Starting /dee2/code/volunteer_pipeline.sh SRR7169082 current disk space = 3056669745152 free memory = 1325424664 SRR7169082 SRAfilesize b4dc6df3d150017cfd5071d8e3400c92 SRR7169082.sra SRR7169082.sra file validated SRR7169082 is paired end SRR7169082 is conventional basespace SRR7169082 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169082_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76575 34.0 33.0 34.0 33.0 34.0 2 33.33 34.0 33.0 34.0 33.0 34.0 3 33.3145 34.0 33.0 34.0 33.0 34.0 4 33.36475 34.0 33.0 34.0 33.0 34.0 5 33.37575 34.0 33.0 34.0 33.0 34.0 6 36.8455 38.0 37.0 38.0 35.0 38.0 7 37.2925 38.0 38.0 38.0 36.0 38.0 8 37.40525 38.0 38.0 38.0 37.0 38.0 9 37.4215 38.0 38.0 38.0 37.0 38.0 10-14 37.44350000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.32299999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.34475 38.0 38.0 38.0 37.0 38.0 25-29 37.3189 38.0 38.0 38.0 37.0 38.0 30-34 37.293000000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.17975 38.0 38.0 38.0 36.6 38.0 40-44 36.9482 38.0 38.0 38.0 35.8 38.0 45-49 36.76935 38.0 38.0 38.0 34.4 38.0 50-54 36.67375 38.0 38.0 38.0 34.4 38.0 55-59 36.557249999999996 38.0 38.0 38.0 34.0 38.0 60-64 36.476299999999995 38.0 37.6 38.0 34.0 38.0 65-69 36.439249999999994 38.0 37.6 38.0 34.0 38.0 70-74 36.30505 38.0 37.2 38.0 33.2 38.0 75-79 36.220150000000004 38.0 37.0 38.0 33.0 38.0 80-84 36.10025 38.0 37.0 38.0 33.0 38.0 85-89 35.9237 38.0 37.0 38.0 31.4 38.0 90-94 35.6726 38.0 36.8 38.0 30.6 38.0 95-99 35.64035 38.0 36.6 38.0 30.6 38.0 100-104 35.3809 38.0 36.0 38.0 29.4 38.0 105-109 35.13905 38.0 36.0 38.0 28.6 38.0 110-114 34.9551 38.0 35.4 38.0 27.8 38.0 115-119 34.64925 38.0 35.0 38.0 26.6 38.0 120-124 34.3805 38.0 34.8 38.0 25.0 38.0 125-129 34.083749999999995 38.0 34.4 38.0 23.4 38.0 130-134 33.57020000000001 38.0 34.0 38.0 21.0 38.0 135-139 32.982150000000004 38.0 33.2 38.0 15.0 38.0 140-144 32.501 37.2 33.0 38.0 14.4 38.0 145-149 31.771949999999997 37.0 32.6 38.0 11.4 38.0 150-151 27.262875 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 2.0 15 5.0 16 3.0 17 3.0 18 5.0 19 11.0 20 7.0 21 10.0 22 13.0 23 14.0 24 23.0 25 21.0 26 17.0 27 35.0 28 45.0 29 46.0 30 66.0 31 94.0 32 107.0 33 151.0 34 237.0 35 386.0 36 1002.0 37 1693.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.86224489795919 12.704081632653061 10.10204081632653 35.33163265306122 2 22.375 14.374999999999998 32.4 30.85 3 20.5 17.2 27.0 35.3 4 23.05 25.0 24.125 27.825 5 22.55 31.724999999999998 23.35 22.375 6 19.7 35.175 23.325000000000003 21.8 7 14.799999999999999 27.975 39.175 18.05 8 17.549999999999997 27.150000000000002 31.15 24.15 9 16.775000000000002 26.6 34.275 22.35 10-14 19.54 29.360000000000003 28.044999999999998 23.055 15-19 19.85 28.665000000000003 28.000000000000004 23.485 20-24 19.99 29.145 27.855 23.01 25-29 19.8 29.244999999999997 27.215 23.74 30-34 19.7 28.970000000000002 28.02 23.31 35-39 19.735 28.655 27.305 24.305 40-44 19.509999999999998 29.17 27.215 24.104999999999997 45-49 20.14 28.525 27.43 23.905 50-54 20.380000000000003 28.77 26.905 23.945 55-59 20.055 28.785 27.334999999999997 23.825 60-64 19.755 28.544999999999998 27.235 24.465 65-69 20.185 28.265 27.26 24.29 70-74 20.36 28.935 27.189999999999998 23.515 75-79 20.265 28.265 27.965 23.505000000000003 80-84 20.205000000000002 29.195 27.235 23.365 85-89 20.150000000000002 28.365000000000002 27.82 23.665 90-94 20.345 28.365000000000002 27.425 23.865 95-99 20.19 28.155 27.83 23.825 100-104 20.72 28.194999999999997 27.534999999999997 23.549999999999997 105-109 20.445 28.075 28.050000000000004 23.43 110-114 20.21 27.700000000000003 27.87 24.22 115-119 20.41 28.199999999999996 27.92 23.47 120-124 20.24 27.675 27.900000000000002 24.185000000000002 125-129 20.369999999999997 27.54 27.46 24.63 130-134 21.13 27.084999999999997 28.24 23.544999999999998 135-139 21.01 27.855 27.229999999999997 23.905 140-144 20.78 27.435 27.73 24.055 145-149 20.965 28.139999999999997 27.71 23.185 150-151 20.7875 28.875 27.187499999999996 23.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 2.0 25 4.0 26 5.5 27 8.5 28 10.0 29 16.0 30 24.0 31 33.0 32 40.5 33 49.5 34 65.5 35 72.5 36 84.5 37 96.0 38 112.0 39 146.5 40 172.0 41 205.0 42 239.0 43 259.0 44 261.0 45 258.0 46 274.5 47 258.0 48 216.5 49 210.0 50 192.0 51 148.0 52 120.0 53 99.0 54 78.0 55 60.0 56 45.5 57 34.0 58 24.5 59 16.0 60 10.5 61 10.0 62 9.0 63 8.0 64 6.0 65 2.0 66 0.5 67 1.0 68 1.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0125 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.0875 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.8374999999999999 0.0 0.0 0.0 0.0 134-135 0.9625 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138-139 1.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169082 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169082_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6925 33.0 33.0 34.0 32.0 34.0 2 32.8855 33.0 33.0 34.0 32.0 34.0 3 32.9115 34.0 33.0 34.0 32.0 34.0 4 32.87775 34.0 33.0 34.0 32.0 34.0 5 32.80625 34.0 33.0 34.0 32.0 34.0 6 37.0845 38.0 38.0 38.0 37.0 38.0 7 37.061 38.0 38.0 38.0 37.0 38.0 8 37.081 38.0 38.0 38.0 37.0 38.0 9 37.0745 38.0 38.0 38.0 37.0 38.0 10-14 37.039049999999996 38.0 38.0 38.0 36.8 38.0 15-19 36.98905 38.0 38.0 38.0 36.4 38.0 20-24 36.92725 38.0 38.0 38.0 36.4 38.0 25-29 36.96 38.0 38.0 38.0 36.6 38.0 30-34 36.8999 38.0 38.0 38.0 36.2 38.0 35-39 36.920899999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.81845 38.0 38.0 38.0 36.0 38.0 45-49 36.83425 38.0 38.0 38.0 36.0 38.0 50-54 36.79395 38.0 38.0 38.0 36.0 38.0 55-59 36.72635 38.0 38.0 38.0 36.0 38.0 60-64 36.77685 38.0 38.0 38.0 36.0 38.0 65-69 36.717150000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.6062 38.0 38.0 38.0 35.2 38.0 75-79 36.6 38.0 38.0 38.0 35.2 38.0 80-84 36.468849999999996 38.0 38.0 38.0 34.6 38.0 85-89 36.4562 38.0 38.0 38.0 34.6 38.0 90-94 36.3995 38.0 38.0 38.0 34.4 38.0 95-99 36.1755 38.0 38.0 38.0 34.0 38.0 100-104 36.0828 38.0 38.0 38.0 33.6 38.0 105-109 36.018600000000006 38.0 38.0 38.0 33.6 38.0 110-114 35.808749999999996 38.0 38.0 38.0 33.0 38.0 115-119 35.71325 38.0 37.6 38.0 32.4 38.0 120-124 35.5253 38.0 37.0 38.0 31.2 38.0 125-129 35.32115 38.0 36.8 38.0 29.6 38.0 130-134 35.12935 38.0 36.2 38.0 29.2 38.0 135-139 34.8309 38.0 36.0 38.0 27.8 38.0 140-144 34.39025 38.0 35.4 38.0 25.2 38.0 145-149 33.72055 38.0 35.0 38.0 19.4 38.0 150-151 29.9535 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 2.0 6 4.0 7 2.0 8 2.0 9 2.0 10 3.0 11 2.0 12 3.0 13 4.0 14 2.0 15 6.0 16 3.0 17 7.0 18 3.0 19 8.0 20 6.0 21 6.0 22 14.0 23 10.0 24 15.0 25 19.0 26 16.0 27 29.0 28 32.0 29 43.0 30 40.0 31 53.0 32 69.0 33 95.0 34 120.0 35 205.0 36 439.0 37 2726.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.15 24.275 13.5 25.074999999999996 2 28.557139284821204 27.25681420355089 27.206801700425103 16.9792448112028 3 21.42142142142142 28.203203203203202 29.604604604604607 20.77077077077077 4 23.3 33.825 24.575 18.3 5 24.575 35.55 22.05 17.825 6 21.775 35.55 23.599999999999998 19.075 7 19.725 22.5 38.25 19.525000000000002 8 23.075000000000003 26.05 27.025 23.849999999999998 9 22.125 25.900000000000002 28.875 23.1 10-14 23.565 29.49 26.125 20.82 15-19 23.435 28.185 27.245 21.135 20-24 23.35 28.275 26.86 21.515 25-29 23.73 28.18 26.950000000000003 21.14 30-34 23.369999999999997 27.744999999999997 27.665 21.22 35-39 23.54 28.95 27.13 20.380000000000003 40-44 24.435000000000002 28.055000000000003 26.44 21.07 45-49 23.47 28.775000000000002 26.950000000000003 20.805 50-54 24.29 27.985 27.125 20.599999999999998 55-59 24.365000000000002 28.139999999999997 27.195000000000004 20.3 60-64 23.825 28.175 27.505000000000003 20.495 65-69 24.035 27.779999999999998 27.255000000000003 20.93 70-74 23.93 27.875 27.57 20.625 75-79 23.410534740633285 27.347306287829525 28.02261017457856 21.21954879695863 80-84 23.7 28.265 27.655 20.380000000000003 85-89 23.845 28.165000000000003 27.105 20.885 90-94 23.39 28.165000000000003 27.075 21.37 95-99 23.77 27.834999999999997 27.58 20.815 100-104 23.575 27.894999999999996 27.775 20.755000000000003 105-109 23.87 27.589999999999996 27.689999999999998 20.849999999999998 110-114 23.93 27.97 27.57 20.53 115-119 24.38 27.889999999999997 27.1 20.630000000000003 120-124 23.955000000000002 28.03 27.72 20.294999999999998 125-129 23.79 27.860000000000003 27.58 20.77 130-134 24.055 27.73 27.525 20.69 135-139 24.375 27.455000000000002 27.525 20.645 140-144 23.885 27.625 27.925 20.565 145-149 24.22419411440317 27.753546899283098 27.5329623502281 20.489296636085626 150-151 24.046330101976583 27.697343572957323 27.634395064836966 20.621931260229132 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 3.0 27 4.0 28 4.0 29 7.0 30 8.5 31 8.0 32 9.0 33 15.0 34 28.0 35 46.0 36 73.0 37 94.0 38 120.0 39 164.5 40 207.5 41 237.5 42 258.0 43 261.5 44 287.5 45 314.5 46 300.0 47 276.5 48 245.0 49 208.5 50 168.0 51 143.5 52 132.0 53 104.0 54 72.5 55 51.0 56 38.0 57 31.0 58 23.5 59 16.0 60 8.5 61 5.5 62 3.5 63 3.5 64 4.0 65 2.5 66 1.0 67 1.0 68 2.0 69 2.5 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.045 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.265 150-151 0.7125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0125 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.0875 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.5249999999999999 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.85 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138-139 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCACT 10 0.0065806094 146.79747 1 >>END_MODULE Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra Read 848249 spots for SRR7169082.sra Written 848249 spots for SRR7169082.sra Read 848242 spots for SRR7169082.sra Written 848242 spots for SRR7169082.sra SRR ids: ['SRR7169082.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kgy4zunz SRR7169082.sra spots: 16964847 blocks: [[1, 848242], [848243, 1696484], [1696485, 2544726], [2544727, 3392968], [3392969, 4241210], [4241211, 5089452], [5089453, 5937694], [5937695, 6785936], [6785937, 7634178], [7634179, 8482420], [8482421, 9330662], [9330663, 10178904], [10178905, 11027146], [11027147, 11875388], [11875389, 12723630], [12723631, 13571872], [13571873, 14420114], [14420115, 15268356], [15268357, 16116598], [16116599, 16964847]] SRR7169082 file size 5727129 SRR7169082 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169082 SRR7169082_1.fastq SRR7169082_2.fastq Input file: SRR7169082_1.fastq Paired file: SRR7169082_2.fastq trimmed: SRR7169082-trimmed-pair1.fastq, SRR7169082-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:35:07 2025 >> started Mon Feb 10 19:35:28 2025 >> done (21.170s) 16964847 read pairs processed; of these: 22147 ( 0.13%) short read pairs filtered out after trimming by size control 12930 ( 0.08%) empty read pairs filtered out after trimming by size control 16929770 (99.79%) read pairs available; of these: 7503884 (44.32%) trimmed read pairs available after processing 9425886 (55.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 10 0.00% 20 7 0.00% 21 5 0.00% 22 10 0.00% 23 3 0.00% 24 2 0.00% 25 7 0.00% 26 8 0.00% 27 8 0.00% 28 13 0.00% 29 4 0.00% 30 14 0.00% 31 6 0.00% 32 6 0.00% 33 9 0.00% 34 13 0.00% 35 6 0.00% 36 9 0.00% 37 16 0.00% 38 12 0.00% 39 7 0.00% 40 14 0.00% 41 17 0.00% 42 23 0.00% 43 25 0.00% 44 28 0.00% 45 22 0.00% 46 22 0.00% 47 24 0.00% 48 24 0.00% 49 32 0.00% 50 34 0.00% 51 29 0.00% 52 32 0.00% 53 54 0.00% 54 51 0.00% 55 51 0.00% 56 63 0.00% 57 62 0.00% 58 64 0.00% 59 82 0.00% 60 94 0.00% 61 106 0.00% 62 110 0.00% 63 118 0.00% 64 132 0.00% 65 167 0.00% 66 153 0.00% 67 171 0.00% 68 193 0.00% 69 246 0.00% 70 240 0.00% 71 246 0.00% 72 302 0.00% 73 340 0.00% 74 357 0.00% 75 390 0.00% 76 425 0.00% 77 476 0.00% 78 562 0.00% 79 581 0.00% 80 626 0.00% 81 763 0.00% 82 813 0.00% 83 1014 0.01% 84 2027 0.01% 85 2737 0.02% 86 2732 0.02% 87 2906 0.02% 88 3071 0.02% 89 3251 0.02% 90 3195 0.02% 91 3152 0.02% 92 3331 0.02% 93 3459 0.02% 94 3685 0.02% 95 3820 0.02% 96 4098 0.02% 97 4389 0.03% 98 4652 0.03% 99 4856 0.03% 100 5172 0.03% 101 5490 0.03% 102 5793 0.03% 103 6174 0.04% 104 6805 0.04% 105 7117 0.04% 106 7711 0.05% 107 8153 0.05% 108 8587 0.05% 109 9162 0.05% 110 9572 0.06% 111 10153 0.06% 112 10910 0.06% 113 11641 0.07% 114 12276 0.07% 115 13100 0.08% 116 13881 0.08% 117 15178 0.09% 118 15995 0.09% 119 16778 0.10% 120 17703 0.10% 121 18528 0.11% 122 19817 0.12% 123 20801 0.12% 124 22749 0.13% 125 23983 0.14% 126 25751 0.15% 127 27539 0.16% 128 29099 0.17% 129 30956 0.18% 130 33730 0.20% 131 36156 0.21% 132 39013 0.23% 133 42158 0.25% 134 45262 0.27% 135 48949 0.29% 136 52964 0.31% 137 58748 0.35% 138 66042 0.39% 139 72806 0.43% 140 81149 0.48% 141 89510 0.53% 142 104196 0.62% 143 113590 0.67% 144 132812 0.78% 145 161968 0.96% 146 204387 1.21% 147 282827 1.67% 148 436547 2.58% 149 889696 5.26% 150 4009884 23.69% 151 9425886 55.68% 16929770 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=37 prefix-density=0.20 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=108.56 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=17.0 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=18.95 fanout-score-rank=9 prefix-density=0.45 prefix-fanout=7.6 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=279.12 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=29.7 sequence=AAGAAGAAGAAA SRR7169082 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:36:52 Started mapping on | Feb 10 19:36:52 Finished on | Feb 10 19:39:08 Mapping speed, Million of reads per hour | 448.14 Number of input reads | 16929770 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15686427 Uniquely mapped reads % | 92.66% Average mapped length | 296.69 Number of splices: Total | 15063830 Number of splices: Annotated (sjdb) | 14821262 Number of splices: GT/AG | 14839460 Number of splices: GC/AG | 178526 Number of splices: AT/AC | 11962 Number of splices: Non-canonical | 33882 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307540 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 35905 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.27% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 957704 957704 957704 N_multimapping 307540 307540 307540 N_noFeature 296194 15514880 360985 N_ambiguous 168745 870 61373 UnstrandedReadsAssigned:15221488 PositiveStrandReadsAssigned:170677 NegativeStrandReadsAssigned:15264069 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169082 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169082-trimmed-pair1.fastq SRR7169082-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,929,770 reads, 15,184,748 reads pseudoaligned [quant] estimated average fragment length: 269.348 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7169082.ke.tsv 34699 SRR7169082.se.tsv 87100 total ==> SRR7169082.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.65 282 8.76648 Potri.005G024800.1.v4.1 1035 766.652 48 3.40542 Potri.004G059700.1.v4.1 961 692.678 9 0.706707 Potri.007G009000.2.v4.1 1416 1147.65 0 0 Potri.003G141000.2.v4.1 2943 2674.65 348.086 7.07859 Potri.016G087400.1.v4.1 270 60.75 1591 1424.47 Potri.015G069301.1.v4.1 564 300.105 0 0 Potri.010G195200.1.v4.1 1773 1504.65 33 1.19291 Potri.012G127500.1.v4.1 977 708.665 10668 818.785 ==> SRR7169082.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1161 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169082 completed mapping pipeline successfully