Starting /dee2/code/volunteer_pipeline.sh SRR7169081 current disk space = 3056503013376 free memory = 1166241348 SRR7169081 SRAfilesize a061513c6caad2479b4dae116d00a515 SRR7169081.sra SRR7169081.sra file validated SRR7169081 is paired end SRR7169081 is conventional basespace SRR7169081 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169081_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7905 34.0 33.0 34.0 33.0 34.0 2 33.33025 34.0 33.0 34.0 33.0 34.0 3 33.34675 34.0 33.0 34.0 33.0 34.0 4 33.39125 34.0 33.0 34.0 33.0 34.0 5 33.35675 34.0 33.0 34.0 33.0 34.0 6 36.92825 38.0 37.0 38.0 35.0 38.0 7 37.36975 38.0 38.0 38.0 37.0 38.0 8 37.36925 38.0 38.0 38.0 37.0 38.0 9 37.4565 38.0 38.0 38.0 37.0 38.0 10-14 37.47005 38.0 38.0 38.0 37.0 38.0 15-19 37.402 38.0 38.0 38.0 37.0 38.0 20-24 37.3831 38.0 38.0 38.0 37.0 38.0 25-29 37.3348 38.0 38.0 38.0 37.0 38.0 30-34 37.2842 38.0 38.0 38.0 37.0 38.0 35-39 37.2176 38.0 38.0 38.0 36.6 38.0 40-44 36.99059999999999 38.0 38.0 38.0 35.8 38.0 45-49 36.8968 38.0 38.0 38.0 35.4 38.0 50-54 36.720299999999995 38.0 38.0 38.0 34.6 38.0 55-59 36.6835 38.0 38.0 38.0 34.4 38.0 60-64 36.630900000000004 38.0 38.0 38.0 34.2 38.0 65-69 36.56755 38.0 38.0 38.0 34.0 38.0 70-74 36.44185 38.0 37.8 38.0 34.0 38.0 75-79 36.3325 38.0 37.0 38.0 33.8 38.0 80-84 36.19 38.0 37.0 38.0 33.0 38.0 85-89 36.01465 38.0 37.0 38.0 32.6 38.0 90-94 35.699149999999996 38.0 37.0 38.0 30.4 38.0 95-99 35.5869 38.0 36.2 38.0 29.6 38.0 100-104 35.42285 38.0 36.0 38.0 29.4 38.0 105-109 35.07255 38.0 35.8 38.0 28.2 38.0 110-114 34.7868 38.0 35.0 38.0 27.0 38.0 115-119 34.350649999999995 38.0 34.4 38.0 24.6 38.0 120-124 33.9491 38.0 34.0 38.0 22.6 38.0 125-129 33.5496 37.6 33.8 38.0 19.8 38.0 130-134 32.899 37.0 32.6 38.0 15.0 38.0 135-139 32.0259 36.0 31.0 38.0 14.6 38.0 140-144 31.20055 36.0 30.6 38.0 14.0 38.0 145-149 29.769650000000002 35.0 27.8 38.0 6.4 38.0 150-151 24.292749999999998 31.5 8.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 1.0 16 1.0 17 3.0 18 6.0 19 6.0 20 8.0 21 6.0 22 11.0 23 17.0 24 22.0 25 24.0 26 40.0 27 34.0 28 41.0 29 61.0 30 80.0 31 95.0 32 122.0 33 176.0 34 261.0 35 492.0 36 1145.0 37 1342.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.908350305498985 13.823828920570264 8.884928716904277 32.382892057026474 2 23.150000000000002 15.299999999999999 33.45 28.1 3 18.775 20.674999999999997 25.95 34.599999999999994 4 23.0 26.650000000000002 24.5 25.85 5 21.875 32.675 24.875 20.575 6 20.424999999999997 35.5 23.575 20.5 7 15.049999999999999 28.000000000000004 40.025 16.925 8 18.375 26.6 29.849999999999998 25.174999999999997 9 16.175 25.95 34.075 23.799999999999997 10-14 20.1 29.37 27.36 23.169999999999998 15-19 20.215 28.444999999999997 27.54 23.799999999999997 20-24 20.18 28.185 27.715 23.919999999999998 25-29 19.814999999999998 29.549999999999997 27.165 23.47 30-34 20.080000000000002 29.07 27.145000000000003 23.705000000000002 35-39 20.4 28.389999999999997 27.54 23.669999999999998 40-44 19.54 28.93 27.58 23.95 45-49 20.044999999999998 27.935 27.744999999999997 24.275 50-54 20.294999999999998 28.975 27.165 23.565 55-59 19.68 28.975 27.384999999999998 23.96 60-64 20.375 28.13 27.834999999999997 23.66 65-69 20.595 28.17 27.615000000000002 23.62 70-74 20.285 28.794999999999998 26.950000000000003 23.97 75-79 20.415 28.235 27.38 23.97 80-84 20.41 28.544999999999998 27.355 23.69 85-89 20.674999999999997 28.315 27.224999999999998 23.785 90-94 20.549999999999997 27.93 27.725 23.794999999999998 95-99 20.215 28.025 27.55 24.21 100-104 20.505000000000003 28.060000000000002 28.02 23.415 105-109 20.115 27.689999999999998 27.955000000000002 24.240000000000002 110-114 20.630000000000003 28.660000000000004 27.41 23.3 115-119 20.62 28.194999999999997 27.97 23.215 120-124 20.62 28.470000000000002 27.175 23.735 125-129 20.71 27.584999999999997 27.83 23.875 130-134 20.72603630181509 28.041402070103505 27.66638331916596 23.566178308915443 135-139 20.976048802440122 28.656432821641083 27.256362818140907 23.111155557777888 140-144 20.955 27.52 27.38 24.145 145-149 21.09 28.22 27.589999999999996 23.1 150-151 20.2125 28.15 27.500000000000004 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.5 22 3.5 23 5.5 24 4.0 25 1.5 26 3.5 27 6.5 28 6.0 29 9.0 30 15.0 31 21.0 32 24.5 33 27.5 34 41.5 35 60.0 36 77.5 37 113.0 38 143.0 39 153.5 40 184.5 41 219.5 42 234.5 43 252.0 44 280.5 45 279.0 46 279.0 47 291.5 48 252.0 49 192.5 50 160.0 51 138.5 52 117.0 53 94.0 54 82.0 55 65.0 56 41.0 57 32.0 58 21.0 59 15.0 60 12.0 61 9.5 62 6.5 63 3.0 64 3.0 65 3.5 66 2.5 67 2.5 68 3.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.44999999999999996 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.0750000000000002 0.0 0.0 0.0 0.0 138-139 1.2000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGCTT 10 0.006846698 144.88751 8 TAGGTGC 10 0.006846698 144.88751 9 >>END_MODULE SRR7169081 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169081_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5495 33.0 33.0 34.0 32.0 34.0 2 32.6835 33.0 33.0 34.0 32.0 34.0 3 32.66925 33.0 33.0 34.0 32.0 34.0 4 32.6685 33.0 33.0 34.0 32.0 34.0 5 32.612 33.0 33.0 34.0 32.0 34.0 6 36.76125 38.0 38.0 38.0 36.0 38.0 7 36.817 38.0 38.0 38.0 36.0 38.0 8 36.79625 38.0 38.0 38.0 36.0 38.0 9 36.94375 38.0 38.0 38.0 36.0 38.0 10-14 36.807249999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.70655 38.0 38.0 38.0 35.6 38.0 20-24 36.598800000000004 38.0 38.0 38.0 35.4 38.0 25-29 36.6557 38.0 38.0 38.0 35.8 38.0 30-34 36.629450000000006 38.0 38.0 38.0 35.8 38.0 35-39 36.57525 38.0 38.0 38.0 35.2 38.0 40-44 36.453500000000005 38.0 38.0 38.0 34.6 38.0 45-49 36.51255 38.0 38.0 38.0 35.0 38.0 50-54 36.51065 38.0 38.0 38.0 34.8 38.0 55-59 36.451750000000004 38.0 38.0 38.0 34.8 38.0 60-64 36.398799999999994 38.0 38.0 38.0 34.4 38.0 65-69 36.367000000000004 38.0 38.0 38.0 34.2 38.0 70-74 36.2137 38.0 38.0 38.0 34.0 38.0 75-79 36.157300000000006 38.0 38.0 38.0 34.0 38.0 80-84 36.08535 38.0 38.0 38.0 33.8 38.0 85-89 36.03875 38.0 38.0 38.0 33.4 38.0 90-94 35.951 38.0 38.0 38.0 33.2 38.0 95-99 35.7755 38.0 37.8 38.0 32.0 38.0 100-104 35.6205 38.0 37.4 38.0 30.6 38.0 105-109 35.46040000000001 38.0 37.0 38.0 30.2 38.0 110-114 35.327600000000004 38.0 37.0 38.0 29.2 38.0 115-119 35.172450000000005 38.0 37.0 38.0 28.6 38.0 120-124 34.982099999999996 38.0 36.4 38.0 28.0 38.0 125-129 34.67735 38.0 36.0 38.0 26.6 38.0 130-134 34.37564999999999 38.0 35.6 38.0 23.4 38.0 135-139 34.11 38.0 35.2 38.0 23.0 38.0 140-144 33.6494 38.0 35.0 38.0 19.6 38.0 145-149 32.812799999999996 38.0 34.6 38.0 11.4 38.0 150-151 29.068125000000002 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 15.0 4 6.0 5 2.0 6 1.0 7 2.0 8 2.0 9 2.0 10 6.0 11 1.0 12 5.0 13 1.0 14 4.0 15 6.0 16 2.0 17 8.0 18 10.0 19 7.0 20 8.0 21 10.0 22 17.0 23 16.0 24 20.0 25 26.0 26 22.0 27 33.0 28 47.0 29 53.0 30 52.0 31 75.0 32 75.0 33 82.0 34 133.0 35 239.0 36 465.0 37 2540.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.610152538134535 24.681170292573142 12.10302575643911 22.605651412853213 2 28.657164291072768 26.531632908227053 27.406851712928233 17.404351087771943 3 20.910455227613806 27.688844422211105 30.940470235117555 20.460230115057527 4 22.875 35.75 23.575 17.8 5 24.85 35.949999999999996 22.3 16.900000000000002 6 22.075 37.574999999999996 21.725 18.625 7 19.950000000000003 23.325000000000003 36.449999999999996 20.275000000000002 8 22.575 25.650000000000002 27.3 24.474999999999998 9 21.55 25.724999999999998 29.375 23.35 10-14 23.64 28.835 26.540000000000003 20.985 15-19 23.62 28.285 26.75 21.345 20-24 23.29 28.34 27.435 20.935000000000002 25-29 23.595 27.694999999999997 27.57 21.14 30-34 23.205000000000002 28.345 26.945000000000004 21.505 35-39 23.175 28.67 27.01 21.145 40-44 23.305 27.73 27.115000000000002 21.85 45-49 23.73 27.894999999999996 27.48 20.895 50-54 23.145 28.485 27.644999999999996 20.724999999999998 55-59 23.905 27.61 27.52 20.965 60-64 23.380000000000003 28.065 27.715 20.84 65-69 23.62 27.744999999999997 27.92 20.715 70-74 23.5 27.865000000000002 27.82 20.815 75-79 23.219643928785757 27.490498099619927 27.825565113022606 21.464292858571714 80-84 23.785 27.41 27.265 21.54 85-89 23.89 27.88 27.27 20.96 90-94 23.395 27.845 27.845 20.915 95-99 23.845 27.839999999999996 27.439999999999998 20.875 100-104 23.794999999999998 28.055000000000003 27.27 20.880000000000003 105-109 23.200000000000003 28.035 27.505000000000003 21.26 110-114 23.77 28.32 27.415 20.495 115-119 23.515 28.235 27.105 21.145 120-124 23.895 27.73 27.665 20.71 125-129 23.544999999999998 27.88 27.255000000000003 21.32 130-134 24.455 27.74 27.35 20.455000000000002 135-139 24.03 28.360000000000003 26.855 20.755000000000003 140-144 24.23 28.04 27.325 20.405 145-149 24.21675271943456 28.10165923103915 27.700636623389645 19.98095142613665 150-151 24.647887323943664 26.836016096579478 26.949195171026158 21.566901408450704 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.5 27 3.5 28 4.0 29 2.0 30 4.5 31 12.0 32 17.0 33 20.5 34 30.0 35 53.5 36 78.5 37 85.5 38 117.0 39 156.5 40 186.0 41 229.5 42 256.5 43 279.0 44 290.0 45 290.5 46 297.0 47 289.5 48 260.5 49 219.5 50 180.0 51 151.5 52 121.5 53 96.0 54 77.5 55 49.5 56 33.5 57 27.5 58 18.5 59 14.5 60 12.5 61 9.0 62 5.5 63 4.5 64 4.0 65 2.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.02 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.255 150-151 0.6 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.2999999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAAGA 10 0.0065806094 146.79747 1 >>END_MODULE Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849642 spots for SRR7169081.sra Written 849642 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra Read 849639 spots for SRR7169081.sra Written 849639 spots for SRR7169081.sra SRR ids: ['SRR7169081.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sq18dp8h SRR7169081.sra spots: 16992783 blocks: [[1, 849639], [849640, 1699278], [1699279, 2548917], [2548918, 3398556], [3398557, 4248195], [4248196, 5097834], [5097835, 5947473], [5947474, 6797112], [6797113, 7646751], [7646752, 8496390], [8496391, 9346029], [9346030, 10195668], [10195669, 11045307], [11045308, 11894946], [11894947, 12744585], [12744586, 13594224], [13594225, 14443863], [14443864, 15293502], [15293503, 16143141], [16143142, 16992783]] SRR7169081 file size 5736596 SRR7169081 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169081 SRR7169081_1.fastq SRR7169081_2.fastq Input file: SRR7169081_1.fastq Paired file: SRR7169081_2.fastq trimmed: SRR7169081-trimmed-pair1.fastq, SRR7169081-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:48:21 2025 >> started Mon Feb 10 19:48:41 2025 >> done (19.747s) 16992783 read pairs processed; of these: 28649 ( 0.17%) short read pairs filtered out after trimming by size control 21726 ( 0.13%) empty read pairs filtered out after trimming by size control 16942408 (99.70%) read pairs available; of these: 9038931 (53.35%) trimmed read pairs available after processing 7903477 (46.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 4 0.00% 21 3 0.00% 22 6 0.00% 23 5 0.00% 24 5 0.00% 25 3 0.00% 26 9 0.00% 27 8 0.00% 28 12 0.00% 29 10 0.00% 30 12 0.00% 31 12 0.00% 32 5 0.00% 33 8 0.00% 34 16 0.00% 35 13 0.00% 36 15 0.00% 37 13 0.00% 38 10 0.00% 39 13 0.00% 40 11 0.00% 41 23 0.00% 42 25 0.00% 43 21 0.00% 44 28 0.00% 45 29 0.00% 46 23 0.00% 47 35 0.00% 48 24 0.00% 49 36 0.00% 50 39 0.00% 51 57 0.00% 52 53 0.00% 53 48 0.00% 54 62 0.00% 55 70 0.00% 56 68 0.00% 57 90 0.00% 58 100 0.00% 59 111 0.00% 60 95 0.00% 61 124 0.00% 62 145 0.00% 63 141 0.00% 64 148 0.00% 65 159 0.00% 66 202 0.00% 67 210 0.00% 68 230 0.00% 69 256 0.00% 70 324 0.00% 71 352 0.00% 72 318 0.00% 73 382 0.00% 74 448 0.00% 75 457 0.00% 76 555 0.00% 77 629 0.00% 78 644 0.00% 79 757 0.00% 80 833 0.00% 81 968 0.01% 82 1150 0.01% 83 1424 0.01% 84 2460 0.01% 85 3147 0.02% 86 3127 0.02% 87 3220 0.02% 88 3299 0.02% 89 3258 0.02% 90 3425 0.02% 91 3486 0.02% 92 3691 0.02% 93 3855 0.02% 94 3960 0.02% 95 4243 0.03% 96 4562 0.03% 97 4813 0.03% 98 5007 0.03% 99 5371 0.03% 100 5586 0.03% 101 6015 0.04% 102 6259 0.04% 103 6721 0.04% 104 7233 0.04% 105 7636 0.05% 106 8143 0.05% 107 8801 0.05% 108 9349 0.06% 109 9686 0.06% 110 10423 0.06% 111 11184 0.07% 112 12073 0.07% 113 12655 0.07% 114 13695 0.08% 115 14547 0.09% 116 15718 0.09% 117 16570 0.10% 118 17807 0.11% 119 18942 0.11% 120 19759 0.12% 121 21244 0.13% 122 22922 0.14% 123 24590 0.15% 124 26759 0.16% 125 28480 0.17% 126 30527 0.18% 127 32926 0.19% 128 35338 0.21% 129 38301 0.23% 130 41099 0.24% 131 44946 0.27% 132 48516 0.29% 133 53253 0.31% 134 57551 0.34% 135 62560 0.37% 136 69976 0.41% 137 77659 0.46% 138 87597 0.52% 139 98281 0.58% 140 110922 0.65% 141 125330 0.74% 142 146617 0.87% 143 163837 0.97% 144 192039 1.13% 145 236086 1.39% 146 297853 1.76% 147 407251 2.40% 148 617376 3.64% 149 1169227 6.90% 150 4358045 25.72% 151 7903477 46.65% 16942408 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=37 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=223.56 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=241.14 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=25.1 sequence=GAAGAAGAAGAAA SRR7169081 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:49:29 Started mapping on | Feb 10 19:49:29 Finished on | Feb 10 19:51:16 Mapping speed, Million of reads per hour | 570.02 Number of input reads | 16942408 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16069749 Uniquely mapped reads % | 94.85% Average mapped length | 295.60 Number of splices: Total | 15447365 Number of splices: Annotated (sjdb) | 15203453 Number of splices: GT/AG | 15229413 Number of splices: GC/AG | 175694 Number of splices: AT/AC | 12572 Number of splices: Non-canonical | 29686 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.02% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298797 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 32648 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 601338 601338 601338 N_multimapping 298797 298797 298797 N_noFeature 308799 15889693 373187 N_ambiguous 183811 1221 67241 UnstrandedReadsAssigned:15577139 PositiveStrandReadsAssigned:178835 NegativeStrandReadsAssigned:15629321 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169081 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169081-trimmed-pair1.fastq SRR7169081-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,942,408 reads, 15,544,682 reads pseudoaligned [quant] estimated average fragment length: 283.489 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52401 SRR7169081.ke.tsv 34699 SRR7169081.se.tsv 87100 total ==> SRR7169081.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.51 300 9.84708 Potri.005G024800.1.v4.1 1035 752.511 30 2.27103 Potri.004G059700.1.v4.1 961 678.594 3 0.25184 Potri.007G009000.2.v4.1 1416 1133.51 0 0 Potri.003G141000.2.v4.1 2943 2660.51 269.058 5.76095 Potri.016G087400.1.v4.1 270 59.0989 1314 1266.57 Potri.015G069301.1.v4.1 564 290.17 0 0 Potri.010G195200.1.v4.1 1773 1490.51 27 1.03191 Potri.012G127500.1.v4.1 977 694.55 6254 512.942 ==> SRR7169081.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1584 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169081 completed mapping pipeline successfully