Starting /dee2/code/volunteer_pipeline.sh SRR7169076 current disk space = 3056491405312 free memory = 1532810636 SRR7169076 SRAfilesize 7fc6cb406188af05732a673f0ed63e17 SRR7169076.sra SRR7169076.sra file validated SRR7169076 is paired end SRR7169076 is conventional basespace SRR7169076 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169076_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7645 34.0 33.0 34.0 32.0 34.0 2 33.2945 34.0 33.0 34.0 33.0 34.0 3 33.34775 34.0 33.0 34.0 33.0 34.0 4 33.396 34.0 34.0 34.0 33.0 34.0 5 33.42075 34.0 34.0 34.0 33.0 34.0 6 37.03225 38.0 37.0 38.0 36.0 38.0 7 37.414 38.0 38.0 38.0 37.0 38.0 8 37.50075 38.0 38.0 38.0 37.0 38.0 9 37.5015 38.0 38.0 38.0 37.0 38.0 10-14 37.4481 38.0 38.0 38.0 37.2 38.0 15-19 37.384 38.0 38.0 38.0 37.0 38.0 20-24 37.25825 38.0 38.0 38.0 36.6 38.0 25-29 37.23765 38.0 38.0 38.0 36.8 38.0 30-34 37.3098 38.0 38.0 38.0 37.0 38.0 35-39 37.071600000000004 38.0 38.0 38.0 36.2 38.0 40-44 36.980900000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.890950000000004 38.0 38.0 38.0 35.2 38.0 50-54 36.791599999999995 38.0 38.0 38.0 34.8 38.0 55-59 36.63305 38.0 38.0 38.0 34.4 38.0 60-64 36.7106 38.0 38.0 38.0 34.4 38.0 65-69 36.64135 38.0 38.0 38.0 34.4 38.0 70-74 36.4721 38.0 37.6 38.0 33.6 38.0 75-79 36.393449999999994 38.0 37.4 38.0 34.0 38.0 80-84 35.9003 38.0 36.8 38.0 31.8 38.0 85-89 36.071549999999995 38.0 37.0 38.0 33.0 38.0 90-94 35.93315 38.0 37.0 38.0 31.8 38.0 95-99 35.646 38.0 36.6 38.0 30.2 38.0 100-104 35.35385 38.0 36.0 38.0 29.4 38.0 105-109 34.67845 38.0 35.0 38.0 26.0 38.0 110-114 34.70435 38.0 35.0 38.0 25.6 38.0 115-119 35.14315 38.0 36.0 38.0 28.6 38.0 120-124 34.3052 38.0 34.4 38.0 24.0 38.0 125-129 33.9366 38.0 34.0 38.0 22.6 38.0 130-134 33.8509 38.0 34.0 38.0 22.6 38.0 135-139 33.4702 38.0 33.8 38.0 20.2 38.0 140-144 32.6348 37.6 33.2 38.0 14.4 38.0 145-149 31.459250000000004 36.0 31.0 38.0 11.4 38.0 150-151 27.43275 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 4.0 18 2.0 19 5.0 20 10.0 21 8.0 22 9.0 23 15.0 24 19.0 25 35.0 26 23.0 27 38.0 28 47.0 29 36.0 30 80.0 31 82.0 32 114.0 33 158.0 34 235.0 35 394.0 36 960.0 37 1721.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.07927606423655 12.668875860310985 8.48840173336732 35.76344634208514 2 22.6 14.7 34.425 28.275 3 18.35 19.875 27.650000000000002 34.125 4 21.7 28.449999999999996 24.15 25.7 5 23.875 32.0 23.974999999999998 20.150000000000002 6 18.55 35.55 25.0 20.9 7 14.399999999999999 27.950000000000003 39.2 18.45 8 17.974999999999998 26.35 29.575000000000003 26.1 9 17.849999999999998 23.45 34.449999999999996 24.25 10-14 19.41 29.935000000000002 26.75 23.905 15-19 19.595000000000002 29.32 27.089999999999996 23.995 20-24 19.895 29.01 27.02 24.075 25-29 19.650000000000002 28.895 27.54 23.915 30-34 19.455 29.360000000000003 27.845 23.34 35-39 20.125 29.445 26.71 23.72 40-44 20.560000000000002 28.845 27.21 23.385 45-49 19.715 29.18 27.27 23.835 50-54 19.99 30.020000000000003 26.740000000000002 23.25 55-59 20.595 28.610000000000003 27.275 23.52 60-64 20.225 28.189999999999998 27.565 24.02 65-69 20.205000000000002 28.73 27.66 23.405 70-74 19.55 29.095 27.42 23.935000000000002 75-79 20.385 28.410000000000004 27.634999999999998 23.57 80-84 19.79 28.64 27.950000000000003 23.62 85-89 20.325 28.189999999999998 27.71 23.775 90-94 20.244999999999997 28.444999999999997 26.985 24.325 95-99 20.06 28.720000000000002 27.255000000000003 23.965 100-104 19.91 28.76 27.665 23.665 105-109 20.830000000000002 28.110000000000003 27.165 23.895 110-114 20.445 28.035 27.91 23.61 115-119 20.61 27.500000000000004 28.16 23.73 120-124 20.89 28.18 27.245 23.685000000000002 125-129 20.64 28.425 27.05 23.885 130-134 20.815 28.265 26.974999999999998 23.945 135-139 20.29 28.43 27.644999999999996 23.635 140-144 20.68 27.675 27.29 24.355 145-149 20.46 28.13 27.384999999999998 24.025 150-151 20.5875 28.3625 27.1125 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.0 24 1.5 25 1.0 26 4.0 27 7.5 28 6.5 29 10.0 30 17.0 31 23.0 32 32.0 33 43.0 34 56.0 35 67.5 36 83.5 37 114.5 38 147.5 39 170.0 40 194.5 41 208.5 42 221.0 43 260.0 44 278.5 45 271.5 46 266.0 47 253.0 48 242.0 49 215.0 50 170.5 51 135.5 52 116.0 53 94.5 54 74.0 55 59.5 56 44.5 57 31.0 58 19.0 59 14.5 60 11.0 61 7.5 62 5.0 63 3.5 64 3.0 65 3.0 66 2.0 67 0.5 68 1.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.4875 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.675 0.0 0.0 0.0 0.0 130-131 0.75 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 0.9624999999999999 0.0 0.0 0.0 0.0 136-137 1.0375 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATAGTC 10 0.006836113 144.9625 4 >>END_MODULE SRR7169076 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169076_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91125 33.0 33.0 34.0 32.0 34.0 2 32.92525 34.0 33.0 34.0 32.0 34.0 3 32.969 34.0 33.0 34.0 32.0 34.0 4 32.721 34.0 33.0 34.0 32.0 34.0 5 32.98325 34.0 33.0 34.0 32.0 34.0 6 37.02825 38.0 38.0 38.0 37.0 38.0 7 37.2325 38.0 38.0 38.0 37.0 38.0 8 37.15525 38.0 38.0 38.0 37.0 38.0 9 37.0295 38.0 38.0 38.0 36.0 38.0 10-14 36.95515 38.0 38.0 38.0 36.4 38.0 15-19 37.083099999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.021499999999996 38.0 38.0 38.0 36.4 38.0 25-29 36.9899 38.0 38.0 38.0 36.4 38.0 30-34 37.04305 38.0 38.0 38.0 37.0 38.0 35-39 36.88615 38.0 38.0 38.0 36.0 38.0 40-44 36.7428 38.0 38.0 38.0 35.6 38.0 45-49 36.83515 38.0 38.0 38.0 36.0 38.0 50-54 36.9109 38.0 38.0 38.0 36.0 38.0 55-59 36.894000000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.737049999999996 38.0 38.0 38.0 35.2 38.0 65-69 36.744299999999996 38.0 38.0 38.0 35.6 38.0 70-74 36.64075 38.0 38.0 38.0 35.0 38.0 75-79 36.50404999999999 38.0 38.0 38.0 34.4 38.0 80-84 36.43075 38.0 38.0 38.0 34.4 38.0 85-89 36.34975 38.0 38.0 38.0 33.8 38.0 90-94 36.14125 38.0 38.0 38.0 33.6 38.0 95-99 36.3566 38.0 38.0 38.0 34.0 38.0 100-104 36.12794999999999 38.0 38.0 38.0 34.0 38.0 105-109 35.97955 38.0 37.8 38.0 33.2 38.0 110-114 35.632850000000005 38.0 37.0 38.0 31.4 38.0 115-119 35.50865 38.0 37.0 38.0 30.6 38.0 120-124 35.45725 38.0 37.0 38.0 30.8 38.0 125-129 35.01535 38.0 36.0 38.0 28.2 38.0 130-134 34.6793 38.0 35.6 38.0 26.0 38.0 135-139 34.447100000000006 38.0 35.2 38.0 24.8 38.0 140-144 34.2318 38.0 35.0 38.0 23.6 38.0 145-149 33.705400000000004 38.0 34.8 38.0 21.8 38.0 150-151 30.05775 36.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 3.0 6 0.0 7 3.0 8 0.0 9 1.0 10 0.0 11 3.0 12 1.0 13 2.0 14 6.0 15 5.0 16 7.0 17 6.0 18 4.0 19 6.0 20 3.0 21 5.0 22 11.0 23 13.0 24 14.0 25 21.0 26 17.0 27 32.0 28 39.0 29 49.0 30 50.0 31 67.0 32 69.0 33 101.0 34 136.0 35 235.0 36 492.0 37 2592.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.974999999999994 21.975 13.775 26.275 2 27.831957989497376 26.63165791447862 29.657414353588397 15.878969742435608 3 19.86986986986987 28.47847847847848 31.73173173173173 19.91991991991992 4 22.52252252252252 34.434434434434436 23.723723723723726 19.31931931931932 5 24.706176544136035 34.83370842710677 22.83070767691923 17.62940735183796 6 21.25 35.975 24.099999999999998 18.675 7 21.175 21.8 37.724999999999994 19.3 8 20.95 26.75 26.85 25.45 9 21.8 24.45 30.625000000000004 23.125 10-14 23.185 28.105000000000004 27.389999999999997 21.32 15-19 23.265 27.755000000000003 27.955000000000002 21.025 20-24 23.0 28.535 27.810000000000002 20.655 25-29 23.035 27.915 27.779999999999998 21.27 30-34 22.770000000000003 27.955000000000002 28.325 20.95 35-39 22.67 28.27 27.644999999999996 21.415 40-44 23.035 27.534999999999997 27.925 21.505 45-49 23.51 27.73 27.925 20.835 50-54 23.189999999999998 27.87 27.994999999999997 20.945 55-59 23.43 27.950000000000003 27.855 20.765 60-64 23.395 27.665 28.634999999999998 20.305 65-69 23.165 28.335 28.03 20.47 70-74 23.61 27.615000000000002 27.805000000000003 20.97 75-79 23.23 27.42 28.33 21.02 80-84 22.74 28.21 28.095 20.955 85-89 23.755000000000003 27.605 27.76 20.880000000000003 90-94 23.01 27.689999999999998 28.199999999999996 21.099999999999998 95-99 23.535 27.41 28.04 21.015 100-104 23.485 27.265 28.060000000000002 21.19 105-109 23.84 27.355 27.939999999999998 20.865000000000002 110-114 23.200000000000003 27.994999999999997 27.685 21.12 115-119 24.37 27.339999999999996 27.925 20.365 120-124 23.48 27.615000000000002 28.335 20.57 125-129 23.919999999999998 27.800000000000004 27.965 20.315 130-134 24.165 28.000000000000004 27.150000000000002 20.685000000000002 135-139 23.715 27.935 27.505000000000003 20.845 140-144 23.985 27.595 27.915 20.505000000000003 145-149 24.34 27.465 27.49 20.705000000000002 150-151 23.8875 27.1625 28.199999999999996 20.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 1.5 25 1.5 26 2.0 27 3.0 28 4.0 29 9.0 30 12.0 31 15.0 32 25.5 33 29.5 34 36.5 35 62.5 36 78.0 37 101.0 38 141.5 39 170.5 40 197.5 41 233.5 42 258.0 43 269.5 44 284.5 45 283.0 46 285.0 47 276.0 48 241.5 49 209.0 50 174.0 51 145.5 52 116.0 53 85.5 54 63.0 55 48.0 56 35.5 57 22.0 58 19.0 59 14.5 60 10.0 61 8.0 62 6.0 63 5.0 64 3.0 65 2.5 66 1.5 67 1.5 68 1.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.1 4 0.1 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.9125 0.0 0.0 0.0 0.0 134-135 0.9875 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138-139 1.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGT 10 0.006830828 145.0 4 >>END_MODULE Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879368 spots for SRR7169076.sra Written 879368 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra Read 879350 spots for SRR7169076.sra Written 879350 spots for SRR7169076.sra SRR ids: ['SRR7169076.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vpk1k735 SRR7169076.sra spots: 17587018 blocks: [[1, 879350], [879351, 1758700], [1758701, 2638050], [2638051, 3517400], [3517401, 4396750], [4396751, 5276100], [5276101, 6155450], [6155451, 7034800], [7034801, 7914150], [7914151, 8793500], [8793501, 9672850], [9672851, 10552200], [10552201, 11431550], [11431551, 12310900], [12310901, 13190250], [13190251, 14069600], [14069601, 14948950], [14948951, 15828300], [15828301, 16707650], [16707651, 17587018]] SRR7169076 file size 5937962 SRR7169076 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169076 SRR7169076_1.fastq SRR7169076_2.fastq Input file: SRR7169076_1.fastq Paired file: SRR7169076_2.fastq trimmed: SRR7169076-trimmed-pair1.fastq, SRR7169076-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:51:24 2025 >> started Mon Feb 10 19:51:50 2025 >> done (25.623s) 17587018 read pairs processed; of these: 15596 ( 0.09%) short read pairs filtered out after trimming by size control 18806 ( 0.11%) empty read pairs filtered out after trimming by size control 17552616 (99.80%) read pairs available; of these: 7501593 (42.74%) trimmed read pairs available after processing 10051023 (57.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 6 0.00% 21 3 0.00% 22 5 0.00% 23 7 0.00% 24 2 0.00% 25 8 0.00% 26 5 0.00% 27 6 0.00% 28 10 0.00% 29 1 0.00% 30 8 0.00% 31 10 0.00% 32 8 0.00% 33 5 0.00% 34 4 0.00% 35 11 0.00% 36 8 0.00% 37 6 0.00% 38 9 0.00% 39 11 0.00% 40 14 0.00% 41 11 0.00% 42 8 0.00% 43 12 0.00% 44 14 0.00% 45 22 0.00% 46 19 0.00% 47 18 0.00% 48 22 0.00% 49 17 0.00% 50 33 0.00% 51 32 0.00% 52 32 0.00% 53 25 0.00% 54 38 0.00% 55 42 0.00% 56 36 0.00% 57 52 0.00% 58 62 0.00% 59 41 0.00% 60 62 0.00% 61 68 0.00% 62 96 0.00% 63 76 0.00% 64 121 0.00% 65 120 0.00% 66 136 0.00% 67 126 0.00% 68 160 0.00% 69 189 0.00% 70 236 0.00% 71 208 0.00% 72 209 0.00% 73 274 0.00% 74 311 0.00% 75 294 0.00% 76 369 0.00% 77 395 0.00% 78 442 0.00% 79 509 0.00% 80 573 0.00% 81 650 0.00% 82 816 0.00% 83 924 0.01% 84 1652 0.01% 85 2214 0.01% 86 2260 0.01% 87 2446 0.01% 88 2539 0.01% 89 2557 0.01% 90 2697 0.02% 91 2851 0.02% 92 3007 0.02% 93 3142 0.02% 94 3330 0.02% 95 3540 0.02% 96 3692 0.02% 97 3929 0.02% 98 4161 0.02% 99 4410 0.03% 100 4723 0.03% 101 5013 0.03% 102 5309 0.03% 103 5744 0.03% 104 6040 0.03% 105 6344 0.04% 106 6954 0.04% 107 7332 0.04% 108 7934 0.05% 109 8036 0.05% 110 8560 0.05% 111 9196 0.05% 112 9820 0.06% 113 10382 0.06% 114 11282 0.06% 115 11981 0.07% 116 12554 0.07% 117 13735 0.08% 118 14208 0.08% 119 14908 0.08% 120 15446 0.09% 121 16484 0.09% 122 17408 0.10% 123 18804 0.11% 124 19784 0.11% 125 21466 0.12% 126 23307 0.13% 127 25017 0.14% 128 26379 0.15% 129 28183 0.16% 130 30045 0.17% 131 32230 0.18% 132 34993 0.20% 133 37641 0.21% 134 40855 0.23% 135 44375 0.25% 136 48981 0.28% 137 53570 0.31% 138 59024 0.34% 139 64831 0.37% 140 71726 0.41% 141 80375 0.46% 142 91780 0.52% 143 107421 0.61% 144 128563 0.73% 145 155852 0.89% 146 201882 1.15% 147 278747 1.59% 148 433053 2.47% 149 846462 4.82% 150 4210367 23.99% 151 10051023 57.26% 17552616 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=252.19 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=40 prefix-density=0.33 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=226.25 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=25.4 sequence=GAAGAAGAAGAAA SRR7169076 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:52:34 Started mapping on | Feb 10 19:52:34 Finished on | Feb 10 19:54:31 Mapping speed, Million of reads per hour | 540.08 Number of input reads | 17552616 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16769514 Uniquely mapped reads % | 95.54% Average mapped length | 297.22 Number of splices: Total | 16400345 Number of splices: Annotated (sjdb) | 16131515 Number of splices: GT/AG | 16163373 Number of splices: GC/AG | 190710 Number of splices: AT/AC | 13777 Number of splices: Non-canonical | 32485 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287241 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 18004 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 513122 513122 513122 N_multimapping 287241 287241 287241 N_noFeature 400582 16573146 500269 N_ambiguous 168297 934 70969 UnstrandedReadsAssigned:16200635 PositiveStrandReadsAssigned:195434 NegativeStrandReadsAssigned:16198276 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169076 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169076-trimmed-pair1.fastq SRR7169076-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,552,616 reads, 16,067,332 reads pseudoaligned [quant] estimated average fragment length: 277.955 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR7169076.ke.tsv 34699 SRR7169076.se.tsv 87100 total ==> SRR7169076.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.04 336 11.2428 Potri.005G024800.1.v4.1 1035 758.045 37 2.84351 Potri.004G059700.1.v4.1 961 684.094 7 0.596114 Potri.007G009000.2.v4.1 1416 1139.04 0 0 Potri.003G141000.2.v4.1 2943 2666.04 336.066 7.34351 Potri.016G087400.1.v4.1 270 60.6978 1551 1488.63 Potri.015G069301.1.v4.1 564 295.472 0 0 Potri.010G195200.1.v4.1 1773 1496.04 19 0.739871 Potri.012G127500.1.v4.1 977 700.073 5190 431.888 ==> SRR7169076.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1291 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169076 completed mapping pipeline successfully