Starting /dee2/code/volunteer_pipeline.sh SRR7169075 current disk space = 3056685072384 free memory = 1491916688 SRR7169075 SRAfilesize 0e7301241770a39fcba94e8cd1bfbc55 SRR7169075.sra SRR7169075.sra file validated SRR7169075 is paired end SRR7169075 is conventional basespace SRR7169075 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169075_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9885 34.0 33.0 34.0 33.0 34.0 2 33.4305 34.0 34.0 34.0 33.0 34.0 3 33.474 34.0 34.0 34.0 33.0 34.0 4 33.47125 34.0 34.0 34.0 33.0 34.0 5 33.50325 34.0 34.0 34.0 33.0 34.0 6 37.15275 38.0 38.0 38.0 36.0 38.0 7 37.3555 38.0 38.0 38.0 37.0 38.0 8 37.4135 38.0 38.0 38.0 37.0 38.0 9 37.49225 38.0 38.0 38.0 37.0 38.0 10-14 37.4404 38.0 38.0 38.0 37.0 38.0 15-19 37.3445 38.0 38.0 38.0 37.0 38.0 20-24 37.3667 38.0 38.0 38.0 37.0 38.0 25-29 37.338499999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.24965 38.0 38.0 38.0 36.8 38.0 35-39 37.12480000000001 38.0 38.0 38.0 36.2 38.0 40-44 36.8016 38.0 38.0 38.0 35.2 38.0 45-49 36.57885 38.0 38.0 38.0 34.0 38.0 50-54 36.414 38.0 37.4 38.0 34.0 38.0 55-59 36.2738 38.0 37.0 38.0 33.0 38.0 60-64 36.2512 38.0 37.0 38.0 33.8 38.0 65-69 36.09755 38.0 37.0 38.0 33.0 38.0 70-74 36.047399999999996 38.0 37.0 38.0 33.0 38.0 75-79 35.7692 38.0 37.0 38.0 31.2 38.0 80-84 35.731899999999996 38.0 36.8 38.0 30.6 38.0 85-89 35.552699999999994 38.0 36.2 38.0 29.8 38.0 90-94 35.28680000000001 38.0 36.0 38.0 29.0 38.0 95-99 35.175549999999994 38.0 36.0 38.0 28.8 38.0 100-104 34.83285 38.0 35.4 38.0 27.6 38.0 105-109 34.65235 38.0 35.0 38.0 26.8 38.0 110-114 34.24135 38.0 34.4 38.0 24.0 38.0 115-119 34.0201 38.0 34.0 38.0 23.0 38.0 120-124 33.768150000000006 38.0 34.0 38.0 22.6 38.0 125-129 33.2019 37.8 33.4 38.0 17.4 38.0 130-134 32.740199999999994 37.2 33.0 38.0 15.0 38.0 135-139 32.36835 36.6 32.4 38.0 14.6 38.0 140-144 31.724200000000003 36.0 31.0 38.0 14.0 38.0 145-149 30.71035 36.0 31.0 38.0 8.8 38.0 150-151 26.628375 34.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 2.0 13 1.0 14 8.0 15 4.0 16 10.0 17 4.0 18 7.0 19 8.0 20 10.0 21 7.0 22 17.0 23 21.0 24 24.0 25 25.0 26 34.0 27 29.0 28 37.0 29 55.0 30 67.0 31 92.0 32 127.0 33 192.0 34 245.0 35 526.0 36 1114.0 37 1328.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.17364813404417 14.064483371414063 9.799441482609799 31.96242701193196 2 25.05 14.075 29.95 30.925000000000004 3 19.475 18.95 25.775 35.8 4 23.05 24.275 24.2 28.475 5 23.25 29.125 24.2 23.425 6 19.875 33.525 26.025 20.575 7 15.9 30.3 36.9 16.900000000000002 8 18.224999999999998 28.525 31.05 22.2 9 16.650000000000002 27.05 34.150000000000006 22.15 10-14 19.2 31.055 27.775 21.97 15-19 19.345000000000002 29.544999999999998 27.855 23.255 20-24 20.28 29.755 27.650000000000002 22.314999999999998 25-29 19.825 30.275000000000002 27.105 22.795 30-34 19.375 29.49 27.655 23.48 35-39 19.595000000000002 29.99 26.575 23.84 40-44 19.650000000000002 29.515 27.775 23.06 45-49 20.575 29.705 26.834999999999997 22.884999999999998 50-54 19.725 30.3 26.884999999999998 23.09 55-59 20.385 29.23 27.229999999999997 23.155 60-64 19.725 29.215000000000003 27.49 23.57 65-69 19.814999999999998 28.52 28.03 23.635 70-74 19.994999999999997 29.585 27.01 23.41 75-79 19.895 28.945 27.325 23.835 80-84 19.97 28.999999999999996 27.37 23.66 85-89 20.560000000000002 28.675 27.325 23.44 90-94 20.78 28.994999999999997 26.805 23.419999999999998 95-99 20.66 28.82 27.04 23.48 100-104 20.75433945275374 28.86298834475514 27.252263518583362 23.130408683907756 105-109 20.23 28.58 27.279999999999998 23.91 110-114 20.819573701591114 29.16041228860202 26.963874712298608 23.056139297508256 115-119 20.225 29.285 27.095000000000002 23.395 120-124 20.33813525410164 27.89115646258503 27.751100440176067 24.019607843137255 125-129 20.741037051852594 28.421421071053555 27.386369318465924 23.45117255862793 130-134 20.78 27.705000000000002 27.71 23.805 135-139 20.665 27.76 27.6 23.974999999999998 140-144 21.099999999999998 28.244999999999997 27.01 23.645 145-149 20.57 28.875 26.96 23.595 150-151 20.75 28.287499999999998 27.537499999999998 23.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 1.5 23 1.5 24 3.0 25 3.5 26 4.5 27 9.5 28 18.5 29 18.5 30 20.0 31 35.5 32 49.5 33 62.5 34 79.0 35 95.0 36 103.5 37 115.0 38 140.0 39 173.5 40 195.5 41 204.5 42 214.0 43 226.0 44 241.5 45 261.5 46 256.5 47 224.0 48 219.0 49 199.5 50 164.0 51 139.5 52 114.5 53 90.0 54 74.0 55 65.5 56 44.0 57 33.5 58 24.5 59 15.0 60 13.0 61 7.5 62 7.0 63 7.0 64 4.5 65 4.0 66 4.0 67 2.0 68 0.0 69 1.5 70 2.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.0 110-114 0.06999999999999999 115-119 0.0 120-124 0.04 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.037500000000000006 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88-89 0.075 0.025 0.0 0.0 0.0 90-91 0.075 0.025 0.0 0.0 0.0 92-93 0.075 0.025 0.0 0.0 0.0 94-95 0.075 0.025 0.0 0.0 0.0 96-97 0.075 0.025 0.0 0.0 0.0 98-99 0.075 0.025 0.0 0.0 0.0 100-101 0.1 0.025 0.0 0.0 0.0 102-103 0.1125 0.025 0.0 0.0 0.0 104-105 0.1375 0.025 0.0 0.0 0.0 106-107 0.175 0.025 0.0 0.0 0.0 108-109 0.1875 0.025 0.0 0.0 0.0 110-111 0.225 0.025 0.0 0.0 0.0 112-113 0.2625 0.025 0.0 0.0 0.0 114-115 0.275 0.025 0.0 0.0 0.0 116-117 0.3 0.025 0.0 0.0 0.0 118-119 0.325 0.025 0.0 0.0 0.0 120-121 0.3375 0.025 0.0 0.0 0.0 122-123 0.475 0.025 0.0 0.0 0.0 124-125 0.575 0.025 0.0 0.0 0.0 126-127 0.675 0.025 0.0 0.0 0.0 128-129 0.7375 0.025 0.0 0.0 0.0 130-131 0.9 0.025 0.0 0.0 0.0 132-133 0.975 0.025 0.0 0.0 0.0 134-135 1.175 0.025 0.0 0.0 0.0 136-137 1.2999999999999998 0.025 0.0 0.0 0.0 138-139 1.4125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169075 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169075_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8615 33.0 33.0 34.0 32.0 34.0 2 32.956 34.0 33.0 34.0 32.0 34.0 3 32.96775 34.0 33.0 34.0 32.0 34.0 4 32.88525 34.0 33.0 34.0 32.0 34.0 5 32.88275 34.0 33.0 34.0 32.0 34.0 6 37.03875 38.0 38.0 38.0 37.0 38.0 7 37.035 38.0 38.0 38.0 37.0 38.0 8 36.99 38.0 38.0 38.0 37.0 38.0 9 37.005 38.0 38.0 38.0 37.0 38.0 10-14 36.989399999999996 38.0 38.0 38.0 37.0 38.0 15-19 36.92885 38.0 38.0 38.0 37.0 38.0 20-24 36.94235 38.0 38.0 38.0 37.0 38.0 25-29 36.887100000000004 38.0 38.0 38.0 37.0 38.0 30-34 36.90995 38.0 38.0 38.0 37.0 38.0 35-39 36.89615 38.0 38.0 38.0 37.0 38.0 40-44 36.813500000000005 38.0 38.0 38.0 36.6 38.0 45-49 36.82605 38.0 38.0 38.0 36.8 38.0 50-54 36.72095 38.0 38.0 38.0 36.4 38.0 55-59 36.6301 38.0 38.0 38.0 36.0 38.0 60-64 36.575149999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.41139999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.387750000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.294650000000004 38.0 38.0 38.0 35.2 38.0 80-84 36.32145 38.0 38.0 38.0 34.4 38.0 85-89 36.2934 38.0 38.0 38.0 34.4 38.0 90-94 36.201350000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.11665 38.0 38.0 38.0 34.0 38.0 100-104 35.83794999999999 38.0 38.0 38.0 33.2 38.0 105-109 35.80535 38.0 38.0 38.0 33.6 38.0 110-114 35.679 38.0 38.0 38.0 32.6 38.0 115-119 35.501850000000005 38.0 37.8 38.0 31.8 38.0 120-124 35.37375 38.0 37.2 38.0 31.0 38.0 125-129 35.046350000000004 38.0 36.6 38.0 28.4 38.0 130-134 34.8338 38.0 36.2 38.0 28.0 38.0 135-139 34.493 38.0 36.0 38.0 27.0 38.0 140-144 34.047250000000005 38.0 35.6 38.0 22.8 38.0 145-149 33.4898 38.0 35.0 38.0 17.4 38.0 150-151 30.228250000000003 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 9.0 4 3.0 5 1.0 6 4.0 7 2.0 8 2.0 9 3.0 10 3.0 11 5.0 12 3.0 13 8.0 14 4.0 15 6.0 16 3.0 17 5.0 18 11.0 19 9.0 20 11.0 21 13.0 22 17.0 23 9.0 24 10.0 25 16.0 26 21.0 27 27.0 28 24.0 29 39.0 30 41.0 31 52.0 32 56.0 33 71.0 34 96.0 35 184.0 36 399.0 37 2820.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.478957915831664 22.26953907815631 14.353707414829659 23.897795591182362 2 29.164582291145575 27.688844422211105 25.662831415707853 17.483741870935468 3 21.410705352676338 29.164582291145575 28.36418209104552 21.060530265132567 4 24.099999999999998 32.65 23.974999999999998 19.275000000000002 5 24.875 35.175 22.0 17.95 6 22.55 36.7 22.900000000000002 17.849999999999998 7 20.65 22.825 37.55 18.975 8 22.575 26.775 25.775 24.875 9 22.575 26.625 27.900000000000002 22.900000000000002 10-14 24.14 28.78 26.26 20.82 15-19 23.715 27.125 27.800000000000004 21.36 20-24 23.27 28.1 27.55 21.08 25-29 24.01 28.02 27.13 20.84 30-34 23.785 27.950000000000003 27.13 21.135 35-39 24.01 27.625 27.465 20.9 40-44 24.025 28.12 27.084999999999997 20.77 45-49 23.49 28.435 27.055 21.02 50-54 24.24409291149379 27.583099719663593 27.64817781337605 20.524629555466557 55-59 23.552104208416832 27.725450901803605 27.82565130260521 20.896793587174347 60-64 23.380140421263793 27.487462387161482 28.189568706118358 20.94282848545637 65-69 24.07044025157233 27.567295597484275 27.758490566037736 20.60377358490566 70-74 24.315482182403866 27.52667606200926 27.61224078920878 20.545600966378093 75-79 23.60432922225019 27.435187515731187 27.827837905864587 21.13264535615404 80-84 23.331829347771595 27.658294480372987 27.47280292775856 21.537073244096856 85-89 24.178356713426854 27.655310621242485 27.79559118236473 20.370741482965933 90-94 23.827655310621243 26.96392785571142 27.870741482965933 21.337675350701403 95-99 23.69238476953908 27.364729458917836 28.176352705410824 20.766533066132265 100-104 24.34869739478958 27.334669338677354 27.444889779559116 20.871743486973948 105-109 23.672344689378757 27.17935871743487 28.331663326653306 20.816633266533067 110-114 23.857715430861724 27.86573146292585 27.62024048096192 20.6563126252505 115-119 24.243486973947896 27.940881763527052 27.45490981963928 20.360721442885772 120-124 24.028056112224448 27.31462925851703 27.850701402805612 20.806613226452907 125-129 23.416833667334668 28.181362725450903 27.62024048096192 20.781563126252507 130-134 24.223446893787575 27.38977955911824 27.90581162324649 20.480961923847694 135-139 23.256047880098578 27.97364582809435 28.154705024392694 20.615601267414373 140-144 23.908775109500073 27.614156975280675 27.679605296279515 20.79746261893974 145-149 24.239366264695494 28.422221100963725 27.579595337807156 19.75881729653363 150-151 25.502846299810244 27.868437697659708 26.98292220113852 19.645793801391527 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 2.0 18 2.0 19 0.5 20 0.0 21 1.0 22 2.0 23 2.5 24 3.0 25 2.5 26 1.0 27 1.0 28 6.0 29 6.0 30 7.0 31 14.0 32 20.0 33 27.0 34 31.5 35 44.0 36 61.0 37 84.0 38 113.0 39 146.0 40 188.0 41 217.5 42 247.5 43 280.5 44 302.0 45 289.5 46 276.5 47 279.0 48 253.0 49 208.0 50 169.0 51 154.0 52 136.5 53 110.5 54 86.0 55 61.5 56 43.5 57 30.0 58 23.5 59 15.5 60 10.5 61 9.5 62 5.5 63 6.0 64 8.5 65 6.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.05 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.12 55-59 0.2 60-64 0.3 65-69 0.625 70-74 0.66 75-79 0.675 80-84 0.265 85-89 0.2 90-94 0.2 95-99 0.2 100-104 0.2 105-109 0.2 110-114 0.2 115-119 0.2 120-124 0.2 125-129 0.2 130-134 0.2 135-139 0.585 140-144 0.685 145-149 0.905 150-151 1.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7571933366986371 1.5 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.3625 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.7250000000000001 0.0 0.0 0.0 0.0 128-129 0.7875000000000001 0.0 0.0 0.0 0.0 130-131 0.95 0.0 0.0 0.0 0.0 132-133 1.025 0.0 0.0 0.0 0.0 134-135 1.2 0.0 0.0 0.0 0.0 136-137 1.3250000000000002 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709672 spots for SRR7169075.sra Written 709672 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra Read 709669 spots for SRR7169075.sra Written 709669 spots for SRR7169075.sra SRR ids: ['SRR7169075.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rjt3uc7k SRR7169075.sra spots: 14193383 blocks: [[1, 709669], [709670, 1419338], [1419339, 2129007], [2129008, 2838676], [2838677, 3548345], [3548346, 4258014], [4258015, 4967683], [4967684, 5677352], [5677353, 6387021], [6387022, 7096690], [7096691, 7806359], [7806360, 8516028], [8516029, 9225697], [9225698, 9935366], [9935367, 10645035], [10645036, 11354704], [11354705, 12064373], [12064374, 12774042], [12774043, 13483711], [13483712, 14193383]] SRR7169075 file size 4787971 SRR7169075 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169075 SRR7169075_1.fastq SRR7169075_2.fastq Input file: SRR7169075_1.fastq Paired file: SRR7169075_2.fastq trimmed: SRR7169075-trimmed-pair1.fastq, SRR7169075-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:35:15 2025 >> started Mon Feb 10 19:35:31 2025 >> done (15.626s) 14193383 read pairs processed; of these: 26933 ( 0.19%) short read pairs filtered out after trimming by size control 28769 ( 0.20%) empty read pairs filtered out after trimming by size control 14137681 (99.61%) read pairs available; of these: 7453216 (52.72%) trimmed read pairs available after processing 6684465 (47.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 2 0.00% 21 8 0.00% 22 6 0.00% 23 11 0.00% 24 11 0.00% 25 8 0.00% 26 8 0.00% 27 8 0.00% 28 13 0.00% 29 9 0.00% 30 23 0.00% 31 8 0.00% 32 12 0.00% 33 15 0.00% 34 14 0.00% 35 15 0.00% 36 18 0.00% 37 27 0.00% 38 24 0.00% 39 15 0.00% 40 23 0.00% 41 24 0.00% 42 24 0.00% 43 35 0.00% 44 23 0.00% 45 27 0.00% 46 30 0.00% 47 49 0.00% 48 40 0.00% 49 52 0.00% 50 52 0.00% 51 47 0.00% 52 53 0.00% 53 72 0.00% 54 81 0.00% 55 74 0.00% 56 83 0.00% 57 91 0.00% 58 99 0.00% 59 106 0.00% 60 133 0.00% 61 122 0.00% 62 152 0.00% 63 182 0.00% 64 189 0.00% 65 194 0.00% 66 245 0.00% 67 265 0.00% 68 299 0.00% 69 335 0.00% 70 357 0.00% 71 386 0.00% 72 437 0.00% 73 527 0.00% 74 589 0.00% 75 685 0.00% 76 658 0.00% 77 582 0.00% 78 739 0.01% 79 1064 0.01% 80 1565 0.01% 81 858 0.01% 82 1030 0.01% 83 1299 0.01% 84 2395 0.02% 85 3041 0.02% 86 3220 0.02% 87 3187 0.02% 88 3217 0.02% 89 3288 0.02% 90 3543 0.03% 91 3599 0.03% 92 3827 0.03% 93 4012 0.03% 94 4279 0.03% 95 4526 0.03% 96 4827 0.03% 97 5503 0.04% 98 6536 0.05% 99 8325 0.06% 100 9056 0.06% 101 6549 0.05% 102 6532 0.05% 103 7056 0.05% 104 7483 0.05% 105 8187 0.06% 106 8828 0.06% 107 9324 0.07% 108 9781 0.07% 109 10208 0.07% 110 10633 0.08% 111 11350 0.08% 112 12101 0.09% 113 13036 0.09% 114 13443 0.10% 115 14119 0.10% 116 14937 0.11% 117 15854 0.11% 118 16591 0.12% 119 17142 0.12% 120 18569 0.13% 121 19396 0.14% 122 20544 0.15% 123 21940 0.16% 124 23176 0.16% 125 24414 0.17% 126 26024 0.18% 127 27851 0.20% 128 30206 0.21% 129 31943 0.23% 130 34200 0.24% 131 36564 0.26% 132 38938 0.28% 133 42539 0.30% 134 45414 0.32% 135 49919 0.35% 136 54560 0.39% 137 59729 0.42% 138 66659 0.47% 139 75224 0.53% 140 82696 0.58% 141 93221 0.66% 142 107282 0.76% 143 124874 0.88% 144 151617 1.07% 145 189095 1.34% 146 241071 1.71% 147 333980 2.36% 148 521467 3.69% 149 972716 6.88% 150 3583611 25.35% 151 6684465 47.28% 14137681 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.59 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=4.0 sequence=GTTGCATCCTGGTATTGCTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=35 fanout-score=96.92 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=9.2 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=39 prefix-density=0.25 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=10 fanout-score=22.18 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.9 sequence=TTTTCTTCATTGC SRR7169075 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:36:52 Started mapping on | Feb 10 19:36:52 Finished on | Feb 10 19:39:11 Mapping speed, Million of reads per hour | 366.16 Number of input reads | 14137681 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12845836 Uniquely mapped reads % | 90.86% Average mapped length | 295.32 Number of splices: Total | 10773795 Number of splices: Annotated (sjdb) | 10577158 Number of splices: GT/AG | 10624040 Number of splices: GC/AG | 117021 Number of splices: AT/AC | 8689 Number of splices: Non-canonical | 24045 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231801 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 18684 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.32% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1081286 1081286 1081286 N_multimapping 231801 231801 231801 N_noFeature 273521 12649076 346955 N_ambiguous 177239 899 53331 UnstrandedReadsAssigned:12395076 PositiveStrandReadsAssigned:195861 NegativeStrandReadsAssigned:12445550 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169075 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169075-trimmed-pair1.fastq SRR7169075-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,137,681 reads, 12,408,879 reads pseudoaligned [quant] estimated average fragment length: 260.243 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7169075.ke.tsv 34699 SRR7169075.se.tsv 87100 total ==> SRR7169075.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.76 246 9.68278 Potri.005G024800.1.v4.1 1035 775.757 36 3.21253 Potri.004G059700.1.v4.1 961 701.784 3 0.29593 Potri.007G009000.2.v4.1 1416 1156.76 0 0 Potri.003G141000.2.v4.1 2943 2683.76 176.028 4.54056 Potri.016G087400.1.v4.1 270 62.4982 1321 1463.21 Potri.015G069301.1.v4.1 564 307.995 0 0 Potri.010G195200.1.v4.1 1773 1513.76 6 0.274388 Potri.012G127500.1.v4.1 977 717.773 2095 202.054 ==> SRR7169075.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1561 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169075 completed mapping pipeline successfully