Starting /dee2/code/volunteer_pipeline.sh SRR7169079 current disk space = 3056520331264 free memory = 1098374920 SRR7169079 SRAfilesize db3f0f4804b833176813bf29b8592809 SRR7169079.sra SRR7169079.sra file validated SRR7169079 is paired end SRR7169079 is conventional basespace SRR7169079 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169079_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.974 34.0 33.0 34.0 33.0 34.0 2 33.36675 34.0 33.0 34.0 33.0 34.0 3 33.3595 34.0 33.0 34.0 33.0 34.0 4 33.432 34.0 33.0 34.0 33.0 34.0 5 33.45 34.0 33.0 34.0 33.0 34.0 6 36.977 38.0 37.0 38.0 36.0 38.0 7 37.32325 38.0 38.0 38.0 37.0 38.0 8 37.3495 38.0 38.0 38.0 37.0 38.0 9 37.4385 38.0 38.0 38.0 37.0 38.0 10-14 37.41700000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.402100000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.29015 38.0 38.0 38.0 36.8 38.0 25-29 37.2567 38.0 38.0 38.0 36.8 38.0 30-34 37.25415 38.0 38.0 38.0 36.8 38.0 35-39 37.064750000000004 38.0 38.0 38.0 36.2 38.0 40-44 37.008649999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.7847 38.0 38.0 38.0 34.8 38.0 50-54 36.719649999999994 38.0 38.0 38.0 34.6 38.0 55-59 36.630500000000005 38.0 38.0 38.0 34.4 38.0 60-64 36.7869 38.0 38.0 38.0 34.6 38.0 65-69 36.631899999999995 38.0 38.0 38.0 34.2 38.0 70-74 36.30414999999999 38.0 37.6 38.0 33.8 38.0 75-79 36.3528 38.0 37.4 38.0 33.8 38.0 80-84 35.84805 38.0 36.8 38.0 31.2 38.0 85-89 36.08315 38.0 37.0 38.0 33.0 38.0 90-94 35.9676 38.0 37.0 38.0 32.6 38.0 95-99 35.654399999999995 38.0 36.8 38.0 30.6 38.0 100-104 35.33815 38.0 36.0 38.0 29.4 38.0 105-109 34.800450000000005 38.0 35.2 38.0 26.4 38.0 110-114 34.8656 38.0 35.2 38.0 26.6 38.0 115-119 35.19365 38.0 35.8 38.0 28.6 38.0 120-124 34.3391 38.0 34.4 38.0 23.2 38.0 125-129 34.00265 38.0 34.0 38.0 22.6 38.0 130-134 34.00885 38.0 34.2 38.0 23.0 38.0 135-139 33.493399999999994 38.0 34.2 38.0 19.4 38.0 140-144 32.531 37.2 33.2 38.0 14.4 38.0 145-149 31.361250000000002 36.0 31.4 38.0 11.2 38.0 150-151 27.045749999999998 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 0.0 13 5.0 14 0.0 15 5.0 16 2.0 17 3.0 18 2.0 19 8.0 20 3.0 21 5.0 22 9.0 23 12.0 24 22.0 25 26.0 26 21.0 27 39.0 28 48.0 29 50.0 30 75.0 31 87.0 32 111.0 33 163.0 34 224.0 35 398.0 36 931.0 37 1749.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.99112351001776 12.198833375602334 9.256910981486179 33.55313213289374 2 22.075 15.1 33.800000000000004 29.025000000000002 3 17.8 19.475 27.675 35.05 4 22.95 27.950000000000003 24.15 24.95 5 22.25 32.1 24.825 20.825 6 20.525 34.55 25.1 19.825 7 14.649999999999999 28.349999999999998 39.425 17.575 8 18.45 25.324999999999996 31.624999999999996 24.6 9 16.8 24.65 32.9 25.650000000000002 10-14 19.93 29.38 27.065 23.625 15-19 19.78 28.62 28.03 23.57 20-24 20.244999999999997 28.65 27.46 23.645 25-29 19.445 29.345 27.54 23.669999999999998 30-34 19.64 28.785 27.76 23.815 35-39 19.96 29.095 27.36 23.585 40-44 20.06 29.049999999999997 27.134999999999998 23.755000000000003 45-49 20.315 28.62 26.884999999999998 24.18 50-54 20.115 28.475 27.445000000000004 23.965 55-59 20.53 28.384999999999998 27.83 23.255 60-64 20.26 28.22 27.694999999999997 23.825 65-69 20.03 28.7 27.145000000000003 24.125 70-74 20.595 28.585 27.41 23.41 75-79 20.375 28.32 27.615000000000002 23.69 80-84 20.369999999999997 28.46 27.595 23.575 85-89 20.97 29.175 26.650000000000002 23.205000000000002 90-94 19.86 28.449999999999996 27.38 24.310000000000002 95-99 20.455000000000002 28.645 27.355 23.544999999999998 100-104 20.560000000000002 28.470000000000002 27.450000000000003 23.52 105-109 20.31 28.435 27.284999999999997 23.97 110-114 20.375 28.444999999999997 27.555000000000003 23.625 115-119 20.77 28.77 27.189999999999998 23.27 120-124 21.279999999999998 28.095 27.165 23.46 125-129 20.835 28.18 27.565 23.419999999999998 130-134 20.845 28.075 27.139999999999997 23.94 135-139 20.59 28.405 26.91 24.095 140-144 20.775 28.4 26.935 23.89 145-149 20.765 27.845 27.76 23.630000000000003 150-151 21.3625 28.262500000000003 26.575 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 2.5 25 3.0 26 3.5 27 6.5 28 7.5 29 15.5 30 19.5 31 21.0 32 26.5 33 41.0 34 50.0 35 59.0 36 81.5 37 100.0 38 128.5 39 151.5 40 178.5 41 220.5 42 254.0 43 260.0 44 255.5 45 280.0 46 278.5 47 269.0 48 250.0 49 212.0 50 187.5 51 143.0 52 114.0 53 97.0 54 76.0 55 57.0 56 40.0 57 30.0 58 25.0 59 16.5 60 8.0 61 6.0 62 7.0 63 6.0 64 2.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.1749999999999998 0.0 0.0 0.0 0.0 136-137 1.3624999999999998 0.0 0.0 0.0 0.0 138-139 1.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGCA 10 0.006830828 145.0 9 AGCACTG 10 0.006830828 145.0 7 >>END_MODULE SRR7169079 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169079_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79525 33.0 33.0 34.0 32.0 34.0 2 32.83475 34.0 33.0 34.0 32.0 34.0 3 32.796 34.0 33.0 34.0 32.0 34.0 4 32.65475 34.0 33.0 34.0 32.0 34.0 5 32.89675 34.0 33.0 34.0 32.0 34.0 6 37.0345 38.0 38.0 38.0 36.0 38.0 7 37.0825 38.0 38.0 38.0 37.0 38.0 8 37.0295 38.0 38.0 38.0 37.0 38.0 9 36.928 38.0 38.0 38.0 36.0 38.0 10-14 36.8154 38.0 38.0 38.0 35.8 38.0 15-19 36.9452 38.0 38.0 38.0 36.2 38.0 20-24 36.86345 38.0 38.0 38.0 36.4 38.0 25-29 36.798700000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.8252 38.0 38.0 38.0 36.0 38.0 35-39 36.705200000000005 38.0 38.0 38.0 35.6 38.0 40-44 36.569599999999994 38.0 38.0 38.0 35.0 38.0 45-49 36.6853 38.0 38.0 38.0 35.6 38.0 50-54 36.75885 38.0 38.0 38.0 35.8 38.0 55-59 36.700050000000005 38.0 38.0 38.0 35.4 38.0 60-64 36.57785 38.0 38.0 38.0 35.2 38.0 65-69 36.59685 38.0 38.0 38.0 35.2 38.0 70-74 36.4668 38.0 38.0 38.0 34.6 38.0 75-79 36.330949999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.169050000000006 38.0 38.0 38.0 33.8 38.0 85-89 36.0839 38.0 38.0 38.0 33.4 38.0 90-94 35.893449999999994 38.0 37.8 38.0 32.4 38.0 95-99 36.0378 38.0 38.0 38.0 33.4 38.0 100-104 35.95605 38.0 37.8 38.0 33.2 38.0 105-109 35.73555 38.0 37.4 38.0 32.2 38.0 110-114 35.4889 38.0 37.0 38.0 30.6 38.0 115-119 35.321799999999996 38.0 37.0 38.0 29.4 38.0 120-124 35.1924 38.0 36.6 38.0 28.8 38.0 125-129 34.79344999999999 38.0 36.0 38.0 27.2 38.0 130-134 34.39965 38.0 35.2 38.0 24.2 38.0 135-139 34.182900000000004 38.0 35.0 38.0 23.2 38.0 140-144 33.932100000000005 38.0 35.0 38.0 21.6 38.0 145-149 33.29065000000001 38.0 34.8 38.0 15.8 38.0 150-151 29.853 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 4.0 5 3.0 6 3.0 7 2.0 8 1.0 9 1.0 10 5.0 11 2.0 12 1.0 13 4.0 14 6.0 15 4.0 16 4.0 17 7.0 18 8.0 19 9.0 20 9.0 21 9.0 22 14.0 23 17.0 24 18.0 25 13.0 26 24.0 27 30.0 28 30.0 29 27.0 30 51.0 31 69.0 32 82.0 33 108.0 34 149.0 35 241.0 36 554.0 37 2480.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.4 24.4 10.875 23.325000000000003 2 27.175 27.85 28.575 16.400000000000002 3 20.76038019009505 28.939469734867433 31.21560780390195 19.084542271135568 4 24.362181090545274 32.641320660330166 23.81190595297649 19.18459229614807 5 24.8 34.949999999999996 22.45 17.8 6 21.6 36.95 23.150000000000002 18.3 7 18.825 22.95 38.425 19.8 8 22.325 26.174999999999997 26.724999999999998 24.775 9 20.4 25.7 30.975 22.925 10-14 23.45 28.410000000000004 26.44 21.7 15-19 22.994999999999997 28.189999999999998 27.305 21.51 20-24 23.07 27.860000000000003 27.68 21.39 25-29 22.82 28.4 27.555000000000003 21.224999999999998 30-34 23.06 27.944999999999997 27.805000000000003 21.19 35-39 23.575 28.4 27.365000000000002 20.66 40-44 22.939999999999998 27.250000000000004 28.499999999999996 21.310000000000002 45-49 22.935 28.035 28.21 20.82 50-54 22.855 28.285 27.584999999999997 21.275 55-59 23.189999999999998 27.534999999999997 28.38 20.895 60-64 23.315 27.29 28.285 21.11 65-69 23.69 27.61 28.044999999999998 20.655 70-74 23.665 26.97 28.26 21.105 75-79 24.04 27.63 27.810000000000002 20.52 80-84 23.05 27.655 27.884999999999998 21.41 85-89 23.810000000000002 27.639999999999997 27.92 20.630000000000003 90-94 24.035 27.250000000000004 28.115000000000002 20.599999999999998 95-99 23.294999999999998 28.005000000000003 27.52 21.18 100-104 23.915 27.450000000000003 28.139999999999997 20.495 105-109 23.87 26.99 28.52 20.62 110-114 23.895 27.655 27.785 20.665 115-119 24.625 27.415 27.55 20.41 120-124 24.02 27.634999999999998 27.334999999999997 21.01 125-129 23.45 27.71 27.625 21.215 130-134 24.12 27.465 27.72 20.695 135-139 23.605 27.595 28.249999999999996 20.549999999999997 140-144 23.185 27.815 27.644999999999996 21.355 145-149 23.865 27.93 27.325 20.880000000000003 150-151 24.15 26.637499999999996 27.325 21.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 3.0 27 5.0 28 6.0 29 7.0 30 9.5 31 11.0 32 17.0 33 24.5 34 36.0 35 52.5 36 69.5 37 95.5 38 127.5 39 166.5 40 209.0 41 218.5 42 246.5 43 293.0 44 307.5 45 313.0 46 288.5 47 254.5 48 242.0 49 219.0 50 174.5 51 136.0 52 104.5 53 81.0 54 74.5 55 57.0 56 35.5 57 28.0 58 23.0 59 17.0 60 10.5 61 6.5 62 5.0 63 5.0 64 4.5 65 3.5 66 1.5 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.95 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2999999999999998 0.0 0.0 0.0 0.0 138-139 1.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACT 10 0.006830828 145.0 2 AGCACTA 10 0.006830828 145.0 3 GGAATTC 10 0.006830828 145.0 145 TGAGCAC 10 0.006830828 145.0 1 >>END_MODULE Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855616 spots for SRR7169079.sra Written 855616 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra Read 855598 spots for SRR7169079.sra Written 855598 spots for SRR7169079.sra SRR ids: ['SRR7169079.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l0als220 SRR7169079.sra spots: 17111978 blocks: [[1, 855598], [855599, 1711196], [1711197, 2566794], [2566795, 3422392], [3422393, 4277990], [4277991, 5133588], [5133589, 5989186], [5989187, 6844784], [6844785, 7700382], [7700383, 8555980], [8555981, 9411578], [9411579, 10267176], [10267177, 11122774], [11122775, 11978372], [11978373, 12833970], [12833971, 13689568], [13689569, 14545166], [14545167, 15400764], [15400765, 16256362], [16256363, 17111978]] SRR7169079 file size 5776987 SRR7169079 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169079 SRR7169079_1.fastq SRR7169079_2.fastq Input file: SRR7169079_1.fastq Paired file: SRR7169079_2.fastq trimmed: SRR7169079-trimmed-pair1.fastq, SRR7169079-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:46:59 2025 >> started Mon Feb 10 19:47:17 2025 >> done (18.241s) 17111978 read pairs processed; of these: 21639 ( 0.13%) short read pairs filtered out after trimming by size control 18031 ( 0.11%) empty read pairs filtered out after trimming by size control 17072308 (99.77%) read pairs available; of these: 7800743 (45.69%) trimmed read pairs available after processing 9271565 (54.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 4 0.00% 21 5 0.00% 22 7 0.00% 23 4 0.00% 24 5 0.00% 25 2 0.00% 26 8 0.00% 27 14 0.00% 28 6 0.00% 29 4 0.00% 30 5 0.00% 31 6 0.00% 32 8 0.00% 33 10 0.00% 34 14 0.00% 35 7 0.00% 36 11 0.00% 37 9 0.00% 38 10 0.00% 39 8 0.00% 40 8 0.00% 41 16 0.00% 42 15 0.00% 43 15 0.00% 44 19 0.00% 45 17 0.00% 46 21 0.00% 47 28 0.00% 48 25 0.00% 49 28 0.00% 50 24 0.00% 51 41 0.00% 52 22 0.00% 53 37 0.00% 54 36 0.00% 55 51 0.00% 56 40 0.00% 57 42 0.00% 58 59 0.00% 59 54 0.00% 60 67 0.00% 61 81 0.00% 62 72 0.00% 63 91 0.00% 64 104 0.00% 65 128 0.00% 66 112 0.00% 67 134 0.00% 68 147 0.00% 69 222 0.00% 70 234 0.00% 71 209 0.00% 72 238 0.00% 73 271 0.00% 74 300 0.00% 75 339 0.00% 76 382 0.00% 77 436 0.00% 78 448 0.00% 79 544 0.00% 80 601 0.00% 81 708 0.00% 82 817 0.00% 83 1029 0.01% 84 1866 0.01% 85 2507 0.01% 86 2493 0.01% 87 2688 0.02% 88 2830 0.02% 89 2929 0.02% 90 2983 0.02% 91 3061 0.02% 92 3244 0.02% 93 3406 0.02% 94 3646 0.02% 95 3642 0.02% 96 4028 0.02% 97 4220 0.02% 98 4452 0.03% 99 4647 0.03% 100 5135 0.03% 101 5348 0.03% 102 5564 0.03% 103 6044 0.04% 104 6408 0.04% 105 6869 0.04% 106 7113 0.04% 107 7492 0.04% 108 8159 0.05% 109 8307 0.05% 110 9012 0.05% 111 9794 0.06% 112 10334 0.06% 113 10972 0.06% 114 11837 0.07% 115 12802 0.07% 116 13496 0.08% 117 14258 0.08% 118 14880 0.09% 119 15534 0.09% 120 16404 0.10% 121 17066 0.10% 122 18278 0.11% 123 19524 0.11% 124 21263 0.12% 125 22392 0.13% 126 24320 0.14% 127 25910 0.15% 128 27501 0.16% 129 29485 0.17% 130 31456 0.18% 131 33977 0.20% 132 36253 0.21% 133 39715 0.23% 134 43491 0.25% 135 47132 0.28% 136 51303 0.30% 137 56946 0.33% 138 63098 0.37% 139 69411 0.41% 140 76963 0.45% 141 86760 0.51% 142 98537 0.58% 143 115405 0.68% 144 138313 0.81% 145 169810 0.99% 146 219891 1.29% 147 303924 1.78% 148 470175 2.75% 149 918791 5.38% 150 4256776 24.93% 151 9271565 54.31% 17072308 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=35 prefix-density=0.27 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCAGGTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=225.16 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=38 fanout-score=63.32 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=10.2 sequence=CTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGA SRR7169079 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:48:03 Started mapping on | Feb 10 19:48:06 Finished on | Feb 10 19:50:03 Mapping speed, Million of reads per hour | 525.30 Number of input reads | 17072308 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16152182 Uniquely mapped reads % | 94.61% Average mapped length | 296.87 Number of splices: Total | 15549083 Number of splices: Annotated (sjdb) | 15304667 Number of splices: GT/AG | 15344517 Number of splices: GC/AG | 162938 Number of splices: AT/AC | 12704 Number of splices: Non-canonical | 28924 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298040 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 58673 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 642621 642621 642621 N_multimapping 298040 298040 298040 N_noFeature 310391 15950072 394353 N_ambiguous 185444 1070 66464 UnstrandedReadsAssigned:15656347 PositiveStrandReadsAssigned:201040 NegativeStrandReadsAssigned:15691365 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169079 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169079-trimmed-pair1.fastq SRR7169079-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,072,308 reads, 15,595,134 reads pseudoaligned [quant] estimated average fragment length: 275.729 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR7169079.ke.tsv 34699 SRR7169079.se.tsv 87100 total ==> SRR7169079.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.27 271 9.65169 Potri.005G024800.1.v4.1 1035 760.271 31 2.53158 Potri.004G059700.1.v4.1 961 686.37 9 0.81411 Potri.007G009000.2.v4.1 1416 1141.27 0 0 Potri.003G141000.2.v4.1 2943 2668.27 278 6.46865 Potri.016G087400.1.v4.1 270 60.398 1320 1356.91 Potri.015G069301.1.v4.1 564 297.068 0 0 Potri.010G195200.1.v4.1 1773 1498.27 8 0.331511 Potri.012G127500.1.v4.1 977 702.346 1928 170.433 ==> SRR7169079.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1696 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 175 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169079 completed mapping pipeline successfully