Starting /dee2/code/volunteer_pipeline.sh SRR7169078 current disk space = 3056413454336 free memory = 1532196980 SRR7169078 SRAfilesize 76cdc5bdc9a484eac5b490f277d19786 SRR7169078.sra SRR7169078.sra file validated SRR7169078 is paired end SRR7169078 is conventional basespace SRR7169078 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169078_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15575 34.0 33.0 34.0 33.0 34.0 2 33.49325 34.0 34.0 34.0 33.0 34.0 3 33.48575 34.0 34.0 34.0 33.0 34.0 4 33.548 34.0 34.0 34.0 33.0 34.0 5 33.54575 34.0 34.0 34.0 33.0 34.0 6 37.1835 38.0 38.0 38.0 36.0 38.0 7 37.47525 38.0 38.0 38.0 37.0 38.0 8 37.47675 38.0 38.0 38.0 37.0 38.0 9 37.54625 38.0 38.0 38.0 38.0 38.0 10-14 37.49665 38.0 38.0 38.0 37.8 38.0 15-19 37.481700000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.401599999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.380250000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.33895 38.0 38.0 38.0 37.0 38.0 35-39 37.2371 38.0 38.0 38.0 36.8 38.0 40-44 36.9316 38.0 38.0 38.0 35.6 38.0 45-49 36.82335 38.0 38.0 38.0 35.0 38.0 50-54 36.74249999999999 38.0 38.0 38.0 35.0 38.0 55-59 36.571299999999994 38.0 38.0 38.0 34.2 38.0 60-64 36.47950000000001 38.0 38.0 38.0 34.0 38.0 65-69 36.46485 38.0 38.0 38.0 34.0 38.0 70-74 36.40135 38.0 38.0 38.0 34.0 38.0 75-79 36.243399999999994 38.0 37.2 38.0 33.6 38.0 80-84 36.124449999999996 38.0 37.0 38.0 33.2 38.0 85-89 35.93045 38.0 37.0 38.0 32.0 38.0 90-94 35.681850000000004 38.0 37.0 38.0 31.0 38.0 95-99 35.5742 38.0 36.4 38.0 30.6 38.0 100-104 35.328450000000004 38.0 36.0 38.0 29.0 38.0 105-109 35.1547 38.0 36.0 38.0 28.8 38.0 110-114 34.9072 38.0 35.6 38.0 28.2 38.0 115-119 34.61775 38.0 35.0 38.0 26.6 38.0 120-124 34.29845 38.0 34.8 38.0 23.8 38.0 125-129 34.1295 38.0 34.8 38.0 23.6 38.0 130-134 33.61575 38.0 34.0 38.0 20.2 38.0 135-139 33.03975 38.0 33.6 38.0 15.0 38.0 140-144 32.200300000000006 37.2 32.6 38.0 14.0 38.0 145-149 31.411 36.2 31.8 38.0 11.2 38.0 150-151 27.33025 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 1.0 11 3.0 12 2.0 13 3.0 14 1.0 15 7.0 16 0.0 17 7.0 18 6.0 19 8.0 20 10.0 21 12.0 22 12.0 23 14.0 24 20.0 25 27.0 26 32.0 27 25.0 28 35.0 29 40.0 30 52.0 31 77.0 32 88.0 33 141.0 34 213.0 35 418.0 36 1020.0 37 1722.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.692093963122 14.624905279110886 10.002525890376358 34.68047486739076 2 24.2 15.075 30.925000000000004 29.799999999999997 3 19.075 18.45 26.5 35.975 4 21.975 25.5 25.25 27.275 5 23.35 29.5 24.6 22.55 6 20.75 33.85 23.5 21.9 7 16.025 29.325000000000003 39.1 15.55 8 17.0 28.025 30.95 24.025 9 17.175 25.4 33.6 23.825 10-14 19.830000000000002 31.06 27.529999999999998 21.58 15-19 19.585 29.82 27.18 23.415 20-24 19.3 29.565 27.975 23.16 25-29 19.475 29.759999999999998 27.18 23.585 30-34 19.595000000000002 30.14 26.99 23.275000000000002 35-39 19.505 29.695 26.900000000000002 23.9 40-44 20.235 29.03 27.889999999999997 22.845 45-49 20.195 29.080000000000002 27.295 23.43 50-54 19.975 29.365000000000002 26.97 23.69 55-59 19.72 28.945 27.315 24.02 60-64 20.165 29.599999999999998 26.834999999999997 23.400000000000002 65-69 20.119999999999997 29.74 26.91 23.23 70-74 20.04 28.645 27.305 24.01 75-79 19.71 29.189999999999998 26.8 24.3 80-84 20.275000000000002 28.645 26.979999999999997 24.099999999999998 85-89 20.474999999999998 28.860000000000003 27.485 23.18 90-94 20.275000000000002 28.76 27.455000000000002 23.51 95-99 19.725 28.285 27.650000000000002 24.34 100-104 20.54 28.975 26.71 23.775 105-109 20.575 28.560000000000002 27.465 23.400000000000002 110-114 20.595 28.244999999999997 27.01 24.15 115-119 20.330000000000002 28.384999999999998 27.425 23.86 120-124 20.225 28.525 26.634999999999998 24.615000000000002 125-129 20.555 28.21 27.400000000000002 23.835 130-134 20.755000000000003 27.93 27.534999999999997 23.78 135-139 21.16 28.07 26.845000000000002 23.925 140-144 20.979999999999997 28.410000000000004 26.845000000000002 23.765 145-149 21.055 28.255000000000003 26.86 23.830000000000002 150-151 21.75 28.000000000000004 26.775 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 2.0 21 2.5 22 2.0 23 3.0 24 3.5 25 5.0 26 8.5 27 9.5 28 12.0 29 18.5 30 34.0 31 41.5 32 38.5 33 45.0 34 62.0 35 79.5 36 97.5 37 120.5 38 142.0 39 156.0 40 175.0 41 206.0 42 221.5 43 240.0 44 244.5 45 247.0 46 267.0 47 251.5 48 212.5 49 190.5 50 169.5 51 139.5 52 115.5 53 97.0 54 85.0 55 67.0 56 49.5 57 34.5 58 26.0 59 18.5 60 11.5 61 9.5 62 9.5 63 8.0 64 3.5 65 4.0 66 2.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.7313997477931904 1.4500000000000002 3 0.0 0.0 4 0.05044136191677175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.11249999999999999 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.1125 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAATA 10 0.006832588 144.9875 2 CTTAATG 15 1.14152615E-4 144.9875 2 CCTTAAT 20 3.410428E-4 110.11709 1 >>END_MODULE SRR7169078 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169078_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8815 33.0 33.0 34.0 32.0 34.0 2 32.964 34.0 33.0 34.0 32.0 34.0 3 32.98425 34.0 33.0 34.0 32.0 34.0 4 32.97625 34.0 33.0 34.0 32.0 34.0 5 32.89925 34.0 33.0 34.0 32.0 34.0 6 37.08125 38.0 38.0 38.0 37.0 38.0 7 37.0995 38.0 38.0 38.0 37.0 38.0 8 37.16025 38.0 38.0 38.0 37.0 38.0 9 37.10975 38.0 38.0 38.0 37.0 38.0 10-14 37.04925 38.0 38.0 38.0 37.0 38.0 15-19 37.0302 38.0 38.0 38.0 37.0 38.0 20-24 37.0197 38.0 38.0 38.0 37.0 38.0 25-29 37.0055 38.0 38.0 38.0 37.0 38.0 30-34 36.9972 38.0 38.0 38.0 36.8 38.0 35-39 36.9447 38.0 38.0 38.0 36.4 38.0 40-44 36.908100000000005 38.0 38.0 38.0 36.4 38.0 45-49 36.9324 38.0 38.0 38.0 36.4 38.0 50-54 36.7965 38.0 38.0 38.0 36.0 38.0 55-59 36.8189 38.0 38.0 38.0 36.0 38.0 60-64 36.813399999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.7102 38.0 38.0 38.0 36.0 38.0 70-74 36.686249999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.55985 38.0 38.0 38.0 35.2 38.0 80-84 36.5343 38.0 38.0 38.0 35.0 38.0 85-89 36.4711 38.0 38.0 38.0 34.8 38.0 90-94 36.40535 38.0 38.0 38.0 34.2 38.0 95-99 36.313300000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.1169 38.0 38.0 38.0 33.6 38.0 105-109 35.9864 38.0 38.0 38.0 34.0 38.0 110-114 35.8529 38.0 38.0 38.0 33.4 38.0 115-119 35.660799999999995 38.0 38.0 38.0 32.2 38.0 120-124 35.412549999999996 38.0 37.0 38.0 31.0 38.0 125-129 35.163349999999994 38.0 36.8 38.0 29.2 38.0 130-134 35.0826 38.0 36.6 38.0 29.8 38.0 135-139 34.66955 38.0 36.0 38.0 27.4 38.0 140-144 34.1137 38.0 35.2 38.0 23.6 38.0 145-149 33.4663 38.0 35.0 38.0 18.2 38.0 150-151 30.333375 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 0.0 5 2.0 6 3.0 7 1.0 8 4.0 9 0.0 10 4.0 11 1.0 12 3.0 13 3.0 14 4.0 15 5.0 16 9.0 17 7.0 18 9.0 19 7.0 20 9.0 21 11.0 22 10.0 23 6.0 24 19.0 25 21.0 26 22.0 27 26.0 28 22.0 29 33.0 30 45.0 31 57.0 32 71.0 33 75.0 34 109.0 35 169.0 36 450.0 37 2773.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.35 22.675 15.45 25.525 2 29.95 26.025 25.424999999999997 18.6 3 20.525 29.799999999999997 30.15 19.525000000000002 4 24.25 32.525 24.575 18.65 5 24.725 35.025 21.15 19.1 6 20.549999999999997 36.1 23.275000000000002 20.075000000000003 7 22.15 22.85 35.725 19.275000000000002 8 22.900000000000002 26.325 25.924999999999997 24.85 9 20.925 26.825 30.049999999999997 22.2 10-14 24.13 28.29 26.119999999999997 21.46 15-19 23.599999999999998 27.83 27.41 21.16 20-24 23.535 28.17 26.69 21.605 25-29 24.02 27.42 27.145000000000003 21.415 30-34 23.435 28.194999999999997 27.43 20.94 35-39 24.169999999999998 28.29 26.700000000000003 20.84 40-44 24.07 27.744999999999997 27.12 21.065 45-49 23.595 27.365000000000002 27.725 21.315 50-54 23.05 27.915 27.74 21.295 55-59 24.36 27.11 27.744999999999997 20.785 60-64 23.375 27.61 28.199999999999996 20.815 65-69 23.953953953953956 27.392392392392395 27.637637637637635 21.016016016016014 70-74 24.333934294871796 27.569110576923077 27.478966346153843 20.617988782051285 75-79 23.942957217913435 27.690768076057044 27.47060295221416 20.89567175381536 80-84 23.965 27.794999999999998 27.07 21.17 85-89 24.175 27.445000000000004 27.365000000000002 21.015 90-94 23.78 28.084999999999997 27.595 20.54 95-99 23.745 27.395000000000003 27.425 21.435000000000002 100-104 24.16 27.13 27.66 21.05 105-109 23.965 27.715 27.794999999999998 20.525 110-114 23.585 27.22 27.800000000000004 21.395 115-119 24.255 27.77 27.439999999999998 20.535 120-124 23.52 27.195000000000004 28.71 20.575 125-129 23.985 27.689999999999998 27.815 20.51 130-134 24.26 27.865000000000002 27.794999999999998 20.080000000000002 135-139 24.292004403082156 27.599319523666566 27.499249474632244 20.60942659861903 140-144 24.11564284998497 27.778334502455156 27.277282292814913 20.828740354744966 145-149 24.03073523503415 28.108678184009644 27.295098433105665 20.56548814785054 150-151 24.30188679245283 27.358490566037734 27.748427672955977 20.59119496855346 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.0 25 1.5 26 3.5 27 4.0 28 2.0 29 1.5 30 9.5 31 16.0 32 17.5 33 23.5 34 32.0 35 42.0 36 59.0 37 77.5 38 94.0 39 131.0 40 183.5 41 220.5 42 247.0 43 287.0 44 324.5 45 316.0 46 274.5 47 248.5 48 231.5 49 214.5 50 202.0 51 162.5 52 125.5 53 108.0 54 90.5 55 71.5 56 52.0 57 37.5 58 23.0 59 16.5 60 11.5 61 9.0 62 7.5 63 5.0 64 3.5 65 3.5 66 2.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.1 70-74 0.16 75-79 0.075 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.06999999999999999 140-144 0.21 145-149 0.44 150-151 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.655241935483871 1.3 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.11249999999999999 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627052 spots for SRR7169078.sra Written 627052 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra Read 627049 spots for SRR7169078.sra Written 627049 spots for SRR7169078.sra SRR ids: ['SRR7169078.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5j7273qp SRR7169078.sra spots: 12540983 blocks: [[1, 627049], [627050, 1254098], [1254099, 1881147], [1881148, 2508196], [2508197, 3135245], [3135246, 3762294], [3762295, 4389343], [4389344, 5016392], [5016393, 5643441], [5643442, 6270490], [6270491, 6897539], [6897540, 7524588], [7524589, 8151637], [8151638, 8778686], [8778687, 9405735], [9405736, 10032784], [10032785, 10659833], [10659834, 11286882], [11286883, 11913931], [11913932, 12540983]] SRR7169078 file size 4228027 SRR7169078 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169078 SRR7169078_1.fastq SRR7169078_2.fastq Input file: SRR7169078_1.fastq Paired file: SRR7169078_2.fastq trimmed: SRR7169078-trimmed-pair1.fastq, SRR7169078-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:54:13 2025 >> started Mon Feb 10 19:54:45 2025 >> done (32.497s) 12540983 read pairs processed; of these: 14025 ( 0.11%) short read pairs filtered out after trimming by size control 12921 ( 0.10%) empty read pairs filtered out after trimming by size control 12514037 (99.79%) read pairs available; of these: 6363594 (50.85%) trimmed read pairs available after processing 6150443 (49.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 2 0.00% 22 9 0.00% 23 6 0.00% 24 5 0.00% 25 1 0.00% 26 4 0.00% 27 8 0.00% 28 5 0.00% 29 10 0.00% 30 9 0.00% 31 10 0.00% 32 16 0.00% 33 6 0.00% 34 6 0.00% 35 12 0.00% 36 4 0.00% 37 15 0.00% 38 9 0.00% 39 12 0.00% 40 11 0.00% 41 14 0.00% 42 15 0.00% 43 15 0.00% 44 23 0.00% 45 28 0.00% 46 19 0.00% 47 23 0.00% 48 25 0.00% 49 27 0.00% 50 33 0.00% 51 36 0.00% 52 39 0.00% 53 37 0.00% 54 44 0.00% 55 49 0.00% 56 75 0.00% 57 55 0.00% 58 64 0.00% 59 57 0.00% 60 72 0.00% 61 73 0.00% 62 94 0.00% 63 91 0.00% 64 104 0.00% 65 138 0.00% 66 119 0.00% 67 133 0.00% 68 187 0.00% 69 171 0.00% 70 196 0.00% 71 204 0.00% 72 231 0.00% 73 260 0.00% 74 305 0.00% 75 342 0.00% 76 347 0.00% 77 397 0.00% 78 475 0.00% 79 461 0.00% 80 599 0.00% 81 700 0.01% 82 718 0.01% 83 938 0.01% 84 1476 0.01% 85 1944 0.02% 86 2025 0.02% 87 2193 0.02% 88 2354 0.02% 89 2394 0.02% 90 2406 0.02% 91 2502 0.02% 92 2618 0.02% 93 2730 0.02% 94 2951 0.02% 95 3121 0.02% 96 3454 0.03% 97 3759 0.03% 98 4027 0.03% 99 4171 0.03% 100 4471 0.04% 101 4759 0.04% 102 4890 0.04% 103 5452 0.04% 104 5672 0.05% 105 6262 0.05% 106 6781 0.05% 107 7309 0.06% 108 7746 0.06% 109 8092 0.06% 110 8460 0.07% 111 8884 0.07% 112 9414 0.08% 113 10013 0.08% 114 10832 0.09% 115 11281 0.09% 116 12053 0.10% 117 12435 0.10% 118 13480 0.11% 119 13964 0.11% 120 14630 0.12% 121 15489 0.12% 122 16754 0.13% 123 17447 0.14% 124 18809 0.15% 125 20249 0.16% 126 21993 0.18% 127 23286 0.19% 128 24814 0.20% 129 26604 0.21% 130 28278 0.23% 131 30368 0.24% 132 32898 0.26% 133 35908 0.29% 134 38355 0.31% 135 41914 0.33% 136 46939 0.38% 137 50954 0.41% 138 56772 0.45% 139 63839 0.51% 140 70007 0.56% 141 78282 0.63% 142 90140 0.72% 143 102924 0.82% 144 122486 0.98% 145 149965 1.20% 146 194019 1.55% 147 272479 2.18% 148 424706 3.39% 149 814548 6.51% 150 3193158 25.52% 151 6150443 49.15% 12514037 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=92.83 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.4 sequence=AAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=41 prefix-density=0.27 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=21.52 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=7.7 sequence=GAGGCTGCTTTGAGAGAGGG SRR7169078 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:55:46 Started mapping on | Feb 10 19:55:46 Finished on | Feb 10 19:57:34 Mapping speed, Million of reads per hour | 417.13 Number of input reads | 12514037 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 10976989 Uniquely mapped reads % | 87.72% Average mapped length | 287.13 Number of splices: Total | 9453363 Number of splices: Annotated (sjdb) | 9296397 Number of splices: GT/AG | 9321319 Number of splices: GC/AG | 103289 Number of splices: AT/AC | 8399 Number of splices: Non-canonical | 20356 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 206166 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 15435 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.48% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1344352 1344352 1344352 N_multimapping 206166 206166 206166 N_noFeature 212762 10819109 268295 N_ambiguous 158094 1085 54933 UnstrandedReadsAssigned:10606133 PositiveStrandReadsAssigned:156795 NegativeStrandReadsAssigned:10653761 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169078 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169078-trimmed-pair1.fastq SRR7169078-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,514,037 reads, 10,896,864 reads pseudoaligned [quant] estimated average fragment length: 258.62 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR7169078.ke.tsv 34699 SRR7169078.se.tsv 87100 total ==> SRR7169078.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.38 201 8.88345 Potri.005G024800.1.v4.1 1035 777.38 19 1.90157 Potri.004G059700.1.v4.1 961 703.397 3 0.331827 Potri.007G009000.2.v4.1 1416 1158.38 0 0 Potri.003G141000.2.v4.1 2943 2685.38 167 4.83841 Potri.016G087400.1.v4.1 270 65.8859 1182 1395.78 Potri.015G069301.1.v4.1 564 310.588 0 0 Potri.010G195200.1.v4.1 1773 1515.38 12 0.6161 Potri.012G127500.1.v4.1 977 719.386 3862 417.679 ==> SRR7169078.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1027 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 129 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169078 completed mapping pipeline successfully