Starting /dee2/code/volunteer_pipeline.sh SRR7169077 current disk space = 3057017933824 free memory = 955613676 SRR7169077 SRAfilesize 78cb68c00505f74ce85e1f883324ad32 SRR7169077.sra SRR7169077.sra file validated SRR7169077 is paired end SRR7169077 is conventional basespace SRR7169077 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169077_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.099 34.0 33.0 34.0 33.0 34.0 2 33.415 34.0 34.0 34.0 33.0 34.0 3 33.458 34.0 34.0 34.0 33.0 34.0 4 33.45825 34.0 34.0 34.0 33.0 34.0 5 33.5065 34.0 34.0 34.0 33.0 34.0 6 37.04675 38.0 37.0 38.0 36.0 38.0 7 37.39325 38.0 38.0 38.0 37.0 38.0 8 37.4675 38.0 38.0 38.0 37.0 38.0 9 37.53575 38.0 38.0 38.0 38.0 38.0 10-14 37.540949999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.5071 38.0 38.0 38.0 38.0 38.0 20-24 37.46730000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.38975 38.0 38.0 38.0 37.0 38.0 30-34 37.38205 38.0 38.0 38.0 37.2 38.0 35-39 37.295 38.0 38.0 38.0 37.0 38.0 40-44 37.10315000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.9758 38.0 38.0 38.0 36.0 38.0 50-54 36.89805 38.0 38.0 38.0 35.6 38.0 55-59 36.8047 38.0 38.0 38.0 35.0 38.0 60-64 36.6234 38.0 38.0 38.0 34.4 38.0 65-69 36.57515 38.0 38.0 38.0 34.0 38.0 70-74 36.51715 38.0 38.0 38.0 34.0 38.0 75-79 36.3433 38.0 38.0 38.0 33.8 38.0 80-84 36.220150000000004 38.0 37.8 38.0 33.8 38.0 85-89 36.0483 38.0 37.2 38.0 33.0 38.0 90-94 35.9057 38.0 37.0 38.0 32.0 38.0 95-99 35.7928 38.0 37.0 38.0 32.0 38.0 100-104 35.5971 38.0 37.0 38.0 30.6 38.0 105-109 35.5241 38.0 36.8 38.0 30.6 38.0 110-114 35.18965 38.0 36.0 38.0 28.6 38.0 115-119 34.8463 38.0 35.8 38.0 27.4 38.0 120-124 34.6734 38.0 35.2 38.0 27.2 38.0 125-129 34.3608 38.0 35.0 38.0 24.8 38.0 130-134 33.94575 38.0 34.8 38.0 22.6 38.0 135-139 33.42105 38.0 34.0 38.0 18.6 38.0 140-144 33.03045 38.0 34.0 38.0 14.8 38.0 145-149 32.2438 38.0 33.4 38.0 11.4 38.0 150-151 28.569875000000003 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 0.0 9 2.0 10 1.0 11 1.0 12 4.0 13 2.0 14 2.0 15 5.0 16 0.0 17 5.0 18 7.0 19 6.0 20 6.0 21 12.0 22 10.0 23 18.0 24 17.0 25 19.0 26 24.0 27 35.0 28 34.0 29 52.0 30 58.0 31 67.0 32 94.0 33 98.0 34 169.0 35 312.0 36 814.0 37 2122.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.34378159757331 14.661274014155712 10.970677451971689 34.02426693629929 2 23.775 14.075 30.8 31.35 3 19.475 18.475 26.224999999999998 35.825 4 22.05 24.125 23.45 30.375000000000004 5 22.400000000000002 30.025000000000002 22.725 24.85 6 22.125 33.375 23.525 20.974999999999998 7 15.6 30.125 37.925 16.35 8 17.9 29.475 29.25 23.375 9 16.85 26.450000000000003 32.7 24.0 10-14 18.705 31.075000000000003 27.36 22.86 15-19 19.575 29.304999999999996 28.015 23.105 20-24 19.375 29.299999999999997 27.905 23.419999999999998 25-29 20.13 29.475 26.93 23.465 30-34 19.825 29.744999999999997 26.924999999999997 23.505000000000003 35-39 19.785 30.17 26.565 23.48 40-44 19.950000000000003 29.470000000000002 26.61 23.97 45-49 20.86 29.68 26.795 22.665 50-54 19.84 30.11 26.924999999999997 23.125 55-59 19.17 29.330000000000002 26.805 24.695 60-64 20.16 28.860000000000003 27.529999999999998 23.45 65-69 19.82 29.325000000000003 27.525 23.330000000000002 70-74 20.385 29.34 26.900000000000002 23.375 75-79 20.474999999999998 28.754999999999995 26.865 23.905 80-84 19.830000000000002 29.409999999999997 27.11 23.65 85-89 20.244999999999997 29.04 26.83 23.885 90-94 21.14 28.835 27.005000000000003 23.02 95-99 20.21 28.775000000000002 27.01 24.005000000000003 100-104 21.044999999999998 29.085 26.474999999999998 23.395 105-109 20.48 28.655 26.86 24.005000000000003 110-114 20.16 28.515 27.35 23.974999999999998 115-119 20.445 28.549999999999997 26.939999999999998 24.065 120-124 20.84 28.79 26.875 23.494999999999997 125-129 20.14 28.775000000000002 27.1 23.985 130-134 20.285 28.389999999999997 27.089999999999996 24.235 135-139 20.505000000000003 28.37 26.715 24.41 140-144 20.53 27.884999999999998 27.365000000000002 24.22 145-149 21.2 28.07 26.655 24.075 150-151 22.0125 27.3875 27.200000000000003 23.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.5 20 2.5 21 2.5 22 2.0 23 2.0 24 2.5 25 3.5 26 4.0 27 10.5 28 17.0 29 16.0 30 26.5 31 36.5 32 41.5 33 49.5 34 58.0 35 75.5 36 101.0 37 123.0 38 140.5 39 164.5 40 186.0 41 197.0 42 196.0 43 216.5 44 259.0 45 261.5 46 252.0 47 255.5 48 237.0 49 203.5 50 167.5 51 139.0 52 115.5 53 90.0 54 77.5 55 68.5 56 52.5 57 36.5 58 23.0 59 14.0 60 12.5 61 14.5 62 12.5 63 10.0 64 8.0 65 4.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.6043817678166709 1.2 3 0.02518257365902795 0.075 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.4625 0.0 0.0 0.0 0.0 136-137 1.5125 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACGA 10 0.006830828 145.0 145 CGACTTC 10 0.006830828 145.0 145 ACAACTC 10 0.006830828 145.0 145 >>END_MODULE SRR7169077 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169077_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6845 33.0 33.0 34.0 32.0 34.0 2 32.80125 33.0 33.0 34.0 32.0 34.0 3 32.856 34.0 33.0 34.0 32.0 34.0 4 32.6975 34.0 33.0 34.0 32.0 34.0 5 32.8195 34.0 33.0 34.0 32.0 34.0 6 36.87875 38.0 38.0 38.0 36.0 38.0 7 36.89175 38.0 38.0 38.0 36.0 38.0 8 36.81725 38.0 38.0 38.0 36.0 38.0 9 36.91575 38.0 38.0 38.0 36.0 38.0 10-14 36.88125 38.0 38.0 38.0 36.2 38.0 15-19 36.78885 38.0 38.0 38.0 36.0 38.0 20-24 36.77955 38.0 38.0 38.0 36.0 38.0 25-29 36.8411 38.0 38.0 38.0 36.2 38.0 30-34 36.8163 38.0 38.0 38.0 36.0 38.0 35-39 36.72435 38.0 38.0 38.0 36.0 38.0 40-44 36.6935 38.0 38.0 38.0 35.8 38.0 45-49 36.6335 38.0 38.0 38.0 35.8 38.0 50-54 36.67825 38.0 38.0 38.0 36.0 38.0 55-59 36.652550000000005 38.0 38.0 38.0 35.6 38.0 60-64 36.6177 38.0 38.0 38.0 35.8 38.0 65-69 36.49345 38.0 38.0 38.0 35.0 38.0 70-74 36.3649 38.0 38.0 38.0 35.0 38.0 75-79 36.311150000000005 38.0 38.0 38.0 34.2 38.0 80-84 36.3378 38.0 38.0 38.0 34.0 38.0 85-89 36.3195 38.0 38.0 38.0 34.0 38.0 90-94 36.202749999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.05585 38.0 38.0 38.0 33.6 38.0 100-104 35.90525 38.0 38.0 38.0 33.0 38.0 105-109 35.8578 38.0 38.0 38.0 33.0 38.0 110-114 35.6719 38.0 38.0 38.0 31.8 38.0 115-119 35.5521 38.0 37.6 38.0 31.2 38.0 120-124 35.20485000000001 38.0 37.0 38.0 28.6 38.0 125-129 35.1426 38.0 36.8 38.0 29.4 38.0 130-134 34.783249999999995 38.0 36.0 38.0 27.6 38.0 135-139 34.3472 38.0 35.8 38.0 23.8 38.0 140-144 34.029700000000005 38.0 35.4 38.0 22.2 38.0 145-149 33.09335 38.0 35.0 38.0 14.0 38.0 150-151 29.706249999999997 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 4.0 4 4.0 5 1.0 6 4.0 7 1.0 8 0.0 9 0.0 10 2.0 11 2.0 12 3.0 13 3.0 14 4.0 15 6.0 16 7.0 17 3.0 18 1.0 19 16.0 20 9.0 21 11.0 22 4.0 23 16.0 24 18.0 25 31.0 26 20.0 27 39.0 28 42.0 29 37.0 30 52.0 31 56.0 32 73.0 33 93.0 34 126.0 35 178.0 36 415.0 37 2704.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.800000000000004 23.150000000000002 16.35 26.700000000000003 2 28.4 27.474999999999998 25.8 18.325 3 20.375 29.099999999999998 30.599999999999998 19.925 4 23.825 34.425 22.025 19.725 5 24.525 34.949999999999996 22.5 18.025 6 21.825 36.575 22.325 19.275000000000002 7 20.275000000000002 22.775000000000002 37.974999999999994 18.975 8 23.1 25.575 26.3 25.025 9 22.0 26.200000000000003 28.999999999999996 22.8 10-14 24.465 28.275 25.540000000000003 21.72 15-19 23.895 27.145000000000003 27.07 21.89 20-24 24.165 28.315 26.474999999999998 21.044999999999998 25-29 23.705000000000002 28.134999999999998 27.084999999999997 21.075 30-34 23.724999999999998 27.76 27.02 21.495 35-39 24.279999999999998 27.465 27.02 21.235 40-44 23.945 27.61 27.295 21.15 45-49 23.419999999999998 27.46 27.465 21.654999999999998 50-54 24.275 27.884999999999998 26.93 20.91 55-59 23.985 27.944999999999997 27.150000000000002 20.919999999999998 60-64 24.245 27.744999999999997 27.439999999999998 20.57 65-69 23.7866024869635 28.123746490172486 27.196149217809868 20.89350180505415 70-74 23.91686329635022 26.95416436568101 28.00341382599528 21.125558511973495 75-79 24.177037334403852 27.353472501003612 27.298273785628265 21.17121637896427 80-84 24.056202810140505 27.30636531826591 27.94139706985349 20.696034801740087 85-89 24.035 27.265 27.584999999999997 21.115000000000002 90-94 24.104999999999997 27.295 27.860000000000003 20.74 95-99 24.14 27.13 28.115000000000002 20.615 100-104 23.76 28.035 27.284999999999997 20.919999999999998 105-109 23.66 27.474999999999998 27.63 21.235 110-114 24.185000000000002 27.07 28.084999999999997 20.66 115-119 23.565 27.765 28.265 20.405 120-124 23.919999999999998 27.855 27.815 20.41 125-129 24.27 27.465 27.455000000000002 20.810000000000002 130-134 24.565 27.439999999999998 27.794999999999998 20.200000000000003 135-139 24.44611152788197 27.136784196049014 27.47686921730433 20.940235058764692 140-144 23.36570227249975 28.65652217439183 27.6504154570027 20.327360096105714 145-149 24.594200713603698 27.34308256696316 27.458666264636417 20.604050454796724 150-151 24.087131704860237 27.13422311760262 28.51926466884916 20.25938050868799 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 0.5 27 0.5 28 2.5 29 3.5 30 4.5 31 8.0 32 16.5 33 25.0 34 33.5 35 38.0 36 50.0 37 82.5 38 114.5 39 144.0 40 179.5 41 225.5 42 255.0 43 261.5 44 263.0 45 287.0 46 291.0 47 268.0 48 269.5 49 232.5 50 198.5 51 169.5 52 128.5 53 107.5 54 82.0 55 62.5 56 58.5 57 43.0 58 23.0 59 18.0 60 14.0 61 11.5 62 6.0 63 4.0 64 3.0 65 2.0 66 2.0 67 3.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.27999999999999997 70-74 0.40499999999999997 75-79 0.36 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.025 140-144 0.11 145-149 0.505 150-151 0.7250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138-139 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGTTT 10 0.006830828 145.0 1 AAAGTAC 10 0.006830828 145.0 4 >>END_MODULE Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733447 spots for SRR7169077.sra Written 733447 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra Read 733443 spots for SRR7169077.sra Written 733443 spots for SRR7169077.sra SRR ids: ['SRR7169077.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xtk65t14 SRR7169077.sra spots: 14668864 blocks: [[1, 733443], [733444, 1466886], [1466887, 2200329], [2200330, 2933772], [2933773, 3667215], [3667216, 4400658], [4400659, 5134101], [5134102, 5867544], [5867545, 6600987], [6600988, 7334430], [7334431, 8067873], [8067874, 8801316], [8801317, 9534759], [9534760, 10268202], [10268203, 11001645], [11001646, 11735088], [11735089, 12468531], [12468532, 13201974], [13201975, 13935417], [13935418, 14668864]] SRR7169077 file size 4949096 SRR7169077 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169077 SRR7169077_1.fastq SRR7169077_2.fastq Input file: SRR7169077_1.fastq Paired file: SRR7169077_2.fastq trimmed: SRR7169077-trimmed-pair1.fastq, SRR7169077-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:12:35 2025 >> started Mon Feb 10 19:12:51 2025 >> done (15.459s) 14668864 read pairs processed; of these: 19223 ( 0.13%) short read pairs filtered out after trimming by size control 17470 ( 0.12%) empty read pairs filtered out after trimming by size control 14632171 (99.75%) read pairs available; of these: 6406515 (43.78%) trimmed read pairs available after processing 8225656 (56.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 5 0.00% 21 2 0.00% 22 9 0.00% 23 8 0.00% 24 8 0.00% 25 7 0.00% 26 9 0.00% 27 10 0.00% 28 6 0.00% 29 8 0.00% 30 13 0.00% 31 10 0.00% 32 7 0.00% 33 10 0.00% 34 16 0.00% 35 11 0.00% 36 9 0.00% 37 15 0.00% 38 12 0.00% 39 10 0.00% 40 16 0.00% 41 15 0.00% 42 23 0.00% 43 27 0.00% 44 23 0.00% 45 23 0.00% 46 30 0.00% 47 29 0.00% 48 37 0.00% 49 36 0.00% 50 52 0.00% 51 36 0.00% 52 63 0.00% 53 50 0.00% 54 61 0.00% 55 57 0.00% 56 77 0.00% 57 85 0.00% 58 74 0.00% 59 91 0.00% 60 98 0.00% 61 104 0.00% 62 111 0.00% 63 128 0.00% 64 149 0.00% 65 141 0.00% 66 158 0.00% 67 190 0.00% 68 233 0.00% 69 235 0.00% 70 276 0.00% 71 285 0.00% 72 304 0.00% 73 345 0.00% 74 351 0.00% 75 412 0.00% 76 467 0.00% 77 489 0.00% 78 546 0.00% 79 597 0.00% 80 726 0.00% 81 775 0.01% 82 881 0.01% 83 1097 0.01% 84 1875 0.01% 85 2537 0.02% 86 2706 0.02% 87 2778 0.02% 88 3068 0.02% 89 3102 0.02% 90 3208 0.02% 91 3218 0.02% 92 3441 0.02% 93 3536 0.02% 94 3756 0.03% 95 4020 0.03% 96 4191 0.03% 97 4551 0.03% 98 4845 0.03% 99 4998 0.03% 100 5464 0.04% 101 5674 0.04% 102 6104 0.04% 103 6581 0.04% 104 7110 0.05% 105 7651 0.05% 106 8092 0.06% 107 8607 0.06% 108 9060 0.06% 109 9738 0.07% 110 10164 0.07% 111 10714 0.07% 112 11239 0.08% 113 12084 0.08% 114 12650 0.09% 115 13282 0.09% 116 13964 0.10% 117 14980 0.10% 118 15511 0.11% 119 16544 0.11% 120 17388 0.12% 121 18001 0.12% 122 19214 0.13% 123 20194 0.14% 124 21622 0.15% 125 22879 0.16% 126 24531 0.17% 127 26120 0.18% 128 27832 0.19% 129 29663 0.20% 130 31152 0.21% 131 33228 0.23% 132 35244 0.24% 133 38038 0.26% 134 40851 0.28% 135 43847 0.30% 136 47207 0.32% 137 52153 0.36% 138 57608 0.39% 139 62869 0.43% 140 68391 0.47% 141 75216 0.51% 142 84111 0.57% 143 94824 0.65% 144 110547 0.76% 145 133342 0.91% 146 168263 1.15% 147 228749 1.56% 148 356790 2.44% 149 712889 4.87% 150 3432515 23.46% 151 8225656 56.22% 14632171 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=43 prefix-density=0.34 prefix-fanout=2.0 sequence=GTTTATAAGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=46 fanout-score=37.93 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.3 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=7.09 fanout-score-rank=17 prefix-density=0.29 prefix-fanout=4.8 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=34 fanout-score=26.21 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.7 sequence=GAGGCTGCTTTGAGAGAGGG SRR7169077 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:13:37 Started mapping on | Feb 10 19:13:37 Finished on | Feb 10 19:15:38 Mapping speed, Million of reads per hour | 435.34 Number of input reads | 14632171 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13297373 Uniquely mapped reads % | 90.88% Average mapped length | 296.31 Number of splices: Total | 11274264 Number of splices: Annotated (sjdb) | 11078867 Number of splices: GT/AG | 11119382 Number of splices: GC/AG | 119416 Number of splices: AT/AC | 9929 Number of splices: Non-canonical | 25537 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272274 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 42348 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.92% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1082410 1082410 1082410 N_multimapping 272274 272274 272274 N_noFeature 245713 13092462 318572 N_ambiguous 187482 941 54772 UnstrandedReadsAssigned:12864178 PositiveStrandReadsAssigned:203970 NegativeStrandReadsAssigned:12924029 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169077 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169077-trimmed-pair1.fastq SRR7169077-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,632,171 reads, 12,901,821 reads pseudoaligned [quant] estimated average fragment length: 263.716 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7169077.ke.tsv 34699 SRR7169077.se.tsv 87100 total ==> SRR7169077.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.28 245.491 8.17765 Potri.005G024800.1.v4.1 1035 772.284 36 2.72563 Potri.004G059700.1.v4.1 961 698.307 1 0.0837326 Potri.007G009000.2.v4.1 1416 1153.28 0 0 Potri.003G141000.2.v4.1 2943 2680.28 200 4.36305 Potri.016G087400.1.v4.1 270 61.7772 1408.78 1333.39 Potri.015G069301.1.v4.1 564 304.851 0 0 Potri.010G195200.1.v4.1 1773 1510.28 10 0.387153 Potri.012G127500.1.v4.1 977 714.296 4408 360.831 ==> SRR7169077.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1319 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169077 completed mapping pipeline successfully