Starting /dee2/code/volunteer_pipeline.sh SRR7169087 current disk space = 3056044183552 free memory = 1500405484 SRR7169087 SRAfilesize 92f6e0573d01e186cf4a4b4c8fda3e18 SRR7169087.sra SRR7169087.sra file validated SRR7169087 is paired end SRR7169087 is conventional basespace SRR7169087 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169087_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15725 34.0 33.0 34.0 33.0 34.0 2 33.504 34.0 34.0 34.0 33.0 34.0 3 33.5065 34.0 34.0 34.0 33.0 34.0 4 33.53875 34.0 34.0 34.0 33.0 34.0 5 33.5315 34.0 34.0 34.0 33.0 34.0 6 37.2195 38.0 38.0 38.0 36.0 38.0 7 37.46175 38.0 38.0 38.0 37.0 38.0 8 37.59425 38.0 38.0 38.0 38.0 38.0 9 37.58 38.0 38.0 38.0 38.0 38.0 10-14 37.57585 38.0 38.0 38.0 38.0 38.0 15-19 37.5187 38.0 38.0 38.0 38.0 38.0 20-24 37.5072 38.0 38.0 38.0 38.0 38.0 25-29 37.47485 38.0 38.0 38.0 37.6 38.0 30-34 37.4055 38.0 38.0 38.0 37.0 38.0 35-39 37.32225 38.0 38.0 38.0 37.2 38.0 40-44 37.13440000000001 38.0 38.0 38.0 36.2 38.0 45-49 37.012800000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.92289999999999 38.0 38.0 38.0 35.4 38.0 55-59 36.72695 38.0 38.0 38.0 34.8 38.0 60-64 36.705650000000006 38.0 38.0 38.0 35.0 38.0 65-69 36.635200000000005 38.0 38.0 38.0 34.6 38.0 70-74 36.4785 38.0 38.0 38.0 34.0 38.0 75-79 36.424 38.0 38.0 38.0 34.0 38.0 80-84 36.3039 38.0 37.6 38.0 33.6 38.0 85-89 36.102 38.0 37.0 38.0 33.0 38.0 90-94 35.939949999999996 38.0 37.0 38.0 32.6 38.0 95-99 35.7616 38.0 37.0 38.0 31.4 38.0 100-104 35.47755 38.0 36.4 38.0 29.8 38.0 105-109 35.387249999999995 38.0 36.4 38.0 29.4 38.0 110-114 35.061600000000006 38.0 36.0 38.0 28.0 38.0 115-119 34.85455 38.0 35.8 38.0 27.6 38.0 120-124 34.54105 38.0 35.2 38.0 26.0 38.0 125-129 34.30544999999999 38.0 35.0 38.0 24.2 38.0 130-134 33.79155 38.0 34.6 38.0 20.6 38.0 135-139 33.454049999999995 38.0 34.0 38.0 19.0 38.0 140-144 32.705499999999994 38.0 33.6 38.0 14.4 38.0 145-149 32.0658 38.0 33.0 38.0 11.4 38.0 150-151 28.23475 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 4.0 12 2.0 13 0.0 14 4.0 15 3.0 16 3.0 17 6.0 18 6.0 19 7.0 20 7.0 21 10.0 22 18.0 23 12.0 24 23.0 25 21.0 26 29.0 27 32.0 28 28.0 29 52.0 30 58.0 31 68.0 32 87.0 33 119.0 34 195.0 35 300.0 36 840.0 37 2065.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.83518705763397 13.827098078867541 11.450960566228513 32.886754297269974 2 23.7 14.6 30.075000000000003 31.624999999999996 3 19.8 17.175 26.75 36.275 4 22.525000000000002 24.25 23.35 29.875 5 22.775000000000002 27.675 25.025 24.525 6 21.5 32.625 24.05 21.825 7 16.425 29.299999999999997 36.225 18.05 8 17.875 28.775000000000002 30.349999999999998 23.0 9 16.8 28.675 32.45 22.075 10-14 19.59 30.714999999999996 27.685 22.009999999999998 15-19 19.34 29.520000000000003 27.779999999999998 23.36 20-24 19.955000000000002 29.015 27.665 23.365 25-29 19.580000000000002 30.275000000000002 27.224999999999998 22.919999999999998 30-34 19.52 29.720000000000002 27.76 23.0 35-39 19.744999999999997 29.7 27.065 23.49 40-44 19.515 29.735 27.900000000000002 22.85 45-49 19.99 29.205 27.115000000000002 23.69 50-54 20.23 28.910000000000004 27.3 23.56 55-59 20.44 29.175 27.169999999999998 23.215 60-64 20.05 29.425 27.245 23.28 65-69 20.044999999999998 29.39 26.945000000000004 23.62 70-74 20.080000000000002 29.299999999999997 27.435 23.185 75-79 19.685 29.13 27.265 23.919999999999998 80-84 20.044999999999998 29.07 26.840000000000003 24.044999999999998 85-89 20.285 28.92 27.235 23.56 90-94 20.53 28.88 26.93 23.66 95-99 19.975 28.735 27.560000000000002 23.73 100-104 20.78 29.085 27.02 23.115 105-109 20.205000000000002 28.689999999999998 27.325 23.78 110-114 20.29 28.365000000000002 27.52 23.825 115-119 20.395 28.27 26.995 24.34 120-124 20.52 28.075 27.839999999999996 23.565 125-129 20.72 27.71 27.689999999999998 23.880000000000003 130-134 20.54 28.73 27.165 23.565 135-139 20.4 28.585 27.38 23.635 140-144 20.225 28.525 27.705000000000002 23.544999999999998 145-149 20.65 28.694999999999997 27.089999999999996 23.565 150-151 20.5 28.775000000000002 27.525 23.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.5 4 1.5 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 2.0 18 1.5 19 0.5 20 1.0 21 1.5 22 2.5 23 4.0 24 4.0 25 5.0 26 9.5 27 12.5 28 16.0 29 21.5 30 31.0 31 35.0 32 41.5 33 59.0 34 74.0 35 87.5 36 103.0 37 114.0 38 122.0 39 150.5 40 188.0 41 204.5 42 209.5 43 229.0 44 252.5 45 251.5 46 235.0 47 211.5 48 198.5 49 194.5 50 184.0 51 164.5 52 137.0 53 109.5 54 87.5 55 62.5 56 36.5 57 34.0 58 32.5 59 19.0 60 11.5 61 10.5 62 7.0 63 6.0 64 6.5 65 3.5 66 3.0 67 2.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.8999999999999999 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138-139 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACAT 10 0.006830828 145.0 145 GTGGTTG 10 0.006830828 145.0 5 ATCGCAG 10 0.006830828 145.0 145 >>END_MODULE SRR7169087 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169087_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82225 33.0 33.0 34.0 32.0 34.0 2 32.85975 34.0 33.0 34.0 32.0 34.0 3 32.92225 34.0 33.0 34.0 32.0 34.0 4 32.854 34.0 33.0 34.0 32.0 34.0 5 32.78125 34.0 33.0 34.0 32.0 34.0 6 36.9765 38.0 38.0 38.0 36.0 38.0 7 36.9415 38.0 38.0 38.0 37.0 38.0 8 36.9385 38.0 38.0 38.0 36.0 38.0 9 36.914 38.0 38.0 38.0 37.0 38.0 10-14 36.93384999999999 38.0 38.0 38.0 36.8 38.0 15-19 36.91330000000001 38.0 38.0 38.0 37.0 38.0 20-24 36.88015 38.0 38.0 38.0 36.4 38.0 25-29 36.853 38.0 38.0 38.0 36.6 38.0 30-34 36.85125 38.0 38.0 38.0 36.8 38.0 35-39 36.806450000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.75574999999999 38.0 38.0 38.0 36.2 38.0 45-49 36.7551 38.0 38.0 38.0 36.0 38.0 50-54 36.739549999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.67875 38.0 38.0 38.0 36.0 38.0 60-64 36.6768 38.0 38.0 38.0 36.0 38.0 65-69 36.55525 38.0 38.0 38.0 36.0 38.0 70-74 36.525349999999996 38.0 38.0 38.0 35.2 38.0 75-79 36.437749999999994 38.0 38.0 38.0 35.0 38.0 80-84 36.4311 38.0 38.0 38.0 34.8 38.0 85-89 36.40955 38.0 38.0 38.0 34.8 38.0 90-94 36.24175 38.0 38.0 38.0 34.2 38.0 95-99 36.17595 38.0 38.0 38.0 34.0 38.0 100-104 35.963350000000005 38.0 38.0 38.0 33.6 38.0 105-109 35.820800000000006 38.0 38.0 38.0 32.6 38.0 110-114 35.7589 38.0 38.0 38.0 33.0 38.0 115-119 35.48465 38.0 37.6 38.0 31.4 38.0 120-124 35.35275 38.0 37.2 38.0 31.0 38.0 125-129 35.126149999999996 38.0 36.8 38.0 29.2 38.0 130-134 34.969 38.0 36.2 38.0 28.0 38.0 135-139 34.60955 38.0 35.8 38.0 27.2 38.0 140-144 33.888549999999995 38.0 35.0 38.0 21.8 38.0 145-149 33.282700000000006 38.0 35.0 38.0 15.6 38.0 150-151 30.157249999999998 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 6.0 4 7.0 5 0.0 6 1.0 7 4.0 8 5.0 9 0.0 10 2.0 11 2.0 12 1.0 13 4.0 14 3.0 15 2.0 16 7.0 17 6.0 18 5.0 19 8.0 20 9.0 21 12.0 22 10.0 23 10.0 24 13.0 25 12.0 26 19.0 27 21.0 28 36.0 29 44.0 30 53.0 31 53.0 32 73.0 33 89.0 34 121.0 35 174.0 36 412.0 37 2760.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.325 22.975 16.0 24.7 2 27.875 27.825 26.575 17.724999999999998 3 20.925 30.275000000000002 29.325000000000003 19.475 4 24.375 32.800000000000004 24.65 18.175 5 24.8 35.199999999999996 22.55 17.45 6 22.1 36.55 22.975 18.375 7 21.15 22.05 37.475 19.325 8 22.900000000000002 25.45 27.975 23.674999999999997 9 22.0 24.425 29.375 24.2 10-14 23.305 29.025000000000002 26.235000000000003 21.435000000000002 15-19 24.08 27.529999999999998 27.339999999999996 21.05 20-24 23.674999999999997 28.499999999999996 26.52 21.305 25-29 23.87 27.894999999999996 26.834999999999997 21.4 30-34 23.595 28.425 27.175 20.805 35-39 23.965 27.43 27.355 21.25 40-44 23.974999999999998 28.194999999999997 27.275 20.555 45-49 23.525 28.03 27.029999999999998 21.415 50-54 23.34 28.09 27.615000000000002 20.955 55-59 24.075 27.685 27.529999999999998 20.71 60-64 23.965 28.29 27.200000000000003 20.544999999999998 65-69 24.178521338409137 27.975355640152273 27.224003205770387 20.622119815668203 70-74 24.16420229562428 28.028670242093128 26.73048969976442 21.076637762518168 75-79 23.91467628060688 27.60502728956988 28.185869510790646 20.294426919032595 80-84 23.880000000000003 28.084999999999997 26.815 21.22 85-89 23.78 27.284999999999997 27.975 20.96 90-94 23.799999999999997 27.185 27.655 21.36 95-99 24.044999999999998 27.38 27.41 21.165 100-104 24.085 27.275 28.050000000000004 20.59 105-109 23.945 27.310000000000002 27.375 21.37 110-114 23.575 27.639999999999997 27.794999999999998 20.990000000000002 115-119 24.255 27.555000000000003 28.07 20.119999999999997 120-124 23.445 27.48 28.095 20.979999999999997 125-129 23.189999999999998 27.88 28.07 20.86 130-134 23.845 27.315 27.92 20.919999999999998 135-139 24.106517168885773 27.360096105716288 27.90069075983582 20.632695965562117 140-144 23.506676036542515 27.77833550848308 27.883746611785966 20.831241843188437 145-149 24.428441937758084 27.485144526135564 27.782254003424313 20.304159532682043 150-151 24.558526740665997 27.38395560040363 27.901109989909184 20.15640766902119 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 2.0 25 4.0 26 3.5 27 4.0 28 5.0 29 5.5 30 7.5 31 10.0 32 19.5 33 27.0 34 33.0 35 47.0 36 58.0 37 78.0 38 109.5 39 145.0 40 181.0 41 218.0 42 251.0 43 279.0 44 309.0 45 312.5 46 298.0 47 259.0 48 237.0 49 218.0 50 174.5 51 146.0 52 128.5 53 114.0 54 80.5 55 54.0 56 44.0 57 35.5 58 27.0 59 18.0 60 11.5 61 9.0 62 8.0 63 7.5 64 4.0 65 4.0 66 3.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.18 70-74 0.245 75-79 0.145 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.11 140-144 0.38999999999999996 145-149 0.7100000000000001 150-151 0.8999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.32679738562091504 0.65 3 0.07541478129713425 0.22499999999999998 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.6625 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9125 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138-139 1.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACACTT 10 0.006830828 145.0 2 >>END_MODULE Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648164 spots for SRR7169087.sra Written 648164 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra Read 648147 spots for SRR7169087.sra Written 648147 spots for SRR7169087.sra SRR ids: ['SRR7169087.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bb__86a_ SRR7169087.sra spots: 12962957 blocks: [[1, 648147], [648148, 1296294], [1296295, 1944441], [1944442, 2592588], [2592589, 3240735], [3240736, 3888882], [3888883, 4537029], [4537030, 5185176], [5185177, 5833323], [5833324, 6481470], [6481471, 7129617], [7129618, 7777764], [7777765, 8425911], [8425912, 9074058], [9074059, 9722205], [9722206, 10370352], [10370353, 11018499], [11018500, 11666646], [11666647, 12314793], [12314794, 12962957]] SRR7169087 file size 4371020 SRR7169087 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169087 SRR7169087_1.fastq SRR7169087_2.fastq Input file: SRR7169087_1.fastq Paired file: SRR7169087_2.fastq trimmed: SRR7169087-trimmed-pair1.fastq, SRR7169087-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:39:01 2025 >> started Mon Feb 10 20:39:15 2025 >> done (14.001s) 12962957 read pairs processed; of these: 24031 ( 0.19%) short read pairs filtered out after trimming by size control 23453 ( 0.18%) empty read pairs filtered out after trimming by size control 12915473 (99.63%) read pairs available; of these: 6183336 (47.88%) trimmed read pairs available after processing 6732137 (52.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 9 0.00% 21 1 0.00% 22 6 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 6 0.00% 28 9 0.00% 29 5 0.00% 30 11 0.00% 31 11 0.00% 32 12 0.00% 33 8 0.00% 34 21 0.00% 35 10 0.00% 36 15 0.00% 37 13 0.00% 38 13 0.00% 39 16 0.00% 40 23 0.00% 41 15 0.00% 42 26 0.00% 43 16 0.00% 44 17 0.00% 45 17 0.00% 46 36 0.00% 47 37 0.00% 48 38 0.00% 49 40 0.00% 50 38 0.00% 51 37 0.00% 52 47 0.00% 53 49 0.00% 54 55 0.00% 55 78 0.00% 56 55 0.00% 57 63 0.00% 58 70 0.00% 59 73 0.00% 60 83 0.00% 61 94 0.00% 62 119 0.00% 63 106 0.00% 64 140 0.00% 65 123 0.00% 66 152 0.00% 67 159 0.00% 68 184 0.00% 69 208 0.00% 70 214 0.00% 71 249 0.00% 72 262 0.00% 73 284 0.00% 74 336 0.00% 75 387 0.00% 76 406 0.00% 77 462 0.00% 78 521 0.00% 79 540 0.00% 80 590 0.00% 81 680 0.01% 82 867 0.01% 83 965 0.01% 84 1958 0.02% 85 2545 0.02% 86 2664 0.02% 87 2803 0.02% 88 2939 0.02% 89 2956 0.02% 90 3000 0.02% 91 2931 0.02% 92 3122 0.02% 93 3206 0.02% 94 3322 0.03% 95 3522 0.03% 96 3730 0.03% 97 4091 0.03% 98 4423 0.03% 99 4597 0.04% 100 4922 0.04% 101 5197 0.04% 102 5363 0.04% 103 5678 0.04% 104 6204 0.05% 105 6768 0.05% 106 7349 0.06% 107 7783 0.06% 108 8476 0.07% 109 8628 0.07% 110 9115 0.07% 111 9432 0.07% 112 10017 0.08% 113 10557 0.08% 114 11427 0.09% 115 12066 0.09% 116 12515 0.10% 117 13315 0.10% 118 13976 0.11% 119 14668 0.11% 120 15317 0.12% 121 16141 0.12% 122 16641 0.13% 123 17875 0.14% 124 19350 0.15% 125 20558 0.16% 126 22040 0.17% 127 23604 0.18% 128 24824 0.19% 129 26395 0.20% 130 28318 0.22% 131 29882 0.23% 132 32455 0.25% 133 34915 0.27% 134 37436 0.29% 135 40589 0.31% 136 44443 0.34% 137 49021 0.38% 138 54335 0.42% 139 60677 0.47% 140 66587 0.52% 141 73601 0.57% 142 83882 0.65% 143 94521 0.73% 144 111279 0.86% 145 135415 1.05% 146 172548 1.34% 147 241935 1.87% 148 377471 2.92% 149 739414 5.73% 150 3227445 24.99% 151 6732137 52.12% 12915473 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=38 prefix-density=0.28 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=225.01 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=18.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=45 prefix-density=0.27 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=52.72 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=11.7 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAGCGTGCCCAAAGCAGATGCCGTTTTCATGAAGTGGATATGCCATGATTGGAGCGACGCACACTGCTTAAAATTCTTGAAGAATTGCTATGACGCCTTGCCGGAAAACGGCAAGGTGATACTTGTTGAGTGCATTCTTCCCGTGGCTCCTGACACAAGCCTTGCCACCAAGGGAGTCGTGCACATTGATGTTATCATGCTGGCGCACAACCCCGGTGGGAAAGAGAGGACCGAAAAGGAATTTGAGGGCTTAGCAAAGGGAGCTGGCTTTCAAGGTTTTGAAGTAATGTGCTGTGCATTCAACACACATGTCATTGAATTCCGCAAGAACTAA SRR7169087 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:40:02 Started mapping on | Feb 10 20:40:02 Finished on | Feb 10 20:42:07 Mapping speed, Million of reads per hour | 371.97 Number of input reads | 12915473 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11713515 Uniquely mapped reads % | 90.69% Average mapped length | 296.09 Number of splices: Total | 10295683 Number of splices: Annotated (sjdb) | 10111360 Number of splices: GT/AG | 10145598 Number of splices: GC/AG | 118115 Number of splices: AT/AC | 8242 Number of splices: Non-canonical | 23728 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 229257 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 19741 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.34% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 993658 993658 993658 N_multimapping 229257 229257 229257 N_noFeature 231736 11541473 297881 N_ambiguous 156285 1206 49522 UnstrandedReadsAssigned:11325494 PositiveStrandReadsAssigned:170836 NegativeStrandReadsAssigned:11366112 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169087 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169087-trimmed-pair1.fastq SRR7169087-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,915,473 reads, 11,330,378 reads pseudoaligned [quant] estimated average fragment length: 266.785 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7169087.ke.tsv 34699 SRR7169087.se.tsv 87100 total ==> SRR7169087.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.22 207 8.40275 Potri.005G024800.1.v4.1 1035 769.215 20 1.84936 Potri.004G059700.1.v4.1 961 695.226 1 0.102309 Potri.007G009000.2.v4.1 1416 1150.22 0 0 Potri.003G141000.2.v4.1 2943 2677.22 162 4.30398 Potri.016G087400.1.v4.1 270 60.9419 1682 1963.13 Potri.015G069301.1.v4.1 564 302.199 0 0 Potri.010G195200.1.v4.1 1773 1507.22 16 0.755063 Potri.012G127500.1.v4.1 977 711.221 3739 373.929 ==> SRR7169087.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1193 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169087 completed mapping pipeline successfully