Starting /dee2/code/volunteer_pipeline.sh SRR7169080 current disk space = 3056252633088 free memory = 1521473696 SRR7169080 SRAfilesize 8387249ca43565ea0a5f024513d719dc SRR7169080.sra SRR7169080.sra file validated SRR7169080 is paired end SRR7169080 is conventional basespace SRR7169080 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169080_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71375 34.0 33.0 34.0 32.0 34.0 2 33.33275 34.0 33.0 34.0 33.0 34.0 3 33.2605 34.0 33.0 34.0 33.0 34.0 4 33.3045 34.0 33.0 34.0 33.0 34.0 5 33.33975 34.0 33.0 34.0 33.0 34.0 6 36.81975 38.0 37.0 38.0 35.0 38.0 7 37.2305 38.0 38.0 38.0 36.0 38.0 8 37.27775 38.0 38.0 38.0 37.0 38.0 9 37.379 38.0 38.0 38.0 37.0 38.0 10-14 37.41330000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.33005 38.0 38.0 38.0 37.0 38.0 20-24 37.3585 38.0 38.0 38.0 37.0 38.0 25-29 37.2721 38.0 38.0 38.0 37.0 38.0 30-34 37.23145 38.0 38.0 38.0 37.0 38.0 35-39 37.13785 38.0 38.0 38.0 36.4 38.0 40-44 36.87115 38.0 38.0 38.0 35.2 38.0 45-49 36.699149999999996 38.0 38.0 38.0 34.6 38.0 50-54 36.6179 38.0 38.0 38.0 34.0 38.0 55-59 36.50725 38.0 38.0 38.0 34.0 38.0 60-64 36.44065 38.0 37.8 38.0 34.0 38.0 65-69 36.392849999999996 38.0 37.8 38.0 34.0 38.0 70-74 36.25965 38.0 37.0 38.0 33.6 38.0 75-79 36.2322 38.0 37.0 38.0 33.2 38.0 80-84 36.0666 38.0 37.0 38.0 32.6 38.0 85-89 35.96485 38.0 37.0 38.0 32.0 38.0 90-94 35.7315 38.0 37.0 38.0 30.6 38.0 95-99 35.611250000000005 38.0 36.6 38.0 30.2 38.0 100-104 35.39975 38.0 36.0 38.0 29.0 38.0 105-109 35.1751 38.0 36.0 38.0 28.8 38.0 110-114 34.89515 38.0 35.0 38.0 27.4 38.0 115-119 34.693149999999996 38.0 35.0 38.0 26.6 38.0 120-124 34.492 38.0 35.0 38.0 25.8 38.0 125-129 34.1432 38.0 34.6 38.0 24.0 38.0 130-134 33.6536 38.0 34.0 38.0 21.0 38.0 135-139 33.041149999999995 38.0 33.4 38.0 15.0 38.0 140-144 32.6459 38.0 33.0 38.0 14.8 38.0 145-149 31.821049999999996 37.2 32.6 38.0 11.4 38.0 150-151 27.4655 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 3.0 15 3.0 16 3.0 17 3.0 18 6.0 19 9.0 20 13.0 21 10.0 22 6.0 23 5.0 24 19.0 25 31.0 26 34.0 27 34.0 28 43.0 29 57.0 30 58.0 31 99.0 32 103.0 33 158.0 34 209.0 35 394.0 36 948.0 37 1748.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.84258787570046 14.060112073357105 9.526235354049923 33.57106469689251 2 23.974999999999998 15.075 33.7 27.250000000000004 3 19.825 20.875 27.575 31.724999999999998 4 21.825 29.075 24.05 25.05 5 22.3 32.75 24.525 20.424999999999997 6 19.625 35.85 24.15 20.375 7 13.850000000000001 27.3 41.349999999999994 17.5 8 17.75 28.225 28.875 25.15 9 17.8 24.575 32.5 25.124999999999996 10-14 19.75 30.335 27.095000000000002 22.82 15-19 19.965 29.325000000000003 27.375 23.335 20-24 19.89 29.285 27.66 23.165 25-29 19.645000000000003 29.45 27.47 23.435 30-34 19.415 29.044999999999998 27.685 23.855 35-39 20.3 29.255 27.134999999999998 23.31 40-44 19.725 29.2 27.439999999999998 23.635 45-49 19.36 29.18 27.779999999999998 23.68 50-54 19.74 28.595 27.884999999999998 23.78 55-59 19.71 29.425 27.334999999999997 23.53 60-64 19.965 29.205 27.525 23.305 65-69 19.875 29.360000000000003 27.62 23.145 70-74 20.315 28.46 27.415 23.810000000000002 75-79 20.31 28.754999999999995 27.46 23.474999999999998 80-84 20.560000000000002 29.065 26.715 23.66 85-89 20.32 28.515 27.495000000000005 23.669999999999998 90-94 20.195 28.57 27.755000000000003 23.48 95-99 20.560000000000002 28.854999999999997 27.26 23.325000000000003 100-104 20.39 28.815 27.384999999999998 23.41 105-109 20.51 28.48 27.54 23.47 110-114 20.064999999999998 28.18 28.144999999999996 23.61 115-119 20.59 28.625 27.195000000000004 23.59 120-124 20.294999999999998 28.49 28.199999999999996 23.015 125-129 20.41 28.060000000000002 27.98 23.549999999999997 130-134 20.97 27.85 27.71 23.47 135-139 20.236011800590028 28.7914395719786 26.996349817490874 23.976198809940495 140-144 20.275000000000002 28.76 27.055 23.91 145-149 20.695 28.744999999999997 27.284999999999997 23.275000000000002 150-151 21.2625 28.449999999999996 27.0625 23.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 2.0 24 3.5 25 3.0 26 4.0 27 8.5 28 11.0 29 16.5 30 24.5 31 26.5 32 32.5 33 47.5 34 62.0 35 79.5 36 98.5 37 117.0 38 138.0 39 154.0 40 194.5 41 218.0 42 240.5 43 276.0 44 274.0 45 256.0 46 251.0 47 254.0 48 227.0 49 197.0 50 167.0 51 147.0 52 123.0 53 88.5 54 71.5 55 49.5 56 35.5 57 29.5 58 21.0 59 14.5 60 8.5 61 5.5 62 6.0 63 5.5 64 2.5 65 0.5 66 0.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8375 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.3 0.0 0.0 0.0 0.0 138-139 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169080 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169080_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57325 33.0 33.0 34.0 32.0 34.0 2 32.6945 33.0 33.0 34.0 32.0 34.0 3 32.74425 34.0 33.0 34.0 32.0 34.0 4 32.66375 34.0 33.0 34.0 32.0 34.0 5 32.68975 34.0 33.0 34.0 32.0 34.0 6 36.80925 38.0 38.0 38.0 36.0 38.0 7 36.9425 38.0 38.0 38.0 36.0 38.0 8 36.84625 38.0 38.0 38.0 36.0 38.0 9 36.974 38.0 38.0 38.0 36.0 38.0 10-14 36.846 38.0 38.0 38.0 36.0 38.0 15-19 36.808749999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.7933 38.0 38.0 38.0 36.0 38.0 25-29 36.81585 38.0 38.0 38.0 36.0 38.0 30-34 36.71085 38.0 38.0 38.0 36.0 38.0 35-39 36.674549999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.6103 38.0 38.0 38.0 35.4 38.0 45-49 36.66245 38.0 38.0 38.0 36.0 38.0 50-54 36.592999999999996 38.0 38.0 38.0 35.6 38.0 55-59 36.5642 38.0 38.0 38.0 35.2 38.0 60-64 36.5053 38.0 38.0 38.0 34.8 38.0 65-69 36.5218 38.0 38.0 38.0 34.8 38.0 70-74 36.4039 38.0 38.0 38.0 34.4 38.0 75-79 36.311449999999994 38.0 38.0 38.0 34.2 38.0 80-84 36.25320000000001 38.0 38.0 38.0 33.8 38.0 85-89 36.20235 38.0 38.0 38.0 34.0 38.0 90-94 36.08645 38.0 38.0 38.0 33.6 38.0 95-99 35.908699999999996 38.0 38.0 38.0 33.0 38.0 100-104 35.7702 38.0 38.0 38.0 32.2 38.0 105-109 35.6697 38.0 37.6 38.0 32.0 38.0 110-114 35.4919 38.0 37.0 38.0 30.8 38.0 115-119 35.28295 38.0 37.0 38.0 29.6 38.0 120-124 35.1684 38.0 36.8 38.0 29.4 38.0 125-129 34.89775 38.0 36.0 38.0 28.0 38.0 130-134 34.6816 38.0 36.0 38.0 27.4 38.0 135-139 34.36395 38.0 35.8 38.0 24.4 38.0 140-144 33.9288 38.0 35.0 38.0 22.6 38.0 145-149 33.05785 38.0 34.8 38.0 11.6 38.0 150-151 29.162875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 8.0 4 3.0 5 4.0 6 3.0 7 2.0 8 1.0 9 1.0 10 0.0 11 1.0 12 3.0 13 2.0 14 4.0 15 3.0 16 9.0 17 6.0 18 14.0 19 9.0 20 6.0 21 8.0 22 10.0 23 21.0 24 19.0 25 18.0 26 30.0 27 28.0 28 29.0 29 38.0 30 48.0 31 68.0 32 75.0 33 110.0 34 113.0 35 224.0 36 480.0 37 2590.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.16029007251813 22.755688922230558 12.203050762690673 23.88097024256064 2 28.00700175043761 27.031757939484873 29.382345586396596 15.57889472368092 3 20.880220055013755 27.70692673168292 30.782695673918482 20.630157539384847 4 21.675 36.6 23.775 17.95 5 23.150000000000002 36.6 23.075000000000003 17.175 6 21.7 36.725 23.075000000000003 18.5 7 20.05 21.175 38.550000000000004 20.225 8 21.925 26.625 27.700000000000003 23.75 9 22.275 23.849999999999998 30.25 23.625 10-14 23.330000000000002 28.410000000000004 26.705000000000002 21.555 15-19 22.875 27.595 28.02 21.51 20-24 22.814999999999998 28.365000000000002 27.73 21.09 25-29 23.205000000000002 28.694999999999997 27.43 20.669999999999998 30-34 22.79 28.305000000000003 27.72 21.185000000000002 35-39 23.11 28.185 27.51 21.195 40-44 23.27 27.800000000000004 28.044999999999998 20.885 45-49 23.555 27.584999999999997 27.605 21.255 50-54 23.555 28.144999999999996 27.750000000000004 20.549999999999997 55-59 23.96 27.544999999999998 27.76 20.735 60-64 23.645 27.6 28.24 20.515 65-69 23.695 27.905 27.805000000000003 20.595 70-74 23.44 28.18 27.785 20.595 75-79 23.767825869402053 27.600700525394046 27.92594445834376 20.705529146860144 80-84 23.369999999999997 27.87 28.37 20.39 85-89 24.02 27.46 27.215 21.305 90-94 23.665 27.42 28.615000000000002 20.3 95-99 23.315 27.955000000000002 27.955000000000002 20.775 100-104 23.76 27.63 28.275 20.335 105-109 23.68 27.834999999999997 28.16 20.325 110-114 23.59 27.779999999999998 27.97 20.66 115-119 23.465 28.065 27.92 20.549999999999997 120-124 23.330000000000002 27.815 28.1 20.755000000000003 125-129 23.44 27.83 28.610000000000003 20.119999999999997 130-134 23.76 27.584999999999997 28.52 20.135 135-139 23.275000000000002 27.555000000000003 28.475 20.695 140-144 24.02 28.225 27.644999999999996 20.11 145-149 24.58884877657441 28.108704372242276 27.40172482952266 19.90072202166065 150-151 23.49685534591195 27.572327044025158 28.238993710691823 20.69182389937107 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 2.0 25 1.0 26 1.0 27 1.5 28 5.0 29 10.5 30 15.0 31 17.5 32 23.5 33 33.0 34 45.5 35 60.0 36 74.5 37 106.5 38 134.0 39 161.5 40 189.5 41 225.0 42 245.5 43 261.0 44 284.5 45 299.0 46 284.0 47 259.5 48 243.5 49 196.0 50 167.0 51 156.5 52 127.0 53 97.0 54 74.0 55 44.5 56 34.0 57 37.0 58 28.5 59 13.0 60 7.5 61 6.0 62 4.0 63 4.0 64 3.5 65 3.5 66 2.0 67 0.5 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.075 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.27999999999999997 150-151 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.1375000000000002 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAGT 10 0.006830828 145.0 1 CTCTCTC 30 0.0014437955 24.166668 20-24 TTTTTTT 120 0.0036335043 9.666667 130-134 >>END_MODULE Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798787 spots for SRR7169080.sra Written 798787 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra Read 798774 spots for SRR7169080.sra Written 798774 spots for SRR7169080.sra SRR ids: ['SRR7169080.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u6mkaav1 SRR7169080.sra spots: 15975493 blocks: [[1, 798774], [798775, 1597548], [1597549, 2396322], [2396323, 3195096], [3195097, 3993870], [3993871, 4792644], [4792645, 5591418], [5591419, 6390192], [6390193, 7188966], [7188967, 7987740], [7987741, 8786514], [8786515, 9585288], [9585289, 10384062], [10384063, 11182836], [11182837, 11981610], [11981611, 12780384], [12780385, 13579158], [13579159, 14377932], [14377933, 15176706], [15176707, 15975493]] SRR7169080 file size 5391870 SRR7169080 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169080 SRR7169080_1.fastq SRR7169080_2.fastq Input file: SRR7169080_1.fastq Paired file: SRR7169080_2.fastq trimmed: SRR7169080-trimmed-pair1.fastq, SRR7169080-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:10:00 2025 >> started Mon Feb 10 20:10:18 2025 >> done (18.026s) 15975493 read pairs processed; of these: 24740 ( 0.15%) short read pairs filtered out after trimming by size control 29378 ( 0.18%) empty read pairs filtered out after trimming by size control 15921375 (99.66%) read pairs available; of these: 7240894 (45.48%) trimmed read pairs available after processing 8680481 (54.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 3 0.00% 21 7 0.00% 22 6 0.00% 23 2 0.00% 24 12 0.00% 25 4 0.00% 26 9 0.00% 27 16 0.00% 28 6 0.00% 29 9 0.00% 30 11 0.00% 31 4 0.00% 32 8 0.00% 33 16 0.00% 34 11 0.00% 35 17 0.00% 36 12 0.00% 37 14 0.00% 38 16 0.00% 39 15 0.00% 40 13 0.00% 41 21 0.00% 42 17 0.00% 43 23 0.00% 44 22 0.00% 45 25 0.00% 46 38 0.00% 47 29 0.00% 48 23 0.00% 49 23 0.00% 50 30 0.00% 51 38 0.00% 52 44 0.00% 53 39 0.00% 54 44 0.00% 55 63 0.00% 56 60 0.00% 57 72 0.00% 58 67 0.00% 59 96 0.00% 60 88 0.00% 61 88 0.00% 62 101 0.00% 63 123 0.00% 64 138 0.00% 65 140 0.00% 66 162 0.00% 67 182 0.00% 68 185 0.00% 69 218 0.00% 70 253 0.00% 71 257 0.00% 72 291 0.00% 73 318 0.00% 74 384 0.00% 75 425 0.00% 76 479 0.00% 77 500 0.00% 78 509 0.00% 79 648 0.00% 80 683 0.00% 81 806 0.01% 82 935 0.01% 83 1158 0.01% 84 2118 0.01% 85 2811 0.02% 86 2694 0.02% 87 2739 0.02% 88 2905 0.02% 89 2939 0.02% 90 2991 0.02% 91 3225 0.02% 92 3382 0.02% 93 3535 0.02% 94 3727 0.02% 95 3854 0.02% 96 4109 0.03% 97 4356 0.03% 98 4614 0.03% 99 5006 0.03% 100 5273 0.03% 101 5520 0.03% 102 6060 0.04% 103 6472 0.04% 104 6870 0.04% 105 7407 0.05% 106 7778 0.05% 107 8356 0.05% 108 8630 0.05% 109 9019 0.06% 110 9746 0.06% 111 10445 0.07% 112 11331 0.07% 113 11936 0.07% 114 12749 0.08% 115 13425 0.08% 116 14147 0.09% 117 15258 0.10% 118 15889 0.10% 119 16871 0.11% 120 17769 0.11% 121 18729 0.12% 122 20044 0.13% 123 21587 0.14% 124 22962 0.14% 125 24594 0.15% 126 26121 0.16% 127 28019 0.18% 128 29766 0.19% 129 31443 0.20% 130 33859 0.21% 131 35962 0.23% 132 39065 0.25% 133 42778 0.27% 134 45803 0.29% 135 49751 0.31% 136 54287 0.34% 137 59372 0.37% 138 66839 0.42% 139 72957 0.46% 140 81080 0.51% 141 90922 0.57% 142 104010 0.65% 143 113646 0.71% 144 133684 0.84% 145 161394 1.01% 146 202658 1.27% 147 279073 1.75% 148 426914 2.68% 149 859006 5.40% 150 3778543 23.73% 151 8680481 54.52% 15921375 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=2.0 sequence=GTTTATAAGGAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=87.33 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=13.4 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=9.47 fanout-score-rank=10 prefix-density=0.32 prefix-fanout=6.1 sequence=TCAATGCTGTTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=43.39 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=11.4 sequence=TGTTGGTGGTGG SRR7169080 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:11:05 Started mapping on | Feb 10 20:11:05 Finished on | Feb 10 20:12:55 Mapping speed, Million of reads per hour | 521.06 Number of input reads | 15921375 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14914990 Uniquely mapped reads % | 93.68% Average mapped length | 296.32 Number of splices: Total | 13649635 Number of splices: Annotated (sjdb) | 13418528 Number of splices: GT/AG | 13455259 Number of splices: GC/AG | 153607 Number of splices: AT/AC | 11217 Number of splices: Non-canonical | 29552 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264909 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 18156 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.51% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 763259 763259 763259 N_multimapping 264909 264909 264909 N_noFeature 380749 14733304 444480 N_ambiguous 179330 759 60847 UnstrandedReadsAssigned:14354911 PositiveStrandReadsAssigned:180927 NegativeStrandReadsAssigned:14409663 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169080 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169080-trimmed-pair1.fastq SRR7169080-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,921,375 reads, 14,313,324 reads pseudoaligned [quant] estimated average fragment length: 270.879 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7169080.ke.tsv 34699 SRR7169080.se.tsv 87100 total ==> SRR7169080.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.12 310 11.769 Potri.005G024800.1.v4.1 1035 765.121 24 2.08176 Potri.004G059700.1.v4.1 961 691.159 7 0.672155 Potri.007G009000.2.v4.1 1416 1146.12 0 0 Potri.003G141000.2.v4.1 2943 2673.12 236.062 5.8608 Potri.016G087400.1.v4.1 270 61.7517 1223 1314.4 Potri.015G069301.1.v4.1 564 299.828 0 0 Potri.010G195200.1.v4.1 1773 1503.12 16 0.70644 Potri.012G127500.1.v4.1 977 707.153 4218 395.861 ==> SRR7169080.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2269 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 33 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169080 completed mapping pipeline successfully