.4 38.0 29.2 38.0 135-139 34.53315 38.0 36.0 38.0 27.0 38.0 140-144 34.04600000000001 38.0 35.6 38.0 22.6 38.0 145-149 33.38745 38.0 35.0 38.0 15.2 38.0 150-151 30.275875 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 9.0 4 6.0 5 1.0 6 2.0 7 0.0 8 3.0 9 2.0 10 2.0 11 4.0 12 5.0 13 11.0 14 2.0 15 5.0 16 7.0 17 5.0 18 6.0 19 3.0 20 9.0 21 11.0 22 12.0 23 13.0 24 15.0 25 22.0 26 21.0 27 25.0 28 30.0 29 39.0 30 30.0 31 46.0 32 59.0 33 73.0 34 112.0 35 173.0 36 377.0 37 2846.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.36208625877633 20.91273821464393 16.825476429287864 24.899699097291876 2 29.35733933483371 26.831707926981746 26.281570392598148 17.5293823455864 3 22.155538884721178 28.632158039509875 28.657164291072768 20.555138784696176 4 24.075 32.375 24.5 19.05 5 24.681170292573142 36.05901475368842 22.630657664416105 16.62915728932233 6 22.25 36.75 23.150000000000002 17.849999999999998 7 20.525 23.025000000000002 36.3 20.150000000000002 8 22.675 25.25 26.674999999999997 25.4 9 23.200000000000003 25.974999999999998 28.7 22.125 10-14 24.685000000000002 28.82 25.72 20.775 15-19 24.16 28.24 26.75 20.849999999999998 20-24 23.494999999999997 27.88 27.46 21.165 25-29 24.29 28.09 26.735 20.885 30-34 23.875 27.725 27.235 21.165 35-39 23.72 28.360000000000003 27.235 20.685000000000002 40-44 23.674999999999997 28.27 27.165 20.89 45-49 23.825 28.560000000000002 26.38 21.235 50-54 24.188701923076923 27.974759615384613 26.547475961538463 21.2890625 55-59 24.745575775805886 27.788639895723666 26.86118213265153 20.60460219581892 60-64 23.808089932751177 28.159188999297402 27.085215296597408 20.94750577135401 65-69 24.181360201511335 27.85894206549118 26.947103274559193 21.01259445843829 70-74 24.785764694021577 27.30113922774473 27.07934267567295 20.833753402560742 75-79 24.30566056756893 27.173748676848632 27.80382075709461 20.716769998487827 80-84 23.61793919935788 27.882010635095817 27.39038828132838 21.10966188421792 85-89 24.442439733373426 27.594847892547484 27.80033077732672 20.16238159675237 90-94 24.08140758935285 27.47004862399118 27.465035841395558 20.983507945260413 95-99 24.165413533834588 27.408521303258144 28.1203007518797 20.305764411027567 100-104 24.135164945352454 27.414017848190113 27.885290283766167 20.565526922691266 105-109 23.742918734646814 27.974131448338095 27.94906502230912 20.33388479470597 110-114 24.27812312011229 27.556647282935632 27.83236414678163 20.33286545017044 115-119 24.457257458009526 27.41037854098772 27.936826272248684 20.195537728754072 120-124 23.675106542993234 27.300075206818754 28.428177488092253 20.596640762095763 125-129 24.310638724556302 27.514288579163743 27.90033089341221 20.274741802867744 130-134 24.04872913220033 27.512909209404924 28.31503484233218 20.123326816062566 135-139 24.57447879947628 27.016819417866856 28.492295296605903 19.91640648605096 140-144 24.27634896621281 27.47856782652547 28.20474029248613 20.040342914775593 145-149 23.871685893543816 27.808136004857314 27.798016595830806 20.522161505768064 150-151 25.376916254909414 26.821234004814393 28.32889902445205 19.472950715824147 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 0.5 19 1.0 20 1.5 21 2.0 22 2.5 23 1.0 24 0.0 25 0.5 26 0.5 27 2.0 28 6.0 29 7.5 30 6.5 31 14.5 32 21.5 33 25.5 34 32.5 35 44.5 36 65.0 37 81.5 38 106.5 39 141.0 40 163.5 41 208.5 42 257.5 43 261.5 44 275.5 45 281.0 46 299.0 47 299.5 48 258.5 49 223.0 50 179.0 51 148.0 52 120.0 53 105.0 54 96.0 55 64.5 56 44.5 57 47.5 58 33.0 59 17.0 60 12.5 61 11.0 62 10.0 63 5.0 64 2.5 65 2.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.025 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.16 55-59 0.265 60-64 0.37 65-69 0.75 70-74 0.8099999999999999 75-79 0.8049999999999999 80-84 0.33 85-89 0.23500000000000001 90-94 0.255 95-99 0.25 100-104 0.27 105-109 0.265 110-114 0.26 115-119 0.27499999999999997 120-124 0.27499999999999997 125-129 0.27 130-134 0.265 135-139 0.7100000000000001 140-144 0.8500000000000001 145-149 1.18 150-151 1.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.35 0.0 0.0 0.0 0.0 136-137 1.525 0.0 0.0 0.0 0.0 138-139 1.7374999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATGCC 10 0.006830828 145.0 4 >>END_MODULE Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684682 spots for SRR7169074.sra Written 684682 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra Read 684679 spots for SRR7169074.sra Written 684679 spots for SRR7169074.sra SRR ids: ['SRR7169074.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_07_rhiv4 SRR7169074.sra spots: 13693583 blocks: [[1, 684679], [684680, 1369358], [1369359, 2054037], [2054038, 2738716], [2738717, 3423395], [3423396, 4108074], [4108075, 4792753], [4792754, 5477432], [5477433, 6162111], [6162112, 6846790], [6846791, 7531469], [7531470, 8216148], [8216149, 8900827], [8900828, 9585506], [9585507, 10270185], [10270186, 10954864], [10954865, 11639543], [11639544, 12324222], [12324223, 13008901], [13008902, 13693583]] SRR7169074 file size 4618605 SRR7169074 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169074 SRR7169074_1.fastq SRR7169074_2.fastq Input file: SRR7169074_1.fastq Paired file: SRR7169074_2.fastq trimmed: SRR7169074-trimmed-pair1.fastq, SRR7169074-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:09:27 2025 >> started Mon Feb 10 19:09:42 2025 >> done (15.150s) 13693583 read pairs processed; of these: 22614 ( 0.17%) short read pairs filtered out after trimming by size control 30229 ( 0.22%) empty read pairs filtered out after trimming by size control 13640740 (99.61%) read pairs available; of these: 6274286 (46.00%) trimmed read pairs available after processing 7366454 (54.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 7 0.00% 21 7 0.00% 22 10 0.00% 23 5 0.00% 24 10 0.00% 25 9 0.00% 26 10 0.00% 27 7 0.00% 28 13 0.00% 29 8 0.00% 30 8 0.00% 31 10 0.00% 32 7 0.00% 33 7 0.00% 34 10 0.00% 35 11 0.00% 36 11 0.00% 37 15 0.00% 38 15 0.00% 39 16 0.00% 40 19 0.00% 41 15 0.00% 42 16 0.00% 43 27 0.00% 44 28 0.00% 45 39 0.00% 46 35 0.00% 47 43 0.00% 48 37 0.00% 49 46 0.00% 50 40 0.00% 51 60 0.00% 52 66 0.00% 53 56 0.00% 54 71 0.00% 55 78 0.00% 56 91 0.00% 57 70 0.00% 58 94 0.00% 59 91 0.00% 60 95 0.00% 61 139 0.00% 62 136 0.00% 63 147 0.00% 64 201 0.00% 65 179 0.00% 66 205 0.00% 67 215 0.00% 68 278 0.00% 69 300 0.00% 70 408 0.00% 71 385 0.00% 72 441 0.00% 73 500 0.00% 74 576 0.00% 75 798 0.01% 76 656 0.00% 77 536 0.00% 78 693 0.01% 79 1124 0.01% 80 1711 0.01% 81 771 0.01% 82 928 0.01% 83 1131 0.01% 84 2102 0.02% 85 3009 0.02% 86 3321 0.02% 87 3230 0.02% 88 3056 0.02% 89 3079 0.02% 90 3308 0.02% 91 3398 0.02% 92 3618 0.03% 93 3884 0.03% 94 4163 0.03% 95 4404 0.03% 96 4730 0.03% 97 5338 0.04% 98 6230 0.05% 99 7465 0.05% 100 8419 0.06% 101 6195 0.05% 102 5952 0.04% 103 6301 0.05% 104 6604 0.05% 105 7148 0.05% 106 7492 0.05% 107 8006 0.06% 108 8496 0.06% 109 9089 0.07% 110 9473 0.07% 111 9838 0.07% 112 10446 0.08% 113 11046 0.08% 114 11795 0.09% 115 12357 0.09% 116 12818 0.09% 117 13760 0.10% 118 14289 0.10% 119 14820 0.11% 120 15728 0.12% 121 16777 0.12% 122 17167 0.13% 123 18768 0.14% 124 19958 0.15% 125 21195 0.16% 126 22626 0.17% 127 23853 0.17% 128 25336 0.19% 129 27399 0.20% 130 28491 0.21% 131 30416 0.22% 132 32704 0.24% 133 34946 0.26% 134 37551 0.28% 135 40686 0.30% 136 44159 0.32% 137 47836 0.35% 138 52573 0.39% 139 58765 0.43% 140 63968 0.47% 141 71242 0.52% 142 80564 0.59% 143 92195 0.68% 144 109753 0.80% 145 134018 0.98% 146 168232 1.23% 147 231351 1.70% 148 369821 2.71% 149 722207 5.29% 150 3341546 24.50% 151 7366454 54.00% 13640740 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=266.31 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=20.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=28 prefix-density=0.48 prefix-fanout=3.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.04 sequence-density-rank=42 fanout-score=78.75 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.1 sequence=CACCACCACTGGTAACAAGGACATCATCATGGTTGATCACATGAGGAAGATGAAGAACAATGCCATTGTCTGCAACATCGGTCACTTCGATAATGAAATCGACATGCTTGGACTTGAGACCTTCCCTGGCGTGAAGCGCATCACCATCAAGCCCCAAACTGACAGGTGGGTCTTCCCTGACACCAACTCCGGCATCATTGTCCTGGCTGAGGGACGTCTCATGAACCTGGGATGTGCCACCGGTCACCCCAGCTTTGTGATGTCCTGCTCATTCACCAACCAGGTGAT SRR7169074 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:10:28 Started mapping on | Feb 10 19:10:28 Finished on | Feb 10 19:12:12 Mapping speed, Million of reads per hour | 472.18 Number of input reads | 13640740 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12637204 Uniquely mapped reads % | 92.64% Average mapped length | 296.04 Number of splices: Total | 10878312 Number of splices: Annotated (sjdb) | 10692354 Number of splices: GT/AG | 10720713 Number of splices: GC/AG | 121240 Number of splices: AT/AC | 9304 Number of splices: Non-canonical | 27055 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253178 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 20480 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.30% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 773447 773447 773447 N_multimapping 253178 253178 253178 N_noFeature 248568 12462175 314982 N_ambiguous 162029 1066 52624 UnstrandedReadsAssigned:12226607 PositiveStrandReadsAssigned:173963 NegativeStrandReadsAssigned:12269598 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169074 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169074-trimmed-pair1.fastq SRR7169074-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,640,740 reads, 12,225,673 reads pseudoaligned [quant] estimated average fragment length: 266.478 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52401 SRR7169074.ke.tsv 34699 SRR7169074.se.tsv 87100 total ==> SRR7169074.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.52 194 6.86333 Potri.005G024800.1.v4.1 1035 769.522 33 2.65882 Potri.004G059700.1.v4.1 961 695.548 2 0.178279 Potri.007G009000.2.v4.1 1416 1150.52 0 0 Potri.003G141000.2.v4.1 2943 2677.52 193 4.46911 Potri.016G087400.1.v4.1 270 60.5579 1672.57 1712.42 Potri.015G069301.1.v4.1 564 302.322 0 0 Potri.010G195200.1.v4.1 1773 1507.52 7 0.287893 Potri.012G127500.1.v4.1 977 711.543 5406 471.055 ==> SRR7169074.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1097 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 274 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169074 completed mapping pipeline successfully