Starting /dee2/code/volunteer_pipeline.sh SRR7169084 current disk space = 3056117919744 free memory = 1505195416 SRR7169084 SRAfilesize a063a83be92eaf99b65c54ede457c4b8 SRR7169084.sra SRR7169084.sra file validated SRR7169084 is paired end SRR7169084 is conventional basespace SRR7169084 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169084_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80025 34.0 33.0 34.0 33.0 34.0 2 33.3545 34.0 33.0 34.0 33.0 34.0 3 33.33575 34.0 34.0 34.0 33.0 34.0 4 33.4085 34.0 34.0 34.0 33.0 34.0 5 33.4465 34.0 34.0 34.0 33.0 34.0 6 36.9305 38.0 37.0 38.0 35.0 38.0 7 37.33825 38.0 38.0 38.0 37.0 38.0 8 37.4345 38.0 38.0 38.0 37.0 38.0 9 37.476 38.0 38.0 38.0 37.0 38.0 10-14 37.449349999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.379599999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.4148 38.0 38.0 38.0 37.0 38.0 25-29 37.35765 38.0 38.0 38.0 37.0 38.0 30-34 37.2906 38.0 38.0 38.0 37.0 38.0 35-39 37.19495 38.0 38.0 38.0 36.6 38.0 40-44 37.00305000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.7856 38.0 38.0 38.0 34.8 38.0 50-54 36.6916 38.0 38.0 38.0 34.4 38.0 55-59 36.5892 38.0 38.0 38.0 34.0 38.0 60-64 36.5159 38.0 38.0 38.0 34.0 38.0 65-69 36.535199999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.39934999999999 38.0 37.4 38.0 34.0 38.0 75-79 36.32215000000001 38.0 37.0 38.0 33.8 38.0 80-84 36.142 38.0 37.0 38.0 33.0 38.0 85-89 36.037099999999995 38.0 37.0 38.0 33.0 38.0 90-94 35.7739 38.0 37.0 38.0 31.2 38.0 95-99 35.68285 38.0 36.8 38.0 31.0 38.0 100-104 35.536950000000004 38.0 36.2 38.0 30.0 38.0 105-109 35.30185 38.0 36.0 38.0 29.0 38.0 110-114 35.12055 38.0 35.6 38.0 28.4 38.0 115-119 34.65859999999999 38.0 35.0 38.0 26.8 38.0 120-124 34.38505 38.0 34.8 38.0 25.4 38.0 125-129 34.1411 38.0 34.4 38.0 24.2 38.0 130-134 33.655550000000005 38.0 34.0 38.0 21.0 38.0 135-139 33.0672 38.0 33.6 38.0 15.0 38.0 140-144 32.65945000000001 37.6 33.0 38.0 14.4 38.0 145-149 31.872300000000003 37.2 32.2 38.0 11.4 38.0 150-151 27.48375 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 2.0 14 2.0 15 2.0 16 6.0 17 1.0 18 4.0 19 10.0 20 4.0 21 7.0 22 12.0 23 16.0 24 18.0 25 19.0 26 26.0 27 30.0 28 45.0 29 53.0 30 49.0 31 93.0 32 108.0 33 136.0 34 231.0 35 410.0 36 999.0 37 1714.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.77387318563789 13.623631270690096 8.25057295645531 34.351922587216706 2 22.7 13.850000000000001 32.65 30.8 3 19.7 18.475 27.224999999999998 34.599999999999994 4 23.775 24.925 23.674999999999997 27.625 5 22.7 30.725 23.849999999999998 22.725 6 20.825 34.125 23.775 21.275 7 15.299999999999999 28.199999999999996 40.125 16.375 8 18.7 27.325 29.549999999999997 24.425 9 16.3 25.374999999999996 33.6 24.725 10-14 19.97 30.314999999999998 26.525 23.189999999999998 15-19 19.794999999999998 28.87 27.634999999999998 23.7 20-24 19.97 28.720000000000002 27.805000000000003 23.505000000000003 25-29 19.900000000000002 29.04 27.29 23.77 30-34 19.53 29.01 27.505000000000003 23.955000000000002 35-39 19.985 29.03 27.04 23.945 40-44 20.54 29.060000000000002 27.01 23.39 45-49 20.605 28.749999999999996 26.884999999999998 23.76 50-54 20.225 28.57 26.945000000000004 24.26 55-59 20.04 29.09 26.945000000000004 23.925 60-64 20.925 28.28 26.979999999999997 23.815 65-69 20.419999999999998 28.720000000000002 26.795 24.065 70-74 20.735 28.395 27.395000000000003 23.474999999999998 75-79 20.115 28.285 27.689999999999998 23.91 80-84 20.5 28.315 27.74 23.445 85-89 20.585 27.834999999999997 28.08 23.5 90-94 20.69 28.410000000000004 27.04 23.86 95-99 20.645 27.675 27.52 24.16 100-104 20.995 28.744999999999997 26.995 23.265 105-109 21.13 27.99 27.485 23.395 110-114 20.255000000000003 28.37 27.555000000000003 23.82 115-119 20.76 27.689999999999998 27.71 23.84 120-124 20.885 28.18 27.375 23.56 125-129 20.22 28.15 27.389999999999997 24.240000000000002 130-134 20.93104655232762 27.44637231861593 27.67138356917846 23.951197559877993 135-139 21.11105555277764 28.16640832041602 27.336366818340917 23.386169308465423 140-144 20.885 27.43 27.07 24.615000000000002 145-149 20.945 28.02 27.1 23.935000000000002 150-151 20.1625 27.9125 27.6625 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 1.0 19 1.5 20 1.0 21 0.0 22 0.5 23 1.5 24 1.5 25 3.0 26 7.0 27 7.5 28 7.5 29 12.5 30 19.5 31 25.0 32 31.0 33 39.0 34 52.5 35 65.5 36 85.5 37 104.0 38 118.5 39 151.5 40 182.5 41 213.5 42 227.5 43 239.5 44 264.5 45 263.0 46 260.5 47 255.5 48 228.5 49 199.5 50 176.0 51 156.5 52 140.5 53 108.5 54 76.0 55 61.5 56 43.5 57 39.5 58 38.0 59 25.0 60 15.5 61 9.0 62 7.5 63 6.0 64 4.0 65 3.0 66 3.0 67 3.5 68 3.5 69 2.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.7875 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0750000000000002 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169084 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169084_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75 33.0 33.0 34.0 32.0 34.0 2 32.8455 33.0 33.0 34.0 32.0 34.0 3 32.895 34.0 33.0 34.0 32.0 34.0 4 32.86975 34.0 33.0 34.0 32.0 34.0 5 32.8385 34.0 33.0 34.0 32.0 34.0 6 37.044 38.0 38.0 38.0 37.0 38.0 7 37.06775 38.0 38.0 38.0 37.0 38.0 8 37.10725 38.0 38.0 38.0 37.0 38.0 9 37.04 38.0 38.0 38.0 37.0 38.0 10-14 37.0322 38.0 38.0 38.0 36.8 38.0 15-19 37.0178 38.0 38.0 38.0 36.8 38.0 20-24 36.97815 38.0 38.0 38.0 36.4 38.0 25-29 36.9528 38.0 38.0 38.0 36.8 38.0 30-34 36.922000000000004 38.0 38.0 38.0 36.4 38.0 35-39 36.865249999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.7898 38.0 38.0 38.0 36.0 38.0 45-49 36.903 38.0 38.0 38.0 36.2 38.0 50-54 36.78115 38.0 38.0 38.0 35.8 38.0 55-59 36.7772 38.0 38.0 38.0 36.0 38.0 60-64 36.70395 38.0 38.0 38.0 36.0 38.0 65-69 36.71145 38.0 38.0 38.0 35.8 38.0 70-74 36.643550000000005 38.0 38.0 38.0 35.4 38.0 75-79 36.53189999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.4627 38.0 38.0 38.0 34.8 38.0 85-89 36.41975 38.0 38.0 38.0 34.4 38.0 90-94 36.33015 38.0 38.0 38.0 34.2 38.0 95-99 36.18335 38.0 38.0 38.0 34.0 38.0 100-104 36.1 38.0 38.0 38.0 34.0 38.0 105-109 35.91725 38.0 38.0 38.0 33.4 38.0 110-114 35.83395 38.0 38.0 38.0 32.6 38.0 115-119 35.6351 38.0 37.6 38.0 31.4 38.0 120-124 35.480399999999996 38.0 37.0 38.0 31.0 38.0 125-129 35.21040000000001 38.0 36.2 38.0 30.6 38.0 130-134 35.078250000000004 38.0 36.2 38.0 28.8 38.0 135-139 34.69625 38.0 36.0 38.0 27.4 38.0 140-144 34.289699999999996 38.0 35.4 38.0 24.4 38.0 145-149 33.621300000000005 38.0 35.0 38.0 19.4 38.0 150-151 29.955624999999998 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 6.0 4 1.0 5 2.0 6 0.0 7 3.0 8 1.0 9 2.0 10 2.0 11 1.0 12 5.0 13 3.0 14 5.0 15 5.0 16 6.0 17 5.0 18 4.0 19 4.0 20 4.0 21 9.0 22 8.0 23 20.0 24 17.0 25 11.0 26 16.0 27 20.0 28 31.0 29 32.0 30 47.0 31 65.0 32 69.0 33 98.0 34 123.0 35 205.0 36 476.0 37 2684.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.93423355838959 24.056014003500874 13.12828207051763 25.881470367591895 2 29.607401850462615 24.33108277069267 28.68217054263566 17.37934483620905 3 20.635317658829415 27.113556778389196 32.24112056028014 20.01000500250125 4 23.599999999999998 33.375 23.3 19.725 5 24.15 35.85 22.35 17.65 6 21.975 36.275 22.275 19.475 7 20.575 23.025000000000002 38.125 18.275 8 22.775000000000002 25.674999999999997 27.250000000000004 24.3 9 21.3 24.65 29.325000000000003 24.725 10-14 23.044999999999998 28.715000000000003 26.119999999999997 22.12 15-19 23.13 27.950000000000003 27.07 21.85 20-24 23.025000000000002 27.884999999999998 27.145000000000003 21.945 25-29 22.900000000000002 28.050000000000004 27.185 21.865000000000002 30-34 23.005 27.750000000000004 27.884999999999998 21.36 35-39 23.315 27.794999999999998 27.08 21.81 40-44 23.69 28.105000000000004 26.915 21.29 45-49 23.265 27.99 27.49 21.255 50-54 23.555 27.725 27.655 21.065 55-59 23.755000000000003 27.589999999999996 27.765 20.89 60-64 23.674999999999997 27.675 27.375 21.275 65-69 23.56 27.815 27.775 20.849999999999998 70-74 23.77 27.47 27.775 20.985 75-79 23.89955982392957 27.195878351340536 27.561024409763906 21.343537414965986 80-84 23.93 28.155 27.1 20.815 85-89 23.49 27.845 27.825 20.84 90-94 23.380000000000003 28.095 27.644999999999996 20.880000000000003 95-99 23.925 27.595 27.485 20.995 100-104 23.53 27.49 28.125 20.855 105-109 24.175 27.495000000000005 27.615000000000002 20.715 110-114 23.474999999999998 27.839999999999996 27.544999999999998 21.14 115-119 23.775 27.975 27.185 21.065 120-124 24.175 27.91 27.015 20.9 125-129 23.595 27.51 27.61 21.285 130-134 24.645 27.615000000000002 27.284999999999997 20.455000000000002 135-139 24.01 27.584999999999997 27.800000000000004 20.605 140-144 24.545 27.105 27.560000000000002 20.79 145-149 24.484988221141798 27.74297027717909 27.54749135381685 20.224550147862264 150-151 24.5093105183694 27.60442878711625 27.64217413185707 20.244086562657273 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.0 26 1.0 27 1.5 28 2.5 29 5.5 30 8.5 31 14.0 32 16.5 33 20.5 34 28.5 35 41.0 36 63.5 37 86.5 38 106.5 39 145.5 40 201.5 41 233.5 42 251.0 43 288.0 44 295.5 45 287.0 46 286.0 47 275.0 48 257.5 49 224.5 50 191.5 51 157.5 52 128.5 53 102.0 54 75.5 55 53.5 56 32.5 57 22.5 58 20.5 59 16.5 60 14.0 61 9.0 62 6.5 63 6.0 64 5.5 65 4.5 66 1.0 67 2.0 68 2.5 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.04 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.245 150-151 0.65 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0750000000000002 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825028 spots for SRR7169084.sra Written 825028 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra Read 825020 spots for SRR7169084.sra Written 825020 spots for SRR7169084.sra SRR ids: ['SRR7169084.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mf64dh3c SRR7169084.sra spots: 16500408 blocks: [[1, 825020], [825021, 1650040], [1650041, 2475060], [2475061, 3300080], [3300081, 4125100], [4125101, 4950120], [4950121, 5775140], [5775141, 6600160], [6600161, 7425180], [7425181, 8250200], [8250201, 9075220], [9075221, 9900240], [9900241, 10725260], [10725261, 11550280], [11550281, 12375300], [12375301, 13200320], [13200321, 14025340], [14025341, 14850360], [14850361, 15675380], [15675381, 16500408]] SRR7169084 file size 5569746 SRR7169084 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169084 SRR7169084_1.fastq SRR7169084_2.fastq Input file: SRR7169084_1.fastq Paired file: SRR7169084_2.fastq trimmed: SRR7169084-trimmed-pair1.fastq, SRR7169084-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:22:54 2025 >> started Mon Feb 10 20:23:13 2025 >> done (18.772s) 16500408 read pairs processed; of these: 20710 ( 0.13%) short read pairs filtered out after trimming by size control 21241 ( 0.13%) empty read pairs filtered out after trimming by size control 16458457 (99.75%) read pairs available; of these: 7388702 (44.89%) trimmed read pairs available after processing 9069755 (55.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 9 0.00% 23 6 0.00% 24 8 0.00% 25 5 0.00% 26 7 0.00% 27 5 0.00% 28 8 0.00% 29 7 0.00% 30 18 0.00% 31 8 0.00% 32 5 0.00% 33 8 0.00% 34 16 0.00% 35 11 0.00% 36 10 0.00% 37 11 0.00% 38 13 0.00% 39 18 0.00% 40 11 0.00% 41 17 0.00% 42 20 0.00% 43 20 0.00% 44 22 0.00% 45 19 0.00% 46 31 0.00% 47 37 0.00% 48 26 0.00% 49 35 0.00% 50 32 0.00% 51 50 0.00% 52 44 0.00% 53 50 0.00% 54 48 0.00% 55 50 0.00% 56 63 0.00% 57 73 0.00% 58 65 0.00% 59 86 0.00% 60 82 0.00% 61 93 0.00% 62 122 0.00% 63 125 0.00% 64 149 0.00% 65 148 0.00% 66 185 0.00% 67 156 0.00% 68 193 0.00% 69 223 0.00% 70 268 0.00% 71 274 0.00% 72 300 0.00% 73 309 0.00% 74 359 0.00% 75 396 0.00% 76 422 0.00% 77 486 0.00% 78 547 0.00% 79 615 0.00% 80 689 0.00% 81 752 0.00% 82 925 0.01% 83 1107 0.01% 84 1909 0.01% 85 2415 0.01% 86 2516 0.02% 87 2529 0.02% 88 2660 0.02% 89 2683 0.02% 90 2941 0.02% 91 3005 0.02% 92 3169 0.02% 93 3500 0.02% 94 3649 0.02% 95 3816 0.02% 96 4018 0.02% 97 4395 0.03% 98 4569 0.03% 99 4826 0.03% 100 5268 0.03% 101 5548 0.03% 102 5855 0.04% 103 6276 0.04% 104 6625 0.04% 105 7099 0.04% 106 7688 0.05% 107 8071 0.05% 108 8551 0.05% 109 9059 0.06% 110 9698 0.06% 111 10521 0.06% 112 11253 0.07% 113 11784 0.07% 114 12732 0.08% 115 13371 0.08% 116 14037 0.09% 117 14932 0.09% 118 15819 0.10% 119 16787 0.10% 120 17797 0.11% 121 18506 0.11% 122 19748 0.12% 123 21205 0.13% 124 22372 0.14% 125 24218 0.15% 126 26145 0.16% 127 27879 0.17% 128 29183 0.18% 129 31374 0.19% 130 33868 0.21% 131 36157 0.22% 132 38566 0.23% 133 42287 0.26% 134 45268 0.28% 135 49017 0.30% 136 53625 0.33% 137 58661 0.36% 138 65891 0.40% 139 72937 0.44% 140 80588 0.49% 141 89368 0.54% 142 103744 0.63% 143 112521 0.68% 144 132594 0.81% 145 160666 0.98% 146 201899 1.23% 147 279580 1.70% 148 430056 2.61% 149 876156 5.32% 150 3923336 23.84% 151 9069755 55.11% 16458457 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=258.60 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=45 prefix-density=0.22 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=42 fanout-score=129.08 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=14.3 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169084 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:24:18 Started mapping on | Feb 10 20:24:19 Finished on | Feb 10 20:25:52 Mapping speed, Million of reads per hour | 637.10 Number of input reads | 16458457 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15541685 Uniquely mapped reads % | 94.43% Average mapped length | 296.53 Number of splices: Total | 14779883 Number of splices: Annotated (sjdb) | 14543002 Number of splices: GT/AG | 14567930 Number of splices: GC/AG | 171204 Number of splices: AT/AC | 12127 Number of splices: Non-canonical | 28622 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311672 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 19330 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 625047 625047 625047 N_multimapping 311672 311672 311672 N_noFeature 301598 15367796 370723 N_ambiguous 169781 996 64323 UnstrandedReadsAssigned:15070306 PositiveStrandReadsAssigned:172893 NegativeStrandReadsAssigned:15106639 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169084 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169084-trimmed-pair1.fastq SRR7169084-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,458,457 reads, 15,002,581 reads pseudoaligned [quant] estimated average fragment length: 265.62 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7169084.ke.tsv 34699 SRR7169084.se.tsv 87100 total ==> SRR7169084.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.38 300 9.64777 Potri.005G024800.1.v4.1 1035 770.38 39 2.85457 Potri.004G059700.1.v4.1 961 696.398 3 0.24291 Potri.007G009000.2.v4.1 1416 1151.38 0 0 Potri.003G141000.2.v4.1 2943 2678.38 282.033 5.93757 Potri.016G087400.1.v4.1 270 62.352 1775 1605.2 Potri.015G069301.1.v4.1 564 303.919 0 0 Potri.010G195200.1.v4.1 1773 1508.38 25 0.934568 Potri.012G127500.1.v4.1 977 712.398 5970 472.534 ==> SRR7169084.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1442 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 276 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169084 completed mapping pipeline successfully