Starting /dee2/code/volunteer_pipeline.sh SRR7169085 current disk space = 3056248279040 free memory = 1572537956 SRR7169085 SRAfilesize c245aeabb488153c8620c0eb962585bd SRR7169085.sra SRR7169085.sra file validated SRR7169085 is paired end SRR7169085 is conventional basespace SRR7169085 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169085_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.178 34.0 33.0 34.0 32.0 34.0 2 33.262 34.0 33.0 34.0 32.0 34.0 3 33.3205 34.0 33.0 34.0 32.0 34.0 4 33.432 34.0 33.0 34.0 33.0 34.0 5 33.29225 34.0 33.0 34.0 33.0 34.0 6 37.09225 38.0 37.0 38.0 36.0 38.0 7 35.7305 38.0 37.0 38.0 30.0 38.0 8 36.30525 38.0 37.0 38.0 33.0 38.0 9 37.209 38.0 38.0 38.0 36.0 38.0 10-14 37.3584 38.0 38.0 38.0 36.8 38.0 15-19 37.0318 38.0 38.0 38.0 35.8 38.0 20-24 37.36565 38.0 38.0 38.0 37.0 38.0 25-29 37.2586 38.0 38.0 38.0 37.0 38.0 30-34 37.282799999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.32025 38.0 38.0 38.0 37.0 38.0 40-44 36.739850000000004 38.0 37.6 38.0 34.2 38.0 45-49 36.6947 38.0 37.8 38.0 34.8 38.0 50-54 36.35215 38.0 37.4 38.0 33.0 38.0 55-59 36.22705 38.0 37.2 38.0 33.2 38.0 60-64 36.39045 38.0 37.6 38.0 33.4 38.0 65-69 36.24589999999999 38.0 37.0 38.0 33.4 38.0 70-74 36.06570000000001 38.0 37.0 38.0 32.6 38.0 75-79 36.2176 38.0 37.0 38.0 33.2 38.0 80-84 36.0623 38.0 37.0 38.0 32.6 38.0 85-89 35.80714999999999 38.0 36.8 38.0 31.0 38.0 90-94 35.67835 38.0 36.6 38.0 30.4 38.0 95-99 35.56570000000001 38.0 36.0 38.0 30.2 38.0 100-104 35.00019999999999 38.0 35.4 38.0 27.8 38.0 105-109 34.38485000000001 38.0 34.4 38.0 23.4 38.0 110-114 34.46555 38.0 34.6 38.0 25.2 38.0 115-119 34.4901 38.0 34.4 38.0 25.0 38.0 120-124 33.928700000000006 38.0 34.0 38.0 21.6 38.0 125-129 33.51639999999999 37.6 34.0 38.0 21.8 38.0 130-134 33.2841 37.8 33.0 38.0 18.6 38.0 135-139 32.76155000000001 37.4 32.4 38.0 18.2 38.0 140-144 31.453899999999997 36.0 30.4 38.0 13.4 38.0 145-149 30.05525 35.8 29.4 38.0 8.6 38.0 150-151 24.853749999999998 32.0 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 4.0 19 1.0 20 16.0 21 2.0 22 11.0 23 12.0 24 21.0 25 19.0 26 31.0 27 43.0 28 54.0 29 69.0 30 98.0 31 87.0 32 125.0 33 208.0 34 320.0 35 571.0 36 1078.0 37 1221.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.74454828660436 12.850467289719624 11.2668743509865 34.13811007268951 2 24.575 14.6 32.2 28.625 3 19.975 18.925 26.650000000000002 34.449999999999996 4 23.200000000000003 25.775 23.525 27.500000000000004 5 21.75 31.6 24.55 22.1 6 19.900000000000002 34.5 23.875 21.725 7 15.225 28.375 39.275 17.125 8 18.125 26.875 30.599999999999998 24.4 9 17.599999999999998 24.3 33.4 24.7 10-14 19.845 29.675 26.834999999999997 23.645 15-19 19.925 28.965000000000003 27.134999999999998 23.974999999999998 20-24 19.83599179958998 28.63643182159108 27.256362818140907 24.271213560678035 25-29 19.59 29.044999999999998 27.839999999999996 23.525 30-34 20.29101455072754 28.57142857142857 27.811390569528477 23.326166308315415 35-39 19.795989799489973 28.616430821541076 27.301365068253414 24.286214310715536 40-44 20.649129825965193 28.395679135827166 27.560512102420482 23.39467893578716 45-49 20.255000000000003 28.08 27.495000000000005 24.169999999999998 50-54 20.09 28.215 27.415 24.279999999999998 55-59 19.685 29.330000000000002 27.24 23.745 60-64 20.10600530026501 28.15640782039102 27.28636431821591 24.451222561128056 65-69 20.435 28.24 27.125 24.2 70-74 20.206010300515025 27.946397319865994 27.67138356917846 24.17620881044052 75-79 20.474999999999998 28.89 26.935 23.7 80-84 19.950000000000003 28.860000000000003 27.425 23.765 85-89 20.756037801890095 27.486374318715935 27.65638281914096 24.10120506025301 90-94 20.39101955097755 28.356417820891046 26.991349567478373 24.261213060653034 95-99 20.71 27.66 28.29 23.34 100-104 20.43 27.505000000000003 27.694999999999997 24.37 105-109 20.395 27.48 27.93 24.195 110-114 20.330000000000002 27.939999999999998 27.455000000000002 24.275 115-119 20.22 28.21 28.04 23.53 120-124 20.544999999999998 27.750000000000004 27.37 24.335 125-129 20.265 27.91 27.689999999999998 24.135 130-134 20.064999999999998 27.755000000000003 28.060000000000002 24.12 135-139 21.077107710771077 27.522752275227525 27.447744774477446 23.952395239523952 140-144 20.281014050702534 27.456372818640933 27.796389819490976 24.466223311165557 145-149 20.792079207920793 27.432743274327432 27.952795279527955 23.82238223822382 150-151 19.9125 27.6375 27.1125 25.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 3.0 26 4.0 27 5.5 28 5.0 29 7.5 30 16.0 31 19.5 32 20.0 33 36.0 34 50.0 35 61.0 36 72.5 37 93.0 38 129.0 39 159.0 40 178.5 41 207.5 42 254.0 43 286.5 44 283.0 45 272.5 46 275.0 47 266.5 48 243.0 49 205.0 50 175.5 51 147.0 52 116.0 53 91.5 54 79.5 55 62.0 56 45.0 57 38.5 58 25.5 59 15.5 60 8.5 61 9.0 62 8.0 63 5.0 64 3.5 65 3.0 66 1.5 67 1.0 68 2.5 69 2.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.02 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.005 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.475 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.6 0.0 0.0 0.0 0.0 134-135 0.6125 0.0 0.0 0.0 0.0 136-137 0.6375 0.0 0.0 0.0 0.0 138-139 0.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169085 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169085_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94225 33.0 33.0 34.0 32.0 34.0 2 33.041 34.0 33.0 34.0 32.0 34.0 3 33.05775 34.0 33.0 34.0 32.0 34.0 4 32.9475 34.0 33.0 34.0 32.0 34.0 5 32.991 34.0 33.0 34.0 32.0 34.0 6 37.1845 38.0 38.0 38.0 37.0 38.0 7 37.10525 38.0 38.0 38.0 37.0 38.0 8 36.52875 38.0 38.0 38.0 35.0 38.0 9 36.96875 38.0 38.0 38.0 36.0 38.0 10-14 37.062850000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.11645 38.0 38.0 38.0 37.0 38.0 20-24 36.99925 38.0 38.0 38.0 36.6 38.0 25-29 37.080850000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.0656 38.0 38.0 38.0 36.6 38.0 35-39 36.80005 38.0 38.0 38.0 35.8 38.0 40-44 36.77405 38.0 38.0 38.0 35.8 38.0 45-49 36.949650000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.923849999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.840050000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.74405 38.0 38.0 38.0 35.2 38.0 65-69 36.694649999999996 38.0 38.0 38.0 34.8 38.0 70-74 36.57985 38.0 38.0 38.0 34.6 38.0 75-79 36.41515 38.0 38.0 38.0 34.0 38.0 80-84 36.27445 38.0 38.0 38.0 33.8 38.0 85-89 36.06420000000001 38.0 37.8 38.0 32.8 38.0 90-94 36.09400000000001 38.0 37.8 38.0 33.4 38.0 95-99 36.1451 38.0 38.0 38.0 33.8 38.0 100-104 36.0427 38.0 37.8 38.0 33.4 38.0 105-109 35.768899999999995 38.0 37.0 38.0 31.8 38.0 110-114 35.4019 38.0 36.8 38.0 29.4 38.0 115-119 35.2274 38.0 36.6 38.0 28.6 38.0 120-124 35.351749999999996 38.0 36.4 38.0 30.2 38.0 125-129 34.69115 38.0 35.4 38.0 26.0 38.0 130-134 34.305150000000005 38.0 35.0 38.0 23.4 38.0 135-139 33.90169999999999 38.0 35.0 38.0 21.8 38.0 140-144 33.6471 38.0 34.0 38.0 21.8 38.0 145-149 32.64 38.0 33.2 38.0 13.6 38.0 150-151 28.236125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 0.0 6 3.0 7 0.0 8 2.0 9 2.0 10 3.0 11 1.0 12 3.0 13 2.0 14 4.0 15 1.0 16 3.0 17 3.0 18 10.0 19 8.0 20 8.0 21 10.0 22 13.0 23 13.0 24 20.0 25 15.0 26 23.0 27 29.0 28 32.0 29 48.0 30 42.0 31 73.0 32 96.0 33 115.0 34 184.0 35 259.0 36 601.0 37 2366.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.28432108027007 22.405601400350086 15.078769692423105 25.23130782695674 2 29.40735183795949 25.98149537384346 27.53188297074269 17.079269817454364 3 21.175 28.425 31.85 18.55 4 23.025000000000002 32.9 24.775 19.3 5 24.425 34.75 23.35 17.474999999999998 6 21.75 38.675 21.775 17.8 7 21.5 22.3 37.35 18.85 8 21.65 26.25 27.800000000000004 24.3 9 21.65 24.625 29.025000000000002 24.7 10-14 23.705000000000002 28.62 26.334999999999997 21.34 15-19 23.97 27.905 27.33 20.794999999999998 20-24 22.869999999999997 28.23 27.93 20.97 25-29 23.189999999999998 27.705000000000002 27.655 21.45 30-34 22.795 27.76 28.01 21.435000000000002 35-39 23.265 27.71 27.875 21.15 40-44 23.044999999999998 27.865000000000002 27.694999999999997 21.395 45-49 23.56 27.93 27.315 21.195 50-54 23.175 28.665000000000003 27.62 20.54 55-59 24.2 27.485 27.49 20.825 60-64 23.355 28.005000000000003 27.61 21.029999999999998 65-69 23.715 27.400000000000002 27.805000000000003 21.08 70-74 24.015 28.050000000000004 27.095000000000002 20.84 75-79 23.93 27.61 27.72 20.74 80-84 23.455000000000002 28.34 27.395000000000003 20.810000000000002 85-89 24.16 26.810000000000002 28.37 20.66 90-94 23.3 27.855 27.905 20.94 95-99 23.945 27.275 28.165000000000003 20.615 100-104 24.6 27.900000000000002 27.11 20.39 105-109 23.919999999999998 27.58 27.779999999999998 20.72 110-114 24.035 27.88 27.465 20.62 115-119 23.685000000000002 27.665 28.060000000000002 20.59 120-124 24.13 27.625 27.62 20.625 125-129 23.806190309515475 27.931396569828493 27.661383069153455 20.601030051502576 130-134 23.93 27.200000000000003 27.944999999999997 20.925 135-139 23.76 27.845 27.22 21.175 140-144 23.965 27.495000000000005 27.61 20.93 145-149 24.13 27.97 26.77 21.13 150-151 24.0375 26.85 27.875 21.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.5 27 2.5 28 4.5 29 4.0 30 6.0 31 8.5 32 14.5 33 23.5 34 35.0 35 55.0 36 65.5 37 86.0 38 117.0 39 154.5 40 208.0 41 242.5 42 263.0 43 285.5 44 309.5 45 295.5 46 276.5 47 277.5 48 254.0 49 217.5 50 172.0 51 125.0 52 102.5 53 97.5 54 81.5 55 59.5 56 42.0 57 31.5 58 24.0 59 15.0 60 10.0 61 7.5 62 4.5 63 4.0 64 3.5 65 3.0 66 2.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.475 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.6 0.0 0.0 0.0 0.0 134-135 0.6 0.0 0.0 0.0 0.0 136-137 0.6375 0.0 0.0 0.0 0.0 138-139 0.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTAT 10 0.006830828 145.0 1 GCAATGG 10 0.006830828 145.0 8 TCACCAT 10 0.006830828 145.0 9 >>END_MODULE Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981796 spots for SRR7169085.sra Written 981796 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra Read 981785 spots for SRR7169085.sra Written 981785 spots for SRR7169085.sra SRR ids: ['SRR7169085.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__fen5f_s SRR7169085.sra spots: 19635711 blocks: [[1, 981785], [981786, 1963570], [1963571, 2945355], [2945356, 3927140], [3927141, 4908925], [4908926, 5890710], [5890711, 6872495], [6872496, 7854280], [7854281, 8836065], [8836066, 9817850], [9817851, 10799635], [10799636, 11781420], [11781421, 12763205], [12763206, 13744990], [13744991, 14726775], [14726776, 15708560], [15708561, 16690345], [16690346, 17672130], [17672131, 18653915], [18653916, 19635711]] SRR7169085 file size 6632197 SRR7169085 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169085 SRR7169085_1.fastq SRR7169085_2.fastq Input file: SRR7169085_1.fastq Paired file: SRR7169085_2.fastq trimmed: SRR7169085-trimmed-pair1.fastq, SRR7169085-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:54:23 2025 >> started Mon Feb 10 20:54:45 2025 >> done (21.476s) 19635711 read pairs processed; of these: 16702 ( 0.09%) short read pairs filtered out after trimming by size control 12552 ( 0.06%) empty read pairs filtered out after trimming by size control 19606457 (99.85%) read pairs available; of these: 9595585 (48.94%) trimmed read pairs available after processing 10010872 (51.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 3 0.00% 21 3 0.00% 22 3 0.00% 23 10 0.00% 24 5 0.00% 25 3 0.00% 26 7 0.00% 27 4 0.00% 28 4 0.00% 29 7 0.00% 30 7 0.00% 31 7 0.00% 32 4 0.00% 33 5 0.00% 34 9 0.00% 35 5 0.00% 36 11 0.00% 37 12 0.00% 38 8 0.00% 39 12 0.00% 40 15 0.00% 41 15 0.00% 42 11 0.00% 43 16 0.00% 44 11 0.00% 45 22 0.00% 46 20 0.00% 47 29 0.00% 48 21 0.00% 49 29 0.00% 50 21 0.00% 51 30 0.00% 52 21 0.00% 53 38 0.00% 54 44 0.00% 55 49 0.00% 56 44 0.00% 57 58 0.00% 58 49 0.00% 59 73 0.00% 60 67 0.00% 61 86 0.00% 62 84 0.00% 63 86 0.00% 64 118 0.00% 65 116 0.00% 66 122 0.00% 67 157 0.00% 68 186 0.00% 69 204 0.00% 70 212 0.00% 71 229 0.00% 72 247 0.00% 73 262 0.00% 74 291 0.00% 75 384 0.00% 76 402 0.00% 77 444 0.00% 78 461 0.00% 79 553 0.00% 80 601 0.00% 81 735 0.00% 82 779 0.00% 83 979 0.00% 84 1806 0.01% 85 2265 0.01% 86 2364 0.01% 87 2489 0.01% 88 2846 0.01% 89 2772 0.01% 90 2859 0.01% 91 3038 0.02% 92 3336 0.02% 93 3357 0.02% 94 3453 0.02% 95 3570 0.02% 96 3811 0.02% 97 4231 0.02% 98 4388 0.02% 99 4692 0.02% 100 5045 0.03% 101 5434 0.03% 102 5764 0.03% 103 6053 0.03% 104 6380 0.03% 105 6946 0.04% 106 7249 0.04% 107 7858 0.04% 108 8130 0.04% 109 8765 0.04% 110 9295 0.05% 111 10050 0.05% 112 10621 0.05% 113 11139 0.06% 114 11916 0.06% 115 12658 0.06% 116 13379 0.07% 117 14497 0.07% 118 15374 0.08% 119 15867 0.08% 120 16798 0.09% 121 17862 0.09% 122 19067 0.10% 123 20725 0.11% 124 22045 0.11% 125 24022 0.12% 126 25910 0.13% 127 27579 0.14% 128 29622 0.15% 129 32068 0.16% 130 34766 0.18% 131 37141 0.19% 132 40666 0.21% 133 44503 0.23% 134 48312 0.25% 135 53502 0.27% 136 59261 0.30% 137 64670 0.33% 138 72262 0.37% 139 80910 0.41% 140 91515 0.47% 141 103744 0.53% 142 121531 0.62% 143 141274 0.72% 144 172947 0.88% 145 215718 1.10% 146 280511 1.43% 147 396642 2.02% 148 617149 3.15% 149 1211977 6.18% 150 5218628 26.62% 151 10010872 51.06% 19606457 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=34 prefix-density=0.21 prefix-fanout=2.7 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=241.68 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=42 prefix-density=0.31 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=27 fanout-score=234.67 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=28.8 sequence=AAGAAGAAGAAA SRR7169085 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:55:30 Started mapping on | Feb 10 20:55:30 Finished on | Feb 10 20:57:13 Mapping speed, Million of reads per hour | 685.27 Number of input reads | 19606457 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18273560 Uniquely mapped reads % | 93.20% Average mapped length | 296.98 Number of splices: Total | 17920385 Number of splices: Annotated (sjdb) | 17648140 Number of splices: GT/AG | 17668565 Number of splices: GC/AG | 203597 Number of splices: AT/AC | 13280 Number of splices: Non-canonical | 34943 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 345962 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 205393 % of reads mapped to too many loci | 1.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1006577 1006577 1006577 N_multimapping 345962 345962 345962 N_noFeature 347923 18073918 439795 N_ambiguous 183249 1218 74543 UnstrandedReadsAssigned:17742388 PositiveStrandReadsAssigned:198424 NegativeStrandReadsAssigned:17759222 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169085 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169085-trimmed-pair1.fastq SRR7169085-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,606,457 reads, 17,743,229 reads pseudoaligned [quant] estimated average fragment length: 286.891 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52401 SRR7169085.ke.tsv 34699 SRR7169085.se.tsv 87100 total ==> SRR7169085.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.11 349 10.4169 Potri.005G024800.1.v4.1 1035 749.109 28 1.93241 Potri.004G059700.1.v4.1 961 675.152 9 0.689172 Potri.007G009000.2.v4.1 1416 1130.11 0 0 Potri.003G141000.2.v4.1 2943 2657.11 317.057 6.169 Potri.016G087400.1.v4.1 270 56.7125 1457 1328.21 Potri.015G069301.1.v4.1 564 285.719 0 0 Potri.010G195200.1.v4.1 1773 1487.11 19 0.660538 Potri.012G127500.1.v4.1 977 691.128 6936 518.845 ==> SRR7169085.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1371 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169085 completed mapping pipeline successfully