Starting /dee2/code/volunteer_pipeline.sh SRR7169086 current disk space = 3056395370496 free memory = 941498780 SRR7169086 SRAfilesize 697787c73fae6b2be7fdcfcc3a040736 SRR7169086.sra SRR7169086.sra file validated SRR7169086 is paired end SRR7169086 is conventional basespace SRR7169086 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169086_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00975 34.0 33.0 34.0 33.0 34.0 2 33.36475 34.0 33.0 34.0 33.0 34.0 3 33.4805 34.0 34.0 34.0 33.0 34.0 4 33.4425 34.0 34.0 34.0 33.0 34.0 5 33.45175 34.0 34.0 34.0 33.0 34.0 6 37.04525 38.0 37.0 38.0 36.0 38.0 7 37.383 38.0 38.0 38.0 37.0 38.0 8 37.4155 38.0 38.0 38.0 37.0 38.0 9 37.5005 38.0 38.0 38.0 38.0 38.0 10-14 37.5384 38.0 38.0 38.0 38.0 38.0 15-19 37.5188 38.0 38.0 38.0 38.0 38.0 20-24 37.451049999999995 38.0 38.0 38.0 37.2 38.0 25-29 37.41055 38.0 38.0 38.0 37.2 38.0 30-34 37.38195 38.0 38.0 38.0 37.0 38.0 35-39 37.319 38.0 38.0 38.0 37.2 38.0 40-44 37.1345 38.0 38.0 38.0 36.0 38.0 45-49 37.087599999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.971199999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.917449999999995 38.0 38.0 38.0 35.8 38.0 60-64 36.8508 38.0 38.0 38.0 35.2 38.0 65-69 36.7432 38.0 38.0 38.0 35.0 38.0 70-74 36.6925 38.0 38.0 38.0 34.8 38.0 75-79 36.648450000000004 38.0 38.0 38.0 34.4 38.0 80-84 36.5487 38.0 38.0 38.0 34.0 38.0 85-89 36.4641 38.0 38.0 38.0 34.0 38.0 90-94 36.28575 38.0 37.8 38.0 33.6 38.0 95-99 36.14919999999999 38.0 37.4 38.0 33.4 38.0 100-104 35.9745 38.0 37.0 38.0 33.0 38.0 105-109 35.745450000000005 38.0 37.0 38.0 31.2 38.0 110-114 35.5223 38.0 36.2 38.0 30.2 38.0 115-119 35.2832 38.0 36.0 38.0 28.8 38.0 120-124 35.1206 38.0 36.0 38.0 28.0 38.0 125-129 34.7856 38.0 35.2 38.0 27.4 38.0 130-134 34.40145 38.0 35.0 38.0 24.6 38.0 135-139 34.237899999999996 38.0 35.0 38.0 24.0 38.0 140-144 33.77205 38.0 34.4 38.0 21.8 38.0 145-149 33.1357 38.0 34.0 38.0 17.2 38.0 150-151 29.324875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 0.0 14 3.0 15 1.0 16 1.0 17 4.0 18 4.0 19 5.0 20 4.0 21 7.0 22 11.0 23 14.0 24 16.0 25 14.0 26 26.0 27 36.0 28 34.0 29 34.0 30 58.0 31 60.0 32 70.0 33 109.0 34 207.0 35 270.0 36 707.0 37 2303.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.89127686472819 13.552465233881165 8.77370417193426 31.782553729456385 2 24.275 13.325000000000001 30.775000000000002 31.624999999999996 3 19.2 18.275 25.7 36.825 4 22.8 25.45 23.724999999999998 28.025 5 22.775000000000002 30.525000000000002 24.05 22.650000000000002 6 21.075 32.9 23.875 22.15 7 15.65 28.225 38.35 17.775 8 17.05 28.499999999999996 29.675 24.775 9 17.299999999999997 25.924999999999997 33.375 23.400000000000002 10-14 18.845 30.34 27.589999999999996 23.225 15-19 19.950000000000003 29.65 26.979999999999997 23.419999999999998 20-24 19.925 29.099999999999998 27.615000000000002 23.36 25-29 19.335 29.354999999999997 27.200000000000003 24.11 30-34 20.055 29.82 26.805 23.32 35-39 19.775000000000002 29.535 26.88 23.810000000000002 40-44 19.88 29.68 27.189999999999998 23.25 45-49 19.585 29.29 27.205000000000002 23.919999999999998 50-54 20.05 28.84 27.105 24.005000000000003 55-59 20.169999999999998 28.68 27.310000000000002 23.84 60-64 20.16 28.585 27.515 23.74 65-69 19.98 28.294999999999998 27.450000000000003 24.275 70-74 20.135 28.29 27.544999999999998 24.03 75-79 20.105 28.65 26.979999999999997 24.265 80-84 20.04 28.410000000000004 27.24 24.310000000000002 85-89 20.47 27.515 27.91 24.104999999999997 90-94 20.93 28.005000000000003 27.04 24.025 95-99 19.775000000000002 28.544999999999998 27.49 24.19 100-104 20.365 28.32 27.46 23.855 105-109 20.59 28.439999999999998 27.089999999999996 23.880000000000003 110-114 20.77 28.09 26.935 24.205 115-119 20.465 28.15 27.245 24.14 120-124 21.345 27.650000000000002 27.41 23.595 125-129 20.665 27.865000000000002 27.79 23.68 130-134 20.665 28.084999999999997 27.589999999999996 23.66 135-139 20.895 27.67 27.665 23.77 140-144 21.255 26.985 27.51 24.25 145-149 21.315 27.6 27.279999999999998 23.805 150-151 21.125 27.0125 27.462500000000002 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 2.5 25 4.5 26 5.0 27 8.0 28 12.0 29 14.0 30 14.0 31 23.5 32 36.5 33 41.0 34 53.5 35 76.5 36 91.0 37 101.5 38 126.0 39 153.5 40 175.5 41 203.0 42 236.5 43 255.5 44 255.5 45 261.0 46 266.0 47 252.5 48 245.0 49 220.5 50 176.5 51 145.5 52 123.5 53 102.0 54 76.0 55 53.0 56 37.0 57 36.5 58 31.5 59 21.0 60 15.5 61 10.0 62 9.5 63 6.5 64 2.5 65 3.5 66 4.0 67 3.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0125 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0125 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.05 0.0 0.0 0.025 0.0 92-93 0.0625 0.0 0.0 0.025 0.0 94-95 0.1 0.0 0.0 0.025 0.0 96-97 0.1 0.0 0.0 0.025 0.0 98-99 0.1 0.0 0.0 0.025 0.0 100-101 0.1 0.0 0.0 0.025 0.0 102-103 0.1125 0.0 0.0 0.025 0.0 104-105 0.125 0.0 0.0 0.025 0.0 106-107 0.1375 0.0 0.0 0.025 0.0 108-109 0.15 0.0 0.0 0.025 0.0 110-111 0.15 0.0 0.0 0.025 0.0 112-113 0.16249999999999998 0.0 0.0 0.025 0.0 114-115 0.225 0.0 0.0 0.025 0.0 116-117 0.2875 0.0 0.0 0.025 0.0 118-119 0.375 0.0 0.0 0.025 0.0 120-121 0.4125 0.0 0.0 0.025 0.0 122-123 0.4625 0.0 0.0 0.025 0.0 124-125 0.525 0.0 0.0 0.025 0.0 126-127 0.6 0.0 0.0 0.025 0.0 128-129 0.7375 0.0 0.0 0.025 0.0 130-131 0.85 0.0 0.0 0.025 0.0 132-133 0.9125000000000001 0.0 0.0 0.025 0.0 134-135 1.0375 0.0 0.0 0.025 0.0 136-137 1.15 0.0 0.0 0.025 0.0 138-139 1.35 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAATT 10 0.006830828 145.0 4 TGTGCAT 10 0.006830828 145.0 3 >>END_MODULE SRR7169086 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169086_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6425 33.0 33.0 34.0 32.0 34.0 2 32.737 33.0 33.0 34.0 32.0 34.0 3 32.8185 34.0 33.0 34.0 32.0 34.0 4 32.7065 34.0 33.0 34.0 32.0 34.0 5 32.741 34.0 33.0 34.0 32.0 34.0 6 36.8565 38.0 38.0 38.0 36.0 38.0 7 36.7865 38.0 38.0 38.0 36.0 38.0 8 36.836 38.0 38.0 38.0 36.0 38.0 9 36.79625 38.0 38.0 38.0 36.0 38.0 10-14 36.819500000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.760000000000005 38.0 38.0 38.0 36.0 38.0 20-24 36.72175 38.0 38.0 38.0 36.0 38.0 25-29 36.6909 38.0 38.0 38.0 36.0 38.0 30-34 36.694599999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.668549999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.585699999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.59065 38.0 38.0 38.0 35.6 38.0 50-54 36.63645 38.0 38.0 38.0 35.4 38.0 55-59 36.597899999999996 38.0 38.0 38.0 35.4 38.0 60-64 36.58445 38.0 38.0 38.0 35.0 38.0 65-69 36.53235 38.0 38.0 38.0 35.0 38.0 70-74 36.46795 38.0 38.0 38.0 35.0 38.0 75-79 36.2843 38.0 38.0 38.0 34.0 38.0 80-84 36.257999999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.1536 38.0 38.0 38.0 34.0 38.0 90-94 36.15585 38.0 38.0 38.0 33.8 38.0 95-99 36.00005 38.0 38.0 38.0 33.4 38.0 100-104 35.86015 38.0 38.0 38.0 32.6 38.0 105-109 35.6459 38.0 38.0 38.0 31.4 38.0 110-114 35.6213 38.0 38.0 38.0 31.2 38.0 115-119 35.40905 38.0 37.4 38.0 30.6 38.0 120-124 35.318999999999996 38.0 37.0 38.0 30.2 38.0 125-129 35.0406 38.0 36.4 38.0 28.2 38.0 130-134 34.734899999999996 38.0 36.0 38.0 27.0 38.0 135-139 34.4844 38.0 36.0 38.0 25.0 38.0 140-144 34.1316 38.0 35.4 38.0 23.6 38.0 145-149 33.307550000000006 38.0 35.0 38.0 14.2 38.0 150-151 29.995875 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 9.0 4 1.0 5 4.0 6 3.0 7 2.0 8 1.0 9 1.0 10 4.0 11 1.0 12 2.0 13 1.0 14 4.0 15 7.0 16 7.0 17 8.0 18 5.0 19 7.0 20 9.0 21 3.0 22 11.0 23 16.0 24 23.0 25 32.0 26 18.0 27 25.0 28 45.0 29 46.0 30 43.0 31 78.0 32 65.0 33 100.0 34 123.0 35 180.0 36 436.0 37 2669.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.175 24.2 11.725 24.9 2 30.75 26.0 25.974999999999998 17.275 3 21.825 27.825 30.25 20.1 4 22.900000000000002 33.625 23.75 19.725 5 24.925 35.199999999999996 20.8 19.075 6 21.6 37.675 21.8 18.925 7 20.424999999999997 23.5 36.725 19.35 8 23.35 26.650000000000002 25.275 24.725 9 21.6 25.525 30.099999999999998 22.775000000000002 10-14 23.330000000000002 28.994999999999997 26.665 21.01 15-19 23.785 28.134999999999998 27.1 20.979999999999997 20-24 24.099999999999998 28.360000000000003 26.529999999999998 21.01 25-29 23.830000000000002 28.21 26.355 21.605 30-34 23.380000000000003 27.955000000000002 27.07 21.595 35-39 23.544999999999998 27.74 27.32 21.395 40-44 23.47 28.405 27.224999999999998 20.9 45-49 24.085 27.900000000000002 26.950000000000003 21.065 50-54 23.345 28.735 26.505000000000003 21.415 55-59 24.425 28.18 26.69 20.705000000000002 60-64 24.035 27.98 27.200000000000003 20.785 65-69 23.594437775110045 28.0062024809924 27.345938375350144 21.05342136854742 70-74 24.66343025874581 27.180821780691655 27.56118312396777 20.594564836594763 75-79 23.800210621332933 27.751868010631362 27.29050699563713 21.157414372398577 80-84 24.32 27.93 27.265 20.485 85-89 23.845 27.88 27.405 20.87 90-94 24.395 27.155 27.744999999999997 20.705000000000002 95-99 24.425 27.700000000000003 27.49 20.385 100-104 24.709999999999997 27.47 26.935 20.885 105-109 23.815 27.229999999999997 28.08 20.875 110-114 23.82 27.515 27.625 21.04 115-119 24.435000000000002 27.485 27.83 20.25 120-124 24.205 27.810000000000002 27.215 20.77 125-129 23.715 28.360000000000003 27.615000000000002 20.31 130-134 24.325 27.839999999999996 27.365000000000002 20.47 135-139 24.044999999999998 27.6 27.67 20.685000000000002 140-144 24.375 27.439999999999998 27.689999999999998 20.495 145-149 24.77142570079373 27.68512006430222 27.18275896714558 20.360695267758462 150-151 23.82930513595166 27.99597180261833 28.046324269889222 20.128398791540786 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 3.5 27 3.5 28 2.5 29 5.0 30 7.5 31 9.0 32 14.0 33 23.0 34 35.0 35 43.5 36 53.5 37 78.5 38 111.5 39 142.0 40 173.0 41 202.0 42 234.0 43 273.0 44 302.5 45 312.0 46 311.0 47 296.5 48 262.0 49 226.0 50 184.0 51 148.5 52 136.5 53 110.0 54 70.5 55 51.5 56 41.5 57 32.5 58 25.5 59 20.5 60 16.5 61 10.5 62 5.5 63 3.5 64 3.5 65 3.5 66 1.5 67 2.0 68 2.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.04 70-74 0.095 75-79 0.295 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.47000000000000003 150-151 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.9125000000000001 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138-139 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797465 spots for SRR7169086.sra Written 797465 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra Read 797458 spots for SRR7169086.sra Written 797458 spots for SRR7169086.sra SRR ids: ['SRR7169086.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vkdnb442 SRR7169086.sra spots: 15949167 blocks: [[1, 797458], [797459, 1594916], [1594917, 2392374], [2392375, 3189832], [3189833, 3987290], [3987291, 4784748], [4784749, 5582206], [5582207, 6379664], [6379665, 7177122], [7177123, 7974580], [7974581, 8772038], [8772039, 9569496], [9569497, 10366954], [10366955, 11164412], [11164413, 11961870], [11961871, 12759328], [12759329, 13556786], [13556787, 14354244], [14354245, 15151702], [15151703, 15949167]] SRR7169086 file size 5382948 SRR7169086 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169086 SRR7169086_1.fastq SRR7169086_2.fastq Input file: SRR7169086_1.fastq Paired file: SRR7169086_2.fastq trimmed: SRR7169086-trimmed-pair1.fastq, SRR7169086-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:56:47 2025 >> started Mon Feb 10 19:57:03 2025 >> done (16.734s) 15949167 read pairs processed; of these: 21131 ( 0.13%) short read pairs filtered out after trimming by size control 22741 ( 0.14%) empty read pairs filtered out after trimming by size control 15905295 (99.72%) read pairs available; of these: 6711886 (42.20%) trimmed read pairs available after processing 9193409 (57.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 2 0.00% 21 7 0.00% 22 9 0.00% 23 5 0.00% 24 4 0.00% 25 3 0.00% 26 8 0.00% 27 8 0.00% 28 11 0.00% 29 9 0.00% 30 13 0.00% 31 7 0.00% 32 8 0.00% 33 14 0.00% 34 10 0.00% 35 15 0.00% 36 15 0.00% 37 17 0.00% 38 8 0.00% 39 19 0.00% 40 23 0.00% 41 15 0.00% 42 21 0.00% 43 18 0.00% 44 20 0.00% 45 23 0.00% 46 25 0.00% 47 37 0.00% 48 25 0.00% 49 45 0.00% 50 41 0.00% 51 31 0.00% 52 36 0.00% 53 48 0.00% 54 47 0.00% 55 48 0.00% 56 63 0.00% 57 63 0.00% 58 51 0.00% 59 73 0.00% 60 79 0.00% 61 80 0.00% 62 100 0.00% 63 100 0.00% 64 132 0.00% 65 126 0.00% 66 166 0.00% 67 166 0.00% 68 171 0.00% 69 211 0.00% 70 224 0.00% 71 270 0.00% 72 292 0.00% 73 303 0.00% 74 354 0.00% 75 382 0.00% 76 457 0.00% 77 487 0.00% 78 564 0.00% 79 625 0.00% 80 641 0.00% 81 759 0.00% 82 868 0.01% 83 1046 0.01% 84 2021 0.01% 85 2595 0.02% 86 2528 0.02% 87 2559 0.02% 88 2639 0.02% 89 2851 0.02% 90 2971 0.02% 91 2996 0.02% 92 3250 0.02% 93 3375 0.02% 94 3598 0.02% 95 3733 0.02% 96 4165 0.03% 97 4372 0.03% 98 4627 0.03% 99 4897 0.03% 100 5024 0.03% 101 5432 0.03% 102 5895 0.04% 103 6248 0.04% 104 6645 0.04% 105 7086 0.04% 106 7471 0.05% 107 7986 0.05% 108 8497 0.05% 109 8638 0.05% 110 9467 0.06% 111 10371 0.07% 112 10770 0.07% 113 11469 0.07% 114 12079 0.08% 115 13012 0.08% 116 13621 0.09% 117 14613 0.09% 118 15448 0.10% 119 16487 0.10% 120 17073 0.11% 121 18442 0.12% 122 19236 0.12% 123 20702 0.13% 124 22151 0.14% 125 23474 0.15% 126 25187 0.16% 127 27050 0.17% 128 28328 0.18% 129 30685 0.19% 130 32319 0.20% 131 35120 0.22% 132 37087 0.23% 133 40602 0.26% 134 43356 0.27% 135 46757 0.29% 136 50694 0.32% 137 55378 0.35% 138 61337 0.39% 139 67266 0.42% 140 73858 0.46% 141 81089 0.51% 142 90082 0.57% 143 101106 0.64% 144 117299 0.74% 145 142935 0.90% 146 176936 1.11% 147 245159 1.54% 148 366121 2.30% 149 719996 4.53% 150 3636070 22.86% 151 9193409 57.80% 15905295 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=221.74 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.62 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=4.6 sequence=CAGTTTGTTGACTGGTGCCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=43 fanout-score=167.27 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=15.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAA SRR7169086 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:58:01 Started mapping on | Feb 10 19:58:06 Finished on | Feb 10 19:59:43 Mapping speed, Million of reads per hour | 590.30 Number of input reads | 15905295 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14972471 Uniquely mapped reads % | 94.14% Average mapped length | 296.69 Number of splices: Total | 14203716 Number of splices: Annotated (sjdb) | 13968707 Number of splices: GT/AG | 13997462 Number of splices: GC/AG | 162349 Number of splices: AT/AC | 12875 Number of splices: Non-canonical | 31030 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298432 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 23049 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 654234 654234 654234 N_multimapping 298432 298432 298432 N_noFeature 269806 14786627 344757 N_ambiguous 175566 850 64102 UnstrandedReadsAssigned:14527099 PositiveStrandReadsAssigned:184994 NegativeStrandReadsAssigned:14563612 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169086 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169086-trimmed-pair1.fastq SRR7169086-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,905,295 reads, 14,463,056 reads pseudoaligned [quant] estimated average fragment length: 267.548 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7169086.ke.tsv 34699 SRR7169086.se.tsv 87100 total ==> SRR7169086.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.45 266 8.27479 Potri.005G024800.1.v4.1 1035 768.452 37 2.62336 Potri.004G059700.1.v4.1 961 694.481 7 0.549176 Potri.007G009000.2.v4.1 1416 1149.45 0 0 Potri.003G141000.2.v4.1 2943 2676.45 288.142 5.86572 Potri.016G087400.1.v4.1 270 62.7925 1498 1299.8 Potri.015G069301.1.v4.1 564 302.239 0 0 Potri.010G195200.1.v4.1 1773 1506.45 21 0.759517 Potri.012G127500.1.v4.1 977 710.46 6638 509.063 ==> SRR7169086.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1150 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169086 completed mapping pipeline successfully