Starting /dee2/code/volunteer_pipeline.sh SRR7169088 current disk space = 3056090664960 free memory = 1116467640 SRR7169088 SRAfilesize 9436e9ed36a5fb2ddb4f8868fcf7646a SRR7169088.sra SRR7169088.sra file validated SRR7169088 is paired end SRR7169088 is conventional basespace SRR7169088 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169088_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7745 34.0 33.0 34.0 33.0 34.0 2 33.34175 34.0 33.0 34.0 33.0 34.0 3 33.32625 34.0 34.0 34.0 33.0 34.0 4 33.4215 34.0 34.0 34.0 33.0 34.0 5 33.37175 34.0 33.0 34.0 33.0 34.0 6 36.929 38.0 37.0 38.0 36.0 38.0 7 37.36075 38.0 38.0 38.0 37.0 38.0 8 37.44375 38.0 38.0 38.0 37.0 38.0 9 37.5085 38.0 38.0 38.0 38.0 38.0 10-14 37.48725 38.0 38.0 38.0 37.6 38.0 15-19 37.438750000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.45295 38.0 38.0 38.0 37.2 38.0 25-29 37.405100000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.33630000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.277 38.0 38.0 38.0 37.0 38.0 40-44 37.075 38.0 38.0 38.0 36.0 38.0 45-49 36.97345 38.0 38.0 38.0 36.0 38.0 50-54 36.885400000000004 38.0 38.0 38.0 35.4 38.0 55-59 36.86055 38.0 38.0 38.0 35.2 38.0 60-64 36.79285 38.0 38.0 38.0 35.0 38.0 65-69 36.74575 38.0 38.0 38.0 35.0 38.0 70-74 36.660450000000004 38.0 38.0 38.0 34.2 38.0 75-79 36.56135 38.0 38.0 38.0 34.0 38.0 80-84 36.4451 38.0 38.0 38.0 34.0 38.0 85-89 36.27075 38.0 37.6 38.0 33.6 38.0 90-94 36.119749999999996 38.0 37.0 38.0 33.2 38.0 95-99 36.004400000000004 38.0 37.0 38.0 32.8 38.0 100-104 35.8534 38.0 37.0 38.0 31.8 38.0 105-109 35.648250000000004 38.0 37.0 38.0 30.8 38.0 110-114 35.56205 38.0 36.6 38.0 30.2 38.0 115-119 35.254149999999996 38.0 36.0 38.0 28.4 38.0 120-124 35.0537 38.0 36.0 38.0 28.0 38.0 125-129 34.749900000000004 38.0 35.2 38.0 27.6 38.0 130-134 34.24315 38.0 35.0 38.0 24.0 38.0 135-139 33.75464999999999 38.0 34.6 38.0 21.8 38.0 140-144 33.41835 38.0 34.0 38.0 18.6 38.0 145-149 32.905249999999995 38.0 34.0 38.0 16.6 38.0 150-151 28.9185 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 3.0 12 1.0 13 2.0 14 2.0 15 3.0 16 2.0 17 0.0 18 4.0 19 8.0 20 8.0 21 6.0 22 15.0 23 12.0 24 16.0 25 28.0 26 22.0 27 36.0 28 29.0 29 37.0 30 54.0 31 71.0 32 78.0 33 98.0 34 190.0 35 300.0 36 726.0 37 2248.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.39622641509434 13.003569607343193 9.178990311065782 34.42121366649668 2 24.175 14.625 32.550000000000004 28.65 3 18.975 20.674999999999997 26.924999999999997 33.425 4 21.05 28.425 23.599999999999998 26.924999999999997 5 22.625 30.925000000000004 24.875 21.575 6 18.575 36.0 24.65 20.775 7 15.625 26.450000000000003 39.675 18.25 8 18.425 26.35 30.0 25.224999999999998 9 16.375 26.3 32.550000000000004 24.775 10-14 19.935 29.785 27.034999999999997 23.244999999999997 15-19 19.975 29.285 26.86 23.880000000000003 20-24 19.805 28.849999999999998 27.71 23.635 25-29 20.155 29.255 26.945000000000004 23.645 30-34 19.78 28.935 27.279999999999998 24.005000000000003 35-39 19.89 28.74 27.275 24.095 40-44 19.99 28.64 27.735 23.635 45-49 20.64 28.444999999999997 26.995 23.919999999999998 50-54 19.97 29.215000000000003 27.195000000000004 23.62 55-59 20.215 28.84 26.76 24.185000000000002 60-64 20.335 28.37 27.229999999999997 24.065 65-69 20.655 28.37 26.655 24.32 70-74 20.175 29.13 27.275 23.419999999999998 75-79 20.61 28.18 27.189999999999998 24.02 80-84 20.200000000000003 28.410000000000004 26.765 24.625 85-89 20.580000000000002 28.675 27.134999999999998 23.61 90-94 20.095 28.235 27.07 24.6 95-99 19.830000000000002 28.720000000000002 27.51 23.94 100-104 20.830000000000002 28.52 27.025 23.625 105-109 19.895 28.175 27.355 24.575 110-114 20.8 27.83 27.215 24.154999999999998 115-119 20.674999999999997 28.525 27.18 23.62 120-124 20.3 28.07 27.07 24.560000000000002 125-129 20.79 28.285 27.189999999999998 23.735 130-134 20.505000000000003 28.535 26.91 24.05 135-139 20.59 28.285 27.845 23.28 140-144 21.08 28.13 27.105 23.685000000000002 145-149 20.974999999999998 28.189999999999998 27.12 23.715 150-151 21.125 27.925 27.0875 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 1.5 25 4.5 26 8.0 27 8.0 28 10.5 29 18.0 30 21.5 31 22.0 32 27.5 33 37.0 34 46.5 35 65.5 36 95.5 37 109.5 38 120.0 39 145.0 40 177.5 41 201.5 42 233.5 43 249.5 44 251.0 45 260.0 46 267.0 47 251.5 48 237.0 49 214.0 50 174.5 51 156.5 52 135.0 53 109.0 54 81.5 55 66.0 56 44.0 57 31.5 58 29.0 59 22.0 60 16.0 61 11.0 62 11.0 63 7.0 64 3.5 65 3.0 66 2.0 67 1.5 68 2.5 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6625 0.0 0.0 0.0 0.0 130-131 0.775 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.2999999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAATT 10 0.005853838 152.57895 1 CCTCGAA 10 0.0068378756 144.95 8 ACATACA 10 0.0068378756 144.95 6 >>END_MODULE SRR7169088 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169088_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5375 33.0 33.0 34.0 32.0 34.0 2 32.739 33.0 33.0 34.0 32.0 34.0 3 32.76025 34.0 33.0 34.0 32.0 34.0 4 32.7175 34.0 33.0 34.0 32.0 34.0 5 32.76575 34.0 33.0 34.0 32.0 34.0 6 36.92675 38.0 38.0 38.0 36.0 38.0 7 37.0255 38.0 38.0 38.0 37.0 38.0 8 36.965 38.0 38.0 38.0 36.0 38.0 9 36.952 38.0 38.0 38.0 36.0 38.0 10-14 36.91645 38.0 38.0 38.0 36.4 38.0 15-19 36.871 38.0 38.0 38.0 36.0 38.0 20-24 36.83755 38.0 38.0 38.0 36.0 38.0 25-29 36.83925000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.7693 38.0 38.0 38.0 36.0 38.0 35-39 36.7449 38.0 38.0 38.0 36.0 38.0 40-44 36.6742 38.0 38.0 38.0 35.4 38.0 45-49 36.7521 38.0 38.0 38.0 36.0 38.0 50-54 36.6887 38.0 38.0 38.0 35.8 38.0 55-59 36.67465 38.0 38.0 38.0 35.6 38.0 60-64 36.65214999999999 38.0 38.0 38.0 35.4 38.0 65-69 36.62545 38.0 38.0 38.0 35.2 38.0 70-74 36.5229 38.0 38.0 38.0 34.6 38.0 75-79 36.346 38.0 38.0 38.0 34.0 38.0 80-84 36.3502 38.0 38.0 38.0 34.0 38.0 85-89 36.368399999999994 38.0 38.0 38.0 34.0 38.0 90-94 36.2024 38.0 38.0 38.0 34.0 38.0 95-99 36.16005 38.0 38.0 38.0 33.8 38.0 100-104 36.0446 38.0 38.0 38.0 33.4 38.0 105-109 35.903800000000004 38.0 38.0 38.0 32.8 38.0 110-114 35.77374999999999 38.0 38.0 38.0 32.2 38.0 115-119 35.643950000000004 38.0 37.8 38.0 31.4 38.0 120-124 35.539300000000004 38.0 37.2 38.0 31.2 38.0 125-129 35.194900000000004 38.0 36.4 38.0 29.4 38.0 130-134 34.942949999999996 38.0 36.0 38.0 28.2 38.0 135-139 34.5811 38.0 36.0 38.0 26.0 38.0 140-144 34.19955 38.0 35.4 38.0 23.4 38.0 145-149 33.55745 38.0 35.0 38.0 18.6 38.0 150-151 29.911625 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 5.0 5 2.0 6 3.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 4.0 15 7.0 16 6.0 17 7.0 18 7.0 19 9.0 20 7.0 21 8.0 22 15.0 23 16.0 24 16.0 25 20.0 26 28.0 27 20.0 28 36.0 29 33.0 30 63.0 31 55.0 32 79.0 33 94.0 34 119.0 35 225.0 36 407.0 37 2691.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 21.85 13.675 25.85 2 28.499999999999996 27.05 27.675 16.775000000000002 3 21.61080540270135 29.889944972486244 29.214607303651825 19.28464232116058 4 23.075000000000003 35.075 23.325000000000003 18.525 5 24.925 34.775 22.225 18.075 6 22.425 35.525 23.75 18.3 7 19.25 22.1 38.25 20.4 8 22.25 25.775 26.900000000000002 25.074999999999996 9 22.925 26.3 27.750000000000004 23.025000000000002 10-14 23.595 29.005 26.1 21.3 15-19 23.91 27.93 27.250000000000004 20.91 20-24 23.655 28.32 26.955000000000002 21.07 25-29 23.415 27.74 27.67 21.175 30-34 23.565 27.935 27.3 21.2 35-39 23.080000000000002 28.03 27.71 21.18 40-44 24.115000000000002 28.095 26.695 21.095 45-49 24.075 28.21 26.640000000000004 21.075 50-54 23.915 27.965 27.24 20.880000000000003 55-59 24.27 27.994999999999997 27.025 20.71 60-64 23.630000000000003 27.615000000000002 27.939999999999998 20.815 65-69 23.845 28.165000000000003 27.01 20.979999999999997 70-74 24.085 27.485 27.595 20.835 75-79 24.127921525449178 28.006606275962163 27.300935889094642 20.56453630949402 80-84 24.55 28.15 27.24 20.06 85-89 24.765 27.339999999999996 27.189999999999998 20.705000000000002 90-94 23.895 27.365000000000002 28.04 20.7 95-99 23.805 27.52 27.93 20.745 100-104 24.645 27.485 27.450000000000003 20.419999999999998 105-109 24.490000000000002 27.185 27.51 20.815 110-114 24.145 27.815 27.229999999999997 20.810000000000002 115-119 24.125 28.24 26.945000000000004 20.69 120-124 24.395 27.715 26.840000000000003 21.05 125-129 24.145 27.525 27.894999999999996 20.435 130-134 24.765 27.150000000000002 27.139999999999997 20.945 135-139 24.185000000000002 27.389999999999997 27.235 21.19 140-144 24.185000000000002 28.08 27.400000000000002 20.335 145-149 24.60333400281181 27.13898373167303 27.550712994577225 20.70696927093794 150-151 23.802319717599595 27.319717599596572 27.874432677760968 21.003530005042865 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 3.5 27 2.5 28 3.0 29 4.0 30 4.0 31 12.0 32 19.0 33 19.0 34 30.5 35 44.5 36 58.5 37 87.5 38 121.5 39 151.5 40 185.5 41 222.5 42 252.5 43 288.0 44 286.0 45 275.0 46 288.5 47 286.5 48 251.0 49 211.5 50 189.5 51 155.0 52 128.5 53 100.5 54 72.5 55 64.5 56 56.0 57 36.5 58 21.5 59 15.5 60 11.5 61 9.0 62 7.5 63 8.0 64 6.0 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.095 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.42 150-151 0.8500000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138-139 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGACC 10 0.0068396386 144.9375 2 >>END_MODULE Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842722 spots for SRR7169088.sra Written 842722 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra Read 842708 spots for SRR7169088.sra Written 842708 spots for SRR7169088.sra SRR ids: ['SRR7169088.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mkh65rqx SRR7169088.sra spots: 16854174 blocks: [[1, 842708], [842709, 1685416], [1685417, 2528124], [2528125, 3370832], [3370833, 4213540], [4213541, 5056248], [5056249, 5898956], [5898957, 6741664], [6741665, 7584372], [7584373, 8427080], [8427081, 9269788], [9269789, 10112496], [10112497, 10955204], [10955205, 11797912], [11797913, 12640620], [12640621, 13483328], [13483329, 14326036], [14326037, 15168744], [15168745, 16011452], [16011453, 16854174]] SRR7169088 file size 5689626 SRR7169088 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169088 SRR7169088_1.fastq SRR7169088_2.fastq Input file: SRR7169088_1.fastq Paired file: SRR7169088_2.fastq trimmed: SRR7169088-trimmed-pair1.fastq, SRR7169088-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:25:17 2025 >> started Mon Feb 10 20:25:40 2025 >> done (23.745s) 16854174 read pairs processed; of these: 20530 ( 0.12%) short read pairs filtered out after trimming by size control 17068 ( 0.10%) empty read pairs filtered out after trimming by size control 16816576 (99.78%) read pairs available; of these: 6945394 (41.30%) trimmed read pairs available after processing 9871182 (58.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 3 0.00% 21 6 0.00% 22 3 0.00% 23 4 0.00% 24 6 0.00% 25 5 0.00% 26 7 0.00% 27 12 0.00% 28 12 0.00% 29 6 0.00% 30 7 0.00% 31 7 0.00% 32 8 0.00% 33 4 0.00% 34 12 0.00% 35 12 0.00% 36 22 0.00% 37 13 0.00% 38 17 0.00% 39 12 0.00% 40 16 0.00% 41 18 0.00% 42 16 0.00% 43 21 0.00% 44 20 0.00% 45 26 0.00% 46 29 0.00% 47 37 0.00% 48 24 0.00% 49 28 0.00% 50 41 0.00% 51 43 0.00% 52 35 0.00% 53 44 0.00% 54 62 0.00% 55 65 0.00% 56 68 0.00% 57 69 0.00% 58 73 0.00% 59 75 0.00% 60 84 0.00% 61 104 0.00% 62 120 0.00% 63 122 0.00% 64 123 0.00% 65 143 0.00% 66 131 0.00% 67 143 0.00% 68 200 0.00% 69 212 0.00% 70 256 0.00% 71 298 0.00% 72 287 0.00% 73 326 0.00% 74 393 0.00% 75 430 0.00% 76 420 0.00% 77 519 0.00% 78 524 0.00% 79 598 0.00% 80 695 0.00% 81 771 0.00% 82 880 0.01% 83 1071 0.01% 84 2004 0.01% 85 2569 0.02% 86 2523 0.02% 87 2669 0.02% 88 2779 0.02% 89 2877 0.02% 90 3030 0.02% 91 3136 0.02% 92 3303 0.02% 93 3497 0.02% 94 3659 0.02% 95 3978 0.02% 96 4119 0.02% 97 4425 0.03% 98 4663 0.03% 99 4856 0.03% 100 5208 0.03% 101 5424 0.03% 102 5761 0.03% 103 6071 0.04% 104 6555 0.04% 105 7077 0.04% 106 7497 0.04% 107 7906 0.05% 108 8487 0.05% 109 8825 0.05% 110 9349 0.06% 111 10172 0.06% 112 10752 0.06% 113 11369 0.07% 114 12163 0.07% 115 13221 0.08% 116 13597 0.08% 117 14635 0.09% 118 15498 0.09% 119 16268 0.10% 120 17202 0.10% 121 17958 0.11% 122 19138 0.11% 123 20465 0.12% 124 21628 0.13% 125 23197 0.14% 126 24564 0.15% 127 26565 0.16% 128 28066 0.17% 129 29734 0.18% 130 31470 0.19% 131 34035 0.20% 132 36874 0.22% 133 39916 0.24% 134 42872 0.25% 135 46664 0.28% 136 50838 0.30% 137 55143 0.33% 138 61761 0.37% 139 68052 0.40% 140 74467 0.44% 141 82888 0.49% 142 96404 0.57% 143 103541 0.62% 144 120773 0.72% 145 145019 0.86% 146 181052 1.08% 147 247756 1.47% 148 377105 2.24% 149 770132 4.58% 150 3790347 22.54% 151 9871182 58.70% 16816576 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=42 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=195.00 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=15.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.49 fanout-score-rank=18 prefix-density=0.30 prefix-fanout=4.4 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=58.39 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=13.2 sequence=TGTTGGTGGTGG SRR7169088 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:26:49 Started mapping on | Feb 10 20:26:50 Finished on | Feb 10 20:29:16 Mapping speed, Million of reads per hour | 414.66 Number of input reads | 16816576 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15280254 Uniquely mapped reads % | 90.86% Average mapped length | 292.51 Number of splices: Total | 14831247 Number of splices: Annotated (sjdb) | 14607340 Number of splices: GT/AG | 14616158 Number of splices: GC/AG | 173364 Number of splices: AT/AC | 11626 Number of splices: Non-canonical | 30099 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300187 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 28501 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.14% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1256071 1256071 1256071 N_multimapping 300187 300187 300187 N_noFeature 255803 15127067 309604 N_ambiguous 171034 1089 70876 UnstrandedReadsAssigned:14853417 PositiveStrandReadsAssigned:152098 NegativeStrandReadsAssigned:14899774 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169088 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169088-trimmed-pair1.fastq SRR7169088-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,816,576 reads, 15,106,947 reads pseudoaligned [quant] estimated average fragment length: 264.899 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,287 rounds 52401 SRR7169088.ke.tsv 34699 SRR7169088.se.tsv 87100 total ==> SRR7169088.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.1 279 9.00018 Potri.005G024800.1.v4.1 1035 771.101 43 3.15543 Potri.004G059700.1.v4.1 961 697.134 3 0.243504 Potri.007G009000.2.v4.1 1416 1152.1 0 0 Potri.003G141000.2.v4.1 2943 2679.1 299 6.31515 Potri.016G087400.1.v4.1 270 63.5975 1454.05 1293.72 Potri.015G069301.1.v4.1 564 304.747 0 0 Potri.010G195200.1.v4.1 1773 1509.1 6 0.224975 Potri.012G127500.1.v4.1 977 713.112 6656 528.15 ==> SRR7169088.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 957 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169088 completed mapping pipeline successfully