Starting /dee2/code/volunteer_pipeline.sh SRR7169083 current disk space = 3056703143936 free memory = 927910856 SRR7169083 SRAfilesize d337340a3f406816a8e3d90998574c53 SRR7169083.sra SRR7169083.sra file validated SRR7169083 is paired end SRR7169083 is conventional basespace SRR7169083 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169083_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76 34.0 33.0 34.0 32.0 34.0 2 33.287 34.0 33.0 34.0 33.0 34.0 3 33.28925 34.0 33.0 34.0 33.0 34.0 4 33.3735 34.0 33.0 34.0 33.0 34.0 5 33.39925 34.0 33.0 34.0 33.0 34.0 6 36.8875 38.0 37.0 38.0 35.0 38.0 7 37.26575 38.0 38.0 38.0 36.0 38.0 8 37.3875 38.0 38.0 38.0 37.0 38.0 9 37.424 38.0 38.0 38.0 37.0 38.0 10-14 37.45005 38.0 38.0 38.0 37.4 38.0 15-19 37.3493 38.0 38.0 38.0 37.0 38.0 20-24 37.35685 38.0 38.0 38.0 37.0 38.0 25-29 37.3227 38.0 38.0 38.0 37.0 38.0 30-34 37.2522 38.0 38.0 38.0 37.0 38.0 35-39 37.141 38.0 38.0 38.0 36.8 38.0 40-44 36.99285 38.0 38.0 38.0 36.0 38.0 45-49 36.8845 38.0 38.0 38.0 35.6 38.0 50-54 36.79165 38.0 38.0 38.0 34.8 38.0 55-59 36.70855 38.0 38.0 38.0 34.8 38.0 60-64 36.6533 38.0 38.0 38.0 34.2 38.0 65-69 36.577 38.0 38.0 38.0 34.2 38.0 70-74 36.530649999999994 38.0 38.0 38.0 34.0 38.0 75-79 36.353899999999996 38.0 38.0 38.0 33.8 38.0 80-84 36.2658 38.0 37.2 38.0 33.4 38.0 85-89 36.1053 38.0 37.0 38.0 33.2 38.0 90-94 35.863749999999996 38.0 37.0 38.0 31.8 38.0 95-99 35.7239 38.0 37.0 38.0 31.0 38.0 100-104 35.62695 38.0 37.0 38.0 31.0 38.0 105-109 35.3483 38.0 36.2 38.0 29.4 38.0 110-114 35.16715 38.0 36.0 38.0 28.4 38.0 115-119 34.972249999999995 38.0 35.6 38.0 27.8 38.0 120-124 34.67274999999999 38.0 35.0 38.0 26.8 38.0 125-129 34.3192 38.0 34.8 38.0 24.6 38.0 130-134 33.9111 38.0 34.0 38.0 23.0 38.0 135-139 33.44515 38.0 34.0 38.0 19.8 38.0 140-144 32.95975 38.0 34.0 38.0 14.8 38.0 145-149 32.213699999999996 38.0 33.0 38.0 11.4 38.0 150-151 28.013375 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 3.0 13 1.0 14 2.0 15 1.0 16 6.0 17 2.0 18 9.0 19 7.0 20 8.0 21 10.0 22 16.0 23 13.0 24 18.0 25 20.0 26 31.0 27 32.0 28 49.0 29 50.0 30 49.0 31 65.0 32 90.0 33 138.0 34 208.0 35 349.0 36 792.0 37 2029.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.6289500509684 12.89500509683996 8.307849133537207 35.16819571865443 2 22.400000000000002 14.899999999999999 34.5 28.199999999999996 3 18.15 20.875 26.950000000000003 34.025 4 21.95 28.225 24.775 25.05 5 23.225 31.474999999999998 25.55 19.75 6 19.35 34.55 25.05 21.05 7 14.05 27.6 41.375 16.975 8 19.400000000000002 25.924999999999997 30.175 24.5 9 17.549999999999997 24.15 33.675 24.625 10-14 20.560000000000002 29.87 26.200000000000003 23.369999999999997 15-19 19.98 29.104999999999997 27.51 23.405 20-24 20.085 28.675 27.725 23.515 25-29 20.16 29.054999999999996 27.66 23.125 30-34 20.165 28.415000000000003 27.700000000000003 23.72 35-39 20.125 28.994999999999997 27.315 23.565 40-44 20.18 28.79 27.855 23.175 45-49 20.09 28.54 27.365000000000002 24.005000000000003 50-54 20.195 28.595 27.33 23.880000000000003 55-59 20.169999999999998 28.810000000000002 27.42 23.599999999999998 60-64 20.125 28.744999999999997 28.02 23.11 65-69 19.830000000000002 28.005000000000003 28.22 23.945 70-74 20.285 28.955 27.005000000000003 23.755000000000003 75-79 20.22 28.754999999999995 27.3 23.724999999999998 80-84 19.965 28.92 27.49 23.625 85-89 20.22 29.255 27.52 23.005 90-94 20.44 28.18 27.01 24.37 95-99 21.08 28.005000000000003 27.32 23.595 100-104 20.525 28.255000000000003 27.455000000000002 23.765 105-109 20.825 28.33 27.505000000000003 23.34 110-114 20.465 28.794999999999998 26.924999999999997 23.815 115-119 20.935000000000002 28.23 27.13 23.705000000000002 120-124 20.41 28.749999999999996 27.195000000000004 23.645 125-129 20.015 28.255000000000003 27.6 24.13 130-134 21.04105205260263 28.061403070153506 27.466373318665934 23.43117155857793 135-139 20.73603680184009 27.92139606980349 28.0114005700285 23.33116655832792 140-144 20.735 28.03 27.815 23.419999999999998 145-149 20.655 28.02 27.655 23.669999999999998 150-151 22.05 27.650000000000002 27.4125 22.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.5 24 4.0 25 5.0 26 6.0 27 7.0 28 8.0 29 9.0 30 19.0 31 32.0 32 36.0 33 43.0 34 53.0 35 65.5 36 85.5 37 102.0 38 126.0 39 156.5 40 175.5 41 199.5 42 239.5 43 253.5 44 261.0 45 293.5 46 282.5 47 257.5 48 250.0 49 218.0 50 175.0 51 136.5 52 112.0 53 94.5 54 72.0 55 58.5 56 45.5 57 30.5 58 22.5 59 16.5 60 10.5 61 6.5 62 5.0 63 3.0 64 1.5 65 1.5 66 2.5 67 2.0 68 1.5 69 2.5 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.5031446540880503 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025157232704402514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 20 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.3624999999999998 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCAC 10 0.006832588 144.9875 9 AGATGTA 10 0.006832588 144.9875 4 AGATCGG 10 0.006832588 144.9875 145 >>END_MODULE SRR7169083 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169083_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.523 33.0 33.0 34.0 32.0 34.0 2 32.6705 33.0 33.0 34.0 32.0 34.0 3 32.74425 33.0 33.0 34.0 32.0 34.0 4 32.63375 33.0 33.0 34.0 32.0 34.0 5 32.66475 34.0 33.0 34.0 32.0 34.0 6 36.8365 38.0 38.0 38.0 36.0 38.0 7 36.852 38.0 38.0 38.0 36.0 38.0 8 36.8735 38.0 38.0 38.0 36.0 38.0 9 36.8965 38.0 38.0 38.0 36.0 38.0 10-14 36.851299999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.7936 38.0 38.0 38.0 36.0 38.0 20-24 36.7911 38.0 38.0 38.0 36.0 38.0 25-29 36.7913 38.0 38.0 38.0 36.0 38.0 30-34 36.7903 38.0 38.0 38.0 36.0 38.0 35-39 36.70380000000001 38.0 38.0 38.0 35.6 38.0 40-44 36.5997 38.0 38.0 38.0 35.4 38.0 45-49 36.6429 38.0 38.0 38.0 35.2 38.0 50-54 36.633500000000005 38.0 38.0 38.0 35.2 38.0 55-59 36.606350000000006 38.0 38.0 38.0 35.2 38.0 60-64 36.5275 38.0 38.0 38.0 35.0 38.0 65-69 36.55055 38.0 38.0 38.0 35.0 38.0 70-74 36.38915 38.0 38.0 38.0 34.2 38.0 75-79 36.2909 38.0 38.0 38.0 34.0 38.0 80-84 36.25275 38.0 38.0 38.0 34.0 38.0 85-89 36.195800000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.09175 38.0 38.0 38.0 33.6 38.0 95-99 35.8446 38.0 38.0 38.0 32.6 38.0 100-104 35.769999999999996 38.0 38.0 38.0 32.2 38.0 105-109 35.6288 38.0 37.6 38.0 31.4 38.0 110-114 35.47975 38.0 37.0 38.0 30.6 38.0 115-119 35.39835000000001 38.0 37.0 38.0 30.4 38.0 120-124 35.197900000000004 38.0 37.0 38.0 28.6 38.0 125-129 34.86055 38.0 36.2 38.0 27.4 38.0 130-134 34.589549999999996 38.0 36.0 38.0 25.8 38.0 135-139 34.273649999999996 38.0 35.2 38.0 23.8 38.0 140-144 33.9075 38.0 35.0 38.0 21.8 38.0 145-149 33.227 38.0 34.8 38.0 16.6 38.0 150-151 29.376375 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 2.0 5 1.0 6 1.0 7 2.0 8 1.0 9 3.0 10 3.0 11 4.0 12 1.0 13 2.0 14 5.0 15 3.0 16 9.0 17 13.0 18 4.0 19 9.0 20 15.0 21 6.0 22 18.0 23 21.0 24 22.0 25 23.0 26 33.0 27 39.0 28 33.0 29 39.0 30 42.0 31 60.0 32 62.0 33 85.0 34 136.0 35 212.0 36 457.0 37 2621.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.484871217804454 22.330582645661416 10.927731932983246 27.25681420355089 2 26.78169542385596 27.85696424106027 29.03225806451613 16.32908227056764 3 19.35483870967742 29.182295573893473 32.23305826456614 19.229807451862964 4 22.25 34.599999999999994 23.9 19.25 5 23.9 35.5 22.85 17.75 6 20.175 38.475 23.599999999999998 17.75 7 20.5 23.05 36.425000000000004 20.025000000000002 8 20.549999999999997 25.3 28.499999999999996 25.650000000000002 9 21.575 25.775 29.975 22.675 10-14 23.485 28.76 26.619999999999997 21.135 15-19 23.625 27.889999999999997 27.32 21.165 20-24 23.03 28.46 27.425 21.085 25-29 23.990000000000002 28.535 26.915 20.560000000000002 30-34 23.01 28.305000000000003 27.505000000000003 21.18 35-39 22.845 28.73 27.455000000000002 20.97 40-44 22.99 28.799999999999997 27.26 20.95 45-49 23.505000000000003 28.09 27.13 21.275 50-54 23.47 28.310000000000002 27.794999999999998 20.424999999999997 55-59 23.105 28.749999999999996 27.455000000000002 20.69 60-64 22.85 27.884999999999998 28.04 21.224999999999998 65-69 24.099999999999998 27.765 27.79 20.345 70-74 23.335 27.744999999999997 27.47 21.45 75-79 23.301310917642347 27.63434404082858 27.574302011407987 21.490043030121083 80-84 23.075000000000003 27.860000000000003 27.985 21.08 85-89 23.405 27.74 28.215 20.64 90-94 23.115 27.915 28.08 20.89 95-99 23.455000000000002 27.339999999999996 28.435 20.77 100-104 23.845 27.389999999999997 27.755000000000003 21.01 105-109 23.49 27.66 28.43 20.419999999999998 110-114 23.905 27.310000000000002 28.060000000000002 20.724999999999998 115-119 23.72 27.49 28.37 20.419999999999998 120-124 23.735 27.72 28.060000000000002 20.485 125-129 23.605 27.405 28.125 20.865000000000002 130-134 24.065 27.584999999999997 27.52 20.830000000000002 135-139 23.815 27.785 27.61 20.79 140-144 23.845 27.325 27.88 20.95 145-149 23.805225414974174 27.53121709041673 27.852163883456193 20.8113936111529 150-151 24.232511323603422 27.554101660795165 28.447408152994463 19.765978862606946 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 3.5 25 2.0 26 1.5 27 2.5 28 4.5 29 5.0 30 10.5 31 17.5 32 20.5 33 27.5 34 38.5 35 52.0 36 75.0 37 98.5 38 128.0 39 167.0 40 200.5 41 234.0 42 265.0 43 293.0 44 302.5 45 288.5 46 282.5 47 268.5 48 237.0 49 217.0 50 177.0 51 127.0 52 99.0 53 86.5 54 73.0 55 51.0 56 38.0 57 27.5 58 22.5 59 15.5 60 7.0 61 5.5 62 4.0 63 5.0 64 5.0 65 4.0 66 3.5 67 1.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.06999999999999999 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.295 150-151 0.65 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59788891681328 99.075 2 0.3518471977883891 0.7000000000000001 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025131942699170642 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.9125000000000001 0.0 0.0 0.0 0.0 130-131 1.0125 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCGG 10 0.0065806094 146.79747 145 GGAATAC 10 0.006836113 144.9625 5 TTTTTTT 20 0.005942617 28.992498 85-89 >>END_MODULE Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895608 spots for SRR7169083.sra Written 895608 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra Read 895604 spots for SRR7169083.sra Written 895604 spots for SRR7169083.sra SRR ids: ['SRR7169083.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3t4hbg_a SRR7169083.sra spots: 17912084 blocks: [[1, 895604], [895605, 1791208], [1791209, 2686812], [2686813, 3582416], [3582417, 4478020], [4478021, 5373624], [5373625, 6269228], [6269229, 7164832], [7164833, 8060436], [8060437, 8956040], [8956041, 9851644], [9851645, 10747248], [10747249, 11642852], [11642853, 12538456], [12538457, 13434060], [13434061, 14329664], [14329665, 15225268], [15225269, 16120872], [16120873, 17016476], [17016477, 17912084]] SRR7169083 file size 6048117 SRR7169083 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169083 SRR7169083_1.fastq SRR7169083_2.fastq Input file: SRR7169083_1.fastq Paired file: SRR7169083_2.fastq trimmed: SRR7169083-trimmed-pair1.fastq, SRR7169083-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:34:38 2025 >> started Mon Feb 10 19:35:00 2025 >> done (21.894s) 17912084 read pairs processed; of these: 18956 ( 0.11%) short read pairs filtered out after trimming by size control 48561 ( 0.27%) empty read pairs filtered out after trimming by size control 17844567 (99.62%) read pairs available; of these: 7603184 (42.61%) trimmed read pairs available after processing 10241383 (57.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 9 0.00% 21 7 0.00% 22 4 0.00% 23 10 0.00% 24 9 0.00% 25 12 0.00% 26 7 0.00% 27 15 0.00% 28 11 0.00% 29 4 0.00% 30 18 0.00% 31 9 0.00% 32 11 0.00% 33 13 0.00% 34 7 0.00% 35 8 0.00% 36 12 0.00% 37 11 0.00% 38 10 0.00% 39 22 0.00% 40 17 0.00% 41 29 0.00% 42 13 0.00% 43 25 0.00% 44 40 0.00% 45 24 0.00% 46 37 0.00% 47 40 0.00% 48 36 0.00% 49 37 0.00% 50 48 0.00% 51 52 0.00% 52 62 0.00% 53 46 0.00% 54 57 0.00% 55 61 0.00% 56 82 0.00% 57 99 0.00% 58 80 0.00% 59 117 0.00% 60 97 0.00% 61 129 0.00% 62 142 0.00% 63 162 0.00% 64 193 0.00% 65 256 0.00% 66 222 0.00% 67 203 0.00% 68 225 0.00% 69 310 0.00% 70 323 0.00% 71 291 0.00% 72 362 0.00% 73 387 0.00% 74 422 0.00% 75 451 0.00% 76 538 0.00% 77 515 0.00% 78 598 0.00% 79 660 0.00% 80 757 0.00% 81 930 0.01% 82 1107 0.01% 83 1266 0.01% 84 2029 0.01% 85 2662 0.01% 86 2626 0.01% 87 2811 0.02% 88 2935 0.02% 89 2986 0.02% 90 3149 0.02% 91 3344 0.02% 92 3534 0.02% 93 3709 0.02% 94 3854 0.02% 95 4187 0.02% 96 4359 0.02% 97 4678 0.03% 98 4877 0.03% 99 5259 0.03% 100 5561 0.03% 101 5751 0.03% 102 6403 0.04% 103 6629 0.04% 104 7134 0.04% 105 7566 0.04% 106 8075 0.05% 107 8468 0.05% 108 8866 0.05% 109 9442 0.05% 110 9925 0.06% 111 10955 0.06% 112 11426 0.06% 113 12178 0.07% 114 13119 0.07% 115 13900 0.08% 116 14699 0.08% 117 15751 0.09% 118 16658 0.09% 119 17402 0.10% 120 18425 0.10% 121 19548 0.11% 122 20840 0.12% 123 22364 0.13% 124 23851 0.13% 125 25677 0.14% 126 27166 0.15% 127 29155 0.16% 128 30691 0.17% 129 32355 0.18% 130 35094 0.20% 131 37340 0.21% 132 40351 0.23% 133 43689 0.24% 134 46953 0.26% 135 51223 0.29% 136 55852 0.31% 137 61038 0.34% 138 68647 0.38% 139 74350 0.42% 140 82800 0.46% 141 92705 0.52% 142 106903 0.60% 143 116305 0.65% 144 135463 0.76% 145 162983 0.91% 146 203949 1.14% 147 280830 1.57% 148 424625 2.38% 149 861181 4.83% 150 4092161 22.93% 151 10241383 57.39% 17844567 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=314.51 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=37 prefix-density=0.30 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=234.06 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=25.6 sequence=GAAGAAGAAGAAA SRR7169083 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:35:56 Started mapping on | Feb 10 19:35:56 Finished on | Feb 10 19:37:44 Mapping speed, Million of reads per hour | 594.82 Number of input reads | 17844567 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16956844 Uniquely mapped reads % | 95.03% Average mapped length | 296.72 Number of splices: Total | 16667085 Number of splices: Annotated (sjdb) | 16392437 Number of splices: GT/AG | 16421251 Number of splices: GC/AG | 198916 Number of splices: AT/AC | 13376 Number of splices: Non-canonical | 33542 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320325 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 12096 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 587129 587129 587129 N_multimapping 320325 320325 320325 N_noFeature 369201 16774690 448407 N_ambiguous 172646 937 69099 UnstrandedReadsAssigned:16414997 PositiveStrandReadsAssigned:181217 NegativeStrandReadsAssigned:16439338 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169083 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169083-trimmed-pair1.fastq SRR7169083-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,844,567 reads, 16,324,137 reads pseudoaligned [quant] estimated average fragment length: 276.66 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7169083.ke.tsv 34699 SRR7169083.se.tsv 87100 total ==> SRR7169083.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.34 327 10.55 Potri.005G024800.1.v4.1 1035 759.34 42 3.10921 Potri.004G059700.1.v4.1 961 685.471 1 0.0820064 Potri.007G009000.2.v4.1 1416 1140.34 0 0 Potri.003G141000.2.v4.1 2943 2667.34 389.038 8.19881 Potri.016G087400.1.v4.1 270 61.0247 1403.56 1292.89 Potri.015G069301.1.v4.1 564 296.41 0 0 Potri.010G195200.1.v4.1 1773 1497.34 18 0.675754 Potri.012G127500.1.v4.1 977 701.435 6194 496.387 ==> SRR7169083.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1015 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169083 completed mapping pipeline successfully